Accession ID: MIRT019372 [miRNA, hsa-miR-148b-3p :: NR3C2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-148bLinkOut: [miRBase ]
Synonyms MIRN148B, mir-148b, MIR148B
Description Homo sapiens miR-148b stem-loop
Comment This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-148b-3p
Mature Sequence 63| UCAGUGCAUCACAGAACUUUGU |84
Evidence Experimental
Experiments Cloned
Putative hsa-miR-148b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NR3C2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ41052, MCR, MGC133092, MLR, MR, NR3C2VIT
Description nuclear receptor subfamily 3, group C, member 2
Transcript NM_0009    LinkOut: [ RefSeq ]
Other Transcripts NM_0011661   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NR3C2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NR3C2
(miRNA target sites are highlighted)
>NR3C2|NM_0009|3'UTR
   1 TGACTGCCCGCTGCCCAGAAGAACTTTGCCTTAAGTTTCCCTGTGTTGTTCCACACCCAGAAGGACCCAAGAAAACCTGT
  81 TTTTAACATGTGATGGTTGATTCACACTTGTTCAACAGTTTCTCAAGTTTAAAGTCATGTCAGAGGTTTGGAGCCGGGAA
 161 AGCTGTTTTTCCGTGGATTTGGCGAGACCAGAGCAGTCTGAAGGATTCCCCACCTCCAATCCCCCAGCGCTTAGAAACAT
 241 GTTCCTGTTCCTCGGGATGAAAAGCCATATCTAGTCAATAACTCTGATTTTGATATTTTCACAGATGGAAGAAGTTTTAA
 321 CTATGCCGTGTAGTTTCTGGTATCGTTCGCTTGTTTTAAAAGGGTTCAAGGACTAACGAACGTTTTAAAGCTTACCCTTG
 401 GTTTGCACATAAAACGTATAGTCAATATGGGGCATTAATATTCTTTTGTTATTAAAAAAACACAAAAAAATAATAAAAAA
 481 ATATATACAGATTCCTGTTGTGTAATAACAGAACTCGTGGCGTGGGGCAGCAGCTGCCTCTGAGCCCTCGCTCGTCCACG
 561 GTCTTCTGCATCACTGGTATACACACTCGTTAGCGTCCATTTCTTATTTAATTAGAATGGATAAGATGATGTTAAATGCC
 641 TTGGTTTGATTTCTAGTATCTATTGTGTTGGCTTTACAAATAATTTTTTGCAGTCTTTTGCTGTGCTGTACATTACTGTA
 721 TGTATAAATTATGAAGGACCTGAAATAAGGTATAAGGATCTTTTGTAAATGAGACACATACAAAAAAAATCTTTAATGGT
 801 TAATAGGATGAATGGGAAAGTATTTTTGAAAGAATTCTATTTTGCTGGAGACTATTTAAGTACTATCTTTGTCTAAACAA
 881 GGTAATTTTTTTTTGTAAAGTGCAATGTCCTGCATGCATAATGAACCGTTTACAGTGTATTTAAGAAAGGGAAAGCTGTG
 961 CCTTTTTTAGCTTCATATCTAATTTACCATTATTTTACAGTCTCTGTTGTAAATAACCACACTGAAACCTCTTCGGTTGT
1041 CTTGAAACCTTTCTACTTTTTCTGTACTTTTTGTTTTGTTCTTGGTCTCCCGCTTGGGGCATTTGTGGGACTCCAGCACG
1121 TTTTCTGGCTTCTGCTTCATCCTGCTCCATCGGGGAATGACACACTGCGGTGTCTGCAGCTCCTGGAAGGTGTCATTTGA
1201 CAACACATGTGGGAGAGGAGGTCCTTGGAGTGCTGCAGCTTTGGGAAAGCTGCCTCGTTTCCCTTTTCCTCTAGAAGCAG
1281 AACCAGCTCTACGAGAGTGAGACTGGGAACTTGATGGCTCAGAGAGCATCTTTTCCTCCCATTTTAGAAAATCAGATTTT
1361 CTCCTGTGGGAAAAAAAAATTCCATGCACTCTCTCTCTGTTAAAGATCAGCTATTCCCTTCTGATCTTGGAAAGAGGTTC
1441 TGCACTCCTGGAACCGGTCACAGGAACGCACAGATCATGGCAGGATGCGCTGGGACGGCCCATCTTGGCAAGGTTCAGTC
1521 TGAATGGCATGGAGACCGGGAGATAGAGGGGTTTTAGATTTTTAAAAGGTAGGTTTTAAAAATAAGTTTTATACATAAAC
1601 AGTTTTGGAGAAAAATTACAGATCATATAAGCAAGACAGTGGCACTAAAATGTTTAATTCATTAATCTGTTTGTTTGGCA
1681 CTGATGCAATGTATGGCTTTTCTCTTGCCCCAAATCACAAACATATGTATCTTTGGGGAAACTAACAATATGATTGCACT
1761 AAATAAACTACTTTGAATAGAGGCCAAATTAATCTTTTAAAAATGATGATAATCATCAGGTTTACTCAGTGAAATCATAT
1841 TAATTATTTTCCAAAATCTAAAAGCTGTAGCTGGAGAAGCCCATGGCCACGAGGAAGCAGCAATTAATTAGATCAACACT
1921 TTTCTCCAGGGTTCACCATGCAGGCAACATTACCTTGTCTTTCAAAAGACACCTGCCTTATGCAAGGGGAAACCTGTGAA
2001 AGCTGCACTCAGAGGGAGGAGTTTTTCTTACATAATTTGCAATTTCAGGAATTTAATTTATAGGCAGATCTTTAAATACA
2081 GTCAACTTACGGTGCACAGTAATATGAAAGCCACACTTTGAAGGTAATAAATACACAGCATGCAGACTGGGAGTTGCTAG
2161 CAAACAAATGGCTTACTTACAAAAGCAGCTTTTAGTTCAGACTTAGTTTTTATAAAATGGGAATTCTGACTTACTTAACC
2241 AGGTTTGGGATGGAGATGGTCTGCATCAGCTTTTTGTATTAACAAAGTTACTGGCTCTTTGTGTGTCTCCAGGTAACTTT
2321 GCTTGATTAAACAGCAAAGCCATATTCTAAATTCACTGTTGAATGCCTGTCCCAGTCCAAATTGTCTGTCTGCTCTTATT
2401 TTTGTACCATATTGCTCTTAAAAATCTTGGTTTGGTACAGTTCATAATTCACCAAAAGTTCATATAATTTAAAGAAACAC
2481 TAAATTAGTTTAAAATGAAGCAATTTATATCTTTATGCAAAAACATATGTCTGTCTTTGCAAAGGACTGTAAGCAGATTA
2561 CAATAAATCCTTTACTTTAATCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugUUUCAAG-AC---ACUACGUGACu 5'
            | || || ||    |||||:||| 
Target 5' gcACAGATCATGGCAGGATGCGCTGg 3'
1468 - 1493 140.00 -18.30
2
miRNA  3' ugUUUCAAGACACU----ACGUGAcu 5'
            |||   ||||||    ||||||  
Target 5' ggAAA--CCTGTGAAAGCTGCACTca 3'
1988 - 2011 138.00 -12.30
3
miRNA  3' ugUUUCAAGACACUACGUGAcu 5'
            ||| |||    |||||||  
Target 5' aaAAAATTC---CATGCACTct 3'
1374 - 1392 137.00 -6.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-148b-3p :: NR3C2    [ Functional MTI ]
Validation Method Microarray
Article - Grimson, A. Farh, K. K. Johnston, W. K. et al.
- Mol Cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
285 hsa-miR-148b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000295 HLA-G major histocompatibility complex, class I, G 2 1
MIRT005759 CCKBR cholecystokinin B receptor 3 2
MIRT007314 ITGA5 integrin, alpha 5 (fibronectin receptor, alpha polypeptide) 1 1
MIRT007315 ROCK1 Rho-associated, coiled-coil containing protein kinase 1 1 1
MIRT007316 PIK3CA phosphoinositide-3-kinase, catalytic, alpha polypeptide 1 1
MIRT007317 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 1 1
MIRT007318 CSF1 colony stimulating factor 1 (macrophage) 1 1
MIRT019247 RAB3B RAB3B, member RAS oncogene family 1 1
MIRT019248 TRDN triadin 1 1
MIRT019249 KLRK1 killer cell lectin-like receptor subfamily K, member 1 1 1
MIRT019250 SPINT4 serine peptidase inhibitor, Kunitz type 4 1 1
MIRT019251 GFRA1 GDNF family receptor alpha 1 1 1
MIRT019252 MYF5 myogenic factor 5 1 1
MIRT019253 AGTR2 angiotensin II receptor, type 2 1 1
MIRT019254 SYNE2 spectrin repeat containing, nuclear envelope 2 1 1
MIRT019255 RHOF ras homolog gene family, member F (in filopodia) 1 1
MIRT019256 OR1A1 olfactory receptor, family 1, subfamily A, member 1 1 1
MIRT019257 PSG2 pregnancy specific beta-1-glycoprotein 2 1 1
MIRT019258 ADAM33 ADAM metallopeptidase domain 33 1 1
MIRT019259 LCN9 lipocalin 9 1 1
MIRT019260 SAG S-antigen; retina and pineal gland (arrestin) 1 1
MIRT019261 LAMC2 laminin, gamma 2 1 1
MIRT019262 PCDHA4 protocadherin alpha 4 1 1
MIRT019263 CLUAP1 clusterin associated protein 1 1 1
MIRT019264 PLXDC2 plexin domain containing 2 1 1
MIRT019265 CCNC cyclin C 1 1
MIRT019266 LIPC lipase, hepatic 1 1
MIRT019267 MEP1B meprin A, beta 1 1
MIRT019268 TEX13A testis expressed 13A 1 1
MIRT019269 NCKIPSD NCK interacting protein with SH3 domain 1 1
MIRT019270 CPNE5 copine V 1 1
MIRT019271 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT019272 YPEL1 yippee-like 1 (Drosophila) 1 1
MIRT019273 MCM10 minichromosome maintenance complex component 10 1 1
MIRT019274 SUMF2 sulfatase modifying factor 2 1 1
MIRT019275 GSTCD glutathione S-transferase, C-terminal domain containing 1 1
MIRT019276 TGM7 transglutaminase 7 1 1
MIRT019277 BTNL3 butyrophilin-like 3 1 1
MIRT019278 KLRC1 killer cell lectin-like receptor subfamily C, member 1 1 1
MIRT019279 CLSPN claspin homolog (Xenopus laevis) 1 1
MIRT019280 TUBAL3 tubulin, alpha-like 3 1 1
MIRT019281 CSTF2T cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant 1 1
MIRT019282 FBXW11 F-box and WD repeat domain containing 11 1 1
MIRT019283 APBB2 amyloid beta (A4) precursor protein-binding, family B, member 2 1 1
MIRT019284 KLHL12 kelch-like 12 (Drosophila) 1 1
MIRT019285 ENPP6 ectonucleotide pyrophosphatase/phosphodiesterase 6 1 1
MIRT019286 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT019287 MRPL28 mitochondrial ribosomal protein L28 1 1
MIRT019288 EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) 1 1
MIRT019289 LHCGR luteinizing hormone/choriogonadotropin receptor 1 1
MIRT019290 YPEL4 yippee-like 4 (Drosophila) 1 1
MIRT019291 PRKD3 protein kinase D3 1 1
MIRT019292 NIN ninein (GSK3B interacting protein) 1 1
MIRT019293 ADAMTS6 ADAM metallopeptidase with thrombospondin type 1 motif, 6 1 1
MIRT019294 IGSF10 immunoglobulin superfamily, member 10 1 1
MIRT019295 FLOT2 flotillin 2 1 1
MIRT019296 DCK deoxycytidine kinase 1 1
MIRT019297 NOL10 nucleolar protein 10 1 1
MIRT019298 CDH20 cadherin 20, type 2 1 1
MIRT019299 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT019300 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT019301 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 1 1
MIRT019302 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT019303 C15orf27 chromosome 15 open reading frame 27 1 1
MIRT019304 UGT8 UDP glycosyltransferase 8 1 1
MIRT019305 DLG2 discs, large homolog 2 (Drosophila) 1 1
MIRT019306 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT019307 USP33 ubiquitin specific peptidase 33 1 1
MIRT019308 ZDHHC17 zinc finger, DHHC-type containing 17 2 2
MIRT019309 SESTD1 SEC14 and spectrin domains 1 1 1
MIRT019310 UHMK1 U2AF homology motif (UHM) kinase 1 1 1
MIRT019311 DLX6 distal-less homeobox 6 1 1
MIRT019312 HAVCR1 hepatitis A virus cellular receptor 1 1 1
MIRT019313 ZCCHC2 zinc finger, CCHC domain containing 2 1 1
MIRT019314 SUMF1 sulfatase modifying factor 1 1 1
MIRT019315 CCL11 chemokine (C-C motif) ligand 11 1 1
MIRT019316 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT019317 RHOV ras homolog gene family, member V 1 1
MIRT019318 PROX1 prospero homeobox 1 1 1
MIRT019319 BPGM 2,3-bisphosphoglycerate mutase 1 1
MIRT019320 KHDRBS2 KH domain containing, RNA binding, signal transduction associated 2 1 1
MIRT019321 MKX mohawk homeobox 1 1
MIRT019322 CAPN13 calpain 13 1 1
MIRT019323 PDZK1 PDZ domain containing 1 1 1
MIRT019324 PIH1D3 chromosome X open reading frame 41 1 1
MIRT019325 PPP1R3A protein phosphatase 1, regulatory (inhibitor) subunit 3A 1 1
MIRT019326 CCL17 chemokine (C-C motif) ligand 17 1 1
MIRT019327 IZUMO2 chromosome 19 open reading frame 41 1 1
MIRT019328 PDSS1 prenyl (decaprenyl) diphosphate synthase, subunit 1 1 1
MIRT019329 CTHRC1 collagen triple helix repeat containing 1 1 1
MIRT019330 ALPI alkaline phosphatase, intestinal 1 1
MIRT019331 CCL19 chemokine (C-C motif) ligand 19 1 1
MIRT019332 MAST1 microtubule associated serine/threonine kinase 1 1 1
MIRT019333 NDN necdin homolog (mouse) 1 1
MIRT019334 STS steroid sulfatase (microsomal), isozyme S 1 1
MIRT019335 LPL lipoprotein lipase 1 1
MIRT019336 LACRT lacritin 1 1
MIRT019337 ZDHHC15 zinc finger, DHHC-type containing 15 1 1
MIRT019338 GDF9 growth differentiation factor 9 1 1
MIRT019339 RASSF6 Ras association (RalGDS/AF-6) domain family member 6 1 1
MIRT019340 SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1 1
MIRT019341 RHAG Rh-associated glycoprotein 1 1
MIRT019342 ATP10B ATPase, class V, type 10B 1 1
MIRT019343 CALN1 calneuron 1 1 1
MIRT019344 GPHB5 glycoprotein hormone beta 5 1 1
MIRT019345 AGGF1 angiogenic factor with G patch and FHA domains 1 1 1
MIRT019346 TPTE2 transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 1 1
MIRT019347 APBA2 amyloid beta (A4) precursor protein-binding, family A, member 2 1 1
MIRT019348 TMEM47 transmembrane protein 47 1 1
MIRT019349 PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide 1 1
MIRT019350 PSG9 pregnancy specific beta-1-glycoprotein 9 1 1
MIRT019351 SYNE1 spectrin repeat containing, nuclear envelope 1 1 1
MIRT019352 ZCCHC5 zinc finger, CCHC domain containing 5 1 1
MIRT019353 KCNJ6 potassium inwardly-rectifying channel, subfamily J, member 6 1 1
MIRT019354 FCAR Fc fragment of IgA, receptor for 1 1
MIRT019355 SSR3 signal sequence receptor, gamma (translocon-associated protein gamma) 1 1
MIRT019356 APBB1 amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) 1 1
MIRT019357 SPZ1 spermatogenic leucine zipper 1 1 1
MIRT019358 HRH4 histamine receptor H4 1 1
MIRT019359 PROKR2 prokineticin receptor 2 1 1
MIRT019360 NLGN4X neuroligin 4, X-linked 1 1
MIRT019361 MYOM1 myomesin 1, 185kDa 1 1
MIRT019362 LOXL1 lysyl oxidase-like 1 1 1
MIRT019363 STON2 stonin 2 1 1
MIRT019364 ACACB acetyl-CoA carboxylase beta 1 1
MIRT019365 RUNX3 runt-related transcription factor 3 1 1
MIRT019366 FETUB fetuin B 1 1
MIRT019367 GPR143 G protein-coupled receptor 143 1 1
MIRT019368 HMOX1 heme oxygenase (decycling) 1 1 1
MIRT019369 SLCO4C1 solute carrier organic anion transporter family, member 4C1 1 1
MIRT019370 TUBA8 tubulin, alpha 8 1 1
MIRT019371 RFX3 regulatory factor X, 3 (influences HLA class II expression) 1 1
MIRT019372 NR3C2 nuclear receptor subfamily 3, group C, member 2 1 1
MIRT019373 NCS1 neuronal calcium sensor 1 1 1
MIRT019374 C1orf168 chromosome 1 open reading frame 168 1 1
MIRT019375 ITSN2 intersectin 2 1 1
MIRT019376 GMPPB GDP-mannose pyrophosphorylase B 1 1
MIRT019377 MARCH2 membrane-associated ring finger (C3HC4) 2 1 1
MIRT019378 SLC22A5 solute carrier family 22 (organic cation/carnitine transporter), member 5 1 1
MIRT019379 RGMA RGM domain family, member A 1 1
MIRT019380 FAM81A family with sequence similarity 81, member A 1 1
MIRT019381 MTMR10 myotubularin related protein 10 1 1
MIRT019382 FBXO28 F-box protein 28 1 1
MIRT019383 PTGER2 prostaglandin E receptor 2 (subtype EP2), 53kDa 1 1
MIRT019384 SLC39A11 solute carrier family 39 (metal ion transporter), member 11 1 1
MIRT019385 VPS37A vacuolar protein sorting 37 homolog A (S. cerevisiae) 1 1
MIRT019386 LYSMD1 LysM, putative peptidoglycan-binding, domain containing 1 1 1
MIRT019387 CYB5R4 cytochrome b5 reductase 4 1 1
MIRT019388 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT019389 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 1
MIRT019390 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 1 1
MIRT019391 NPEPL1 aminopeptidase-like 1 1 1
MIRT019392 DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) 1 1
MIRT019393 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT019394 LRP4 low density lipoprotein receptor-related protein 4 1 1
MIRT019395 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT019396 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT019397 ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 1 1
MIRT019398 PRNP prion protein 1 1
MIRT019399 C3orf58 chromosome 3 open reading frame 58 1 1
MIRT019400 RNF219 ring finger protein 219 1 1
MIRT019401 USP48 ubiquitin specific peptidase 48 1 1
MIRT019402 ATP6AP2 ATPase, H+ transporting, lysosomal accessory protein 2 1 1
MIRT019403 CUL5 cullin 5 1 1
MIRT019404 OSBPL11 oxysterol binding protein-like 11 1 1
MIRT019405 OSBP2 oxysterol binding protein 2 1 1
MIRT019406 CA10 carbonic anhydrase X 1 1
MIRT019407 TMPRSS11A transmembrane protease, serine 11A 1 1
MIRT019408 AVPI1 arginine vasopressin-induced 1 1 1
MIRT019409 CIDEA cell death-inducing DFFA-like effector a 1 1
MIRT019410 MORF4L1 mortality factor 4 like 1 1 1
MIRT019411 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif, 4 1 1
MIRT019412 DPT dermatopontin 1 1
MIRT019413 PNLIPRP2 pancreatic lipase-related protein 2 1 1
MIRT019414 BIK BCL2-interacting killer (apoptosis-inducing) 1 1
MIRT019415 FXYD2 FXYD domain containing ion transport regulator 2 1 1
MIRT019416 KCNQ2 potassium voltage-gated channel, KQT-like subfamily, member 2 1 1
MIRT019417 PKP1 plakophilin 1 (ectodermal dysplasia/skin fragility syndrome) 1 1
MIRT019418 FSCB fibrous sheath CABYR binding protein 1 1
MIRT019419 C8orf47 chromosome 8 open reading frame 47 1 1
MIRT019420 IQCG IQ motif containing G 1 1
MIRT019421 LPHN2 latrophilin 2 1 1
MIRT019422 LINC00521 chromosome 14 open reading frame 48 1 1
MIRT019423 IL13RA2 interleukin 13 receptor, alpha 2 1 1
MIRT019424 HLA-A major histocompatibility complex, class I, A 1 1
MIRT019425 C12orf40 chromosome 12 open reading frame 40 1 1
MIRT019426 C17orf77 chromosome 17 open reading frame 77 1 1
MIRT019427 ROPN1L ropporin 1-like 1 1
MIRT019428 TKTL2 transketolase-like 2 1 1
MIRT019429 MTX3 metaxin 3 1 1
MIRT019430 TMEM14A transmembrane protein 14A 1 1
MIRT019431 CKLF chemokine-like factor 1 1
MIRT019432 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT019433 MUC13 mucin 13, cell surface associated 1 1
MIRT019434 CPNE4 copine IV 1 1
MIRT019435 CD300A CD300a molecule 1 1
MIRT019436 BAX BCL2-associated X protein 1 1
MIRT019437 SLC32A1 solute carrier family 32 (GABA vesicular transporter), member 1 1 1
MIRT019438 GDNF glial cell derived neurotrophic factor 1 1
MIRT019439 GTSF1L gametocyte specific factor 1-like 1 1
MIRT019440 RNF150 ring finger protein 150 1 1
MIRT019441 UTS2 urotensin 2 1 1
MIRT019442 KCTD14 potassium channel tetramerisation domain containing 14 1 1
MIRT019443 NTN1 netrin 1 1 1
MIRT019444 SLC22A3 solute carrier family 22 (extraneuronal monoamine transporter), member 3 1 1
MIRT019445 SNAI2 snail homolog 2 (Drosophila) 1 1
MIRT019446 NME5 non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) 1 1
MIRT019447 IGFBPL1 insulin-like growth factor binding protein-like 1 1 1
MIRT019448 IL21R interleukin 21 receptor 1 1
MIRT019449 ANKUB1 chromosome 3 open reading frame 16 1 1
MIRT019450 SERAC1 serine active site containing 1 1 1
MIRT019451 HEMGN hemogen 1 1
MIRT019452 TPGS2 chromosome 18 open reading frame 10 1 1
MIRT019453 CXCL5 chemokine (C-X-C motif) ligand 5 1 1
MIRT019454 POU4F3 POU class 4 homeobox 3 1 1
MIRT019455 ALDH3B2 aldehyde dehydrogenase 3 family, member B2 1 1
MIRT019456 HEY2 hairy/enhancer-of-split related with YRPW motif 2 1 1
MIRT019457 INHBA inhibin, beta A 1 1
MIRT019458 MT4 metallothionein 4 1 1
MIRT019459 RPIA ribose 5-phosphate isomerase A 1 1
MIRT019460 KCNJ16 potassium inwardly-rectifying channel, subfamily J, member 16 1 1
MIRT019461 ASB13 ankyrin repeat and SOCS box-containing 13 1 1
MIRT019462 DSG1 desmoglein 1 1 1
MIRT019463 EYA4 eyes absent homolog 4 (Drosophila) 1 1
MIRT019464 CPA3 carboxypeptidase A3 (mast cell) 1 1
MIRT019465 C6orf211 chromosome 6 open reading frame 211 1 1
MIRT019466 CCL28 chemokine (C-C motif) ligand 28 1 1
MIRT019467 PNPLA2 patatin-like phospholipase domain containing 2 1 1
MIRT019468 RORC RAR-related orphan receptor C 1 1
MIRT019469 ABCA13 ATP-binding cassette, sub-family A (ABC1), member 13 1 1
MIRT019470 HMGB3 high-mobility group box 3 1 1
MIRT019471 FOXN4 forkhead box N4 1 1
MIRT019472 SLC25A18 solute carrier family 25 (mitochondrial carrier), member 18 1 1
MIRT019473 KIF2C kinesin family member 2C 1 1
MIRT019474 SOX11 SRY (sex determining region Y)-box 11 1 1
MIRT019475 CCDC92 coiled-coil domain containing 92 1 1
MIRT019476 SLC6A19 solute carrier family 6 (neutral amino acid transporter), member 19 1 1
MIRT019477 NOX4 NADPH oxidase 4 1 1
MIRT019478 LCA5 Leber congenital amaurosis 5 1 1
MIRT019479 MATN3 matrilin 3 1 1
MIRT019480 DNAH3 dynein, axonemal, heavy chain 3 1 1
MIRT019481 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 1 1
MIRT019482 PPP2R3A protein phosphatase 2, regulatory subunit B', alpha 1 1
MIRT019483 ST6GALNAC5 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5 1 1
MIRT019484 TOM1L2 target of myb1-like 2 (chicken) 1 1
MIRT019485 AHI1 Abelson helper integration site 1 1 1
MIRT019486 TXNIP thioredoxin interacting protein 1 1
MIRT019487 KDM1B lysine (K)-specific demethylase 1B 1 1
MIRT019488 STEAP4 STEAP family member 4 1 1
MIRT019489 CLCN3 chloride channel 3 1 1
MIRT019490 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa 1 1
MIRT019491 RTN4 reticulon 4 1 1
MIRT019492 ZPLD1 zona pellucida-like domain containing 1 1 1
MIRT019493 CRISP1 cysteine-rich secretory protein 1 1 1
MIRT019494 NXPE3 family with sequence similarity 55, member C 1 1
MIRT019495 ATP7A ATPase, Cu++ transporting, alpha polypeptide 1 1
MIRT019496 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 1 1
MIRT019497 LEPROTL1 leptin receptor overlapping transcript-like 1 1 1
MIRT019498 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT019499 TOMM70A translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae) 1 1
MIRT019500 AP4E1 adaptor-related protein complex 4, epsilon 1 subunit 1 1
MIRT035564 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 1 1
MIRT043575 ND2 MTND2 1 1
MIRT043576 IGSF1 immunoglobulin superfamily, member 1 1 1
MIRT043577 COX7A2 cytochrome c oxidase subunit VIIa polypeptide 2 (liver) 1 1
MIRT043578 RBM8A RNA binding motif protein 8A 1 1
MIRT043579 LARP4 La ribonucleoprotein domain family, member 4 1 1
MIRT043580 PCNX pecanex homolog (Drosophila) 1 1
MIRT043581 TUBG1 tubulin, gamma 1 1 1
MIRT043582 H2AFY H2A histone family, member Y 1 1
MIRT043583 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 1
MIRT043584 H2AFZ H2A histone family, member Z 1 1
MIRT043585 KIAA2013 KIAA2013 1 1
MIRT043586 SYNCRIP synaptotagmin binding, cytoplasmic RNA interacting protein 1 1
MIRT043587 HMGB1 high-mobility group box 1 1 1
MIRT043588 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 1 1
MIRT043589 KLF6 Kruppel-like factor 6 1 1
MIRT043590 GLI3 GLI family zinc finger 3 1 1
MIRT043591 SRSF10 splicing factor, arginine/serine-rich 13A 1 1
MIRT043592 NONO non-POU domain containing, octamer-binding 1 1
MIRT043593 TACC1 transforming, acidic coiled-coil containing protein 1 1 1
MIRT043594 SIRT4 sirtuin (silent mating type information regulation 2 homolog) 4 (S. cerevisiae) 1 1
MIRT043595 TMEM66 transmembrane protein 66 1 1
MIRT043596 EML4 echinoderm microtubule associated protein like 4 1 1
MIRT043597 JMJD4 jumonji domain containing 4 1 1