Accession ID: MIRT019597 [miRNA, hsa-miR-340-5p :: TNFRSF10B, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-340LinkOut: [miRBase ]
Synonyms MIRN340, hsa-mir-340, MIR340
Description Homo sapiens miR-340 stem-loop
Comment This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-340-5p
Mature Sequence 16| UUAUAAAGCAAUGAGACUGAUU |37
Evidence Experimental
Experiments Cloned
Putative hsa-miR-340-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-340-5p :: TNFRSF10B    [ Functional MTI ]
Validation Method Sequencing
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
324 hsa-miR-340-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005458 MET met proto-oncogene (hepatocyte growth factor receptor) 4 1
MIRT019532 LMNA lamin A/C 1 1
MIRT019533 SLX4 SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae) 1 1
MIRT019534 ZIC5 Zic family member 5 1 1
MIRT019535 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT019536 OSBPL1A oxysterol binding protein-like 1A 1 1
MIRT019537 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT019538 ZNF776 zinc finger protein 776 1 1
MIRT019539 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 1
MIRT019540 RFWD3 ring finger and WD repeat domain 3 1 2
MIRT019541 KCTD20 potassium channel tetramerisation domain containing 20 1 1
MIRT019542 NKRF NFKB repressing factor 1 1
MIRT019543 CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 1 1
MIRT019544 BIVM basic, immunoglobulin-like variable motif containing 1 1
MIRT019545 ARHGAP12 Rho GTPase activating protein 12 1 1
MIRT019546 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 1
MIRT019547 GK5 glycerol kinase 5 (putative) 1 1
MIRT019548 LEPROT leptin receptor overlapping transcript 1 1
MIRT019549 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT019550 KIAA1586 KIAA1586 1 1
MIRT019551 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT019552 SCML2 sex comb on midleg-like 2 (Drosophila) 1 2
MIRT019553 SAMD12 sterile alpha motif domain containing 12 1 2
MIRT019554 CAPRIN2 caprin family member 2 1 3
MIRT019555 SERTAD2 SERTA domain containing 2 1 1
MIRT019556 REV3L REV3-like, polymerase (DNA directed), zeta, catalytic subunit 1 1
MIRT019557 MPHOSPH9 M-phase phosphoprotein 9 1 1
MIRT019558 SLC39A7 solute carrier family 39 (zinc transporter), member 7 1 1
MIRT019559 ZFYVE26 zinc finger, FYVE domain containing 26 1 3
MIRT019560 TMEM138 transmembrane protein 138 1 1
MIRT019561 ZCCHC2 zinc finger, CCHC domain containing 2 1 2
MIRT019562 GID8 GID complex subunit 8 homolog (S. cerevisiae) 1 1
MIRT019563 TUBB3 tubulin, beta 3 class III 1 1
MIRT019564 SIVA1 SIVA1, apoptosis-inducing factor 1 1
MIRT019565 ZNF35 zinc finger protein 35 1 1
MIRT019566 CTTN cortactin 1 1
MIRT019567 PPP1R14C protein phosphatase 1, regulatory (inhibitor) subunit 14C 1 1
MIRT019568 NUP50 nucleoporin 50kDa 1 1
MIRT019569 MINPP1 multiple inositol-polyphosphate phosphatase 1 1 1
MIRT019570 PIM3 pim-3 oncogene 1 1
MIRT019571 ECH1 enoyl CoA hydratase 1, peroxisomal 1 1
MIRT019572 MESDC1 mesoderm development candidate 1 1 1
MIRT019573 HSDL1 hydroxysteroid dehydrogenase like 1 1 1
MIRT019574 EFHD2 EF-hand domain family, member D2 1 1
MIRT019575 TES testis derived transcript (3 LIM domains) 1 1
MIRT019576 QSOX2 quiescin Q6 sulfhydryl oxidase 2 1 1
MIRT019577 GPX8 glutathione peroxidase 8 (putative) 1 1
MIRT019578 FBXO21 F-box protein 21 1 1
MIRT019579 YIPF2 Yip1 domain family, member 2 1 1
MIRT019580 DCTN5 dynactin 5 (p25) 1 1
MIRT019581 HOXA5 homeobox A5 1 1
MIRT019582 KLHL42 kelch domain containing 5 1 2
MIRT019583 ANKRD9 ankyrin repeat domain 9 1 1
MIRT019584 KIF11 kinesin family member 11 1 1
MIRT019585 TXLNG taxilin gamma 1 1
MIRT019586 CREBZF CREB/ATF bZIP transcription factor 1 1
MIRT019587 CCBL2 cysteine conjugate-beta lyase 2 1 1
MIRT019588 DDX5 DEAD (Asp-Glu-Ala-Asp) box helicase 5 1 2
MIRT019589 PTPDC1 protein tyrosine phosphatase domain containing 1 1 2
MIRT019590 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 1
MIRT019591 HOXA9 homeobox A9 1 2
MIRT019592 ZNF83 zinc finger protein 83 1 1
MIRT019593 ANKRD29 ankyrin repeat domain 29 1 1
MIRT019594 SLC16A14 solute carrier family 16, member 14 (monocarboxylic acid transporter 14) 1 1
MIRT019595 LRPPRC leucine-rich pentatricopeptide repeat containing 1 1
MIRT019596 C1orf198 chromosome 1 open reading frame 198 1 1
MIRT019597 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 1
MIRT019598 SYPL1 synaptophysin-like 1 1 1
MIRT019599 DEPDC1 DEP domain containing 1 1 1
MIRT019600 ZNF107 zinc finger protein 107 1 1
MIRT019601 AMOT angiomotin 1 1
MIRT019602 BBS10 Bardet-Biedl syndrome 10 1 1
MIRT019603 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 1 1
MIRT019604 SHCBP1 SHC SH2-domain binding protein 1 1 1
MIRT019605 SPIN4 spindlin family, member 4 1 1
MIRT019606 ELAVL1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) 1 1
MIRT019607 RBM8A RNA binding motif protein 8A 1 4
MIRT019608 BCL10 B-cell CLL/lymphoma 10 1 1
MIRT019609 GALNT3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3) 1 1
MIRT019610 CHMP4B charged multivesicular body protein 4B 1 1
MIRT019611 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT019612 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT019613 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT019614 SOWAHC sosondowah ankyrin repeat domain family member C 1 1
MIRT019615 TLX1 T-cell leukemia homeobox 1 1 1
MIRT019616 CD46 CD46 molecule, complement regulatory protein 1 1
MIRT019617 UBE2Z ubiquitin-conjugating enzyme E2Z 1 1
MIRT019618 CSDE1 cold shock domain containing E1, RNA-binding 1 2
MIRT019619 ITPR1 inositol 1,4,5-trisphosphate receptor, type 1 1 3
MIRT019620 ZFHX3 zinc finger homeobox 3 1 2
MIRT019621 KLF10 Kruppel-like factor 10 1 1
MIRT019622 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT019623 ATXN1 ataxin 1 1 1
MIRT019624 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT019625 HECTD2 HECT domain containing E3 ubiquitin protein ligase 2 1 1
MIRT019626 SMC3 structural maintenance of chromosomes 3 1 1
MIRT019627 MYLIP myosin regulatory light chain interacting protein 1 1
MIRT019628 ASF1A ASF1 anti-silencing function 1 homolog A (S. cerevisiae) 1 1
MIRT019629 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT019630 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT019631 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT019632 LBR lamin B receptor 1 1
MIRT019633 BTG3 BTG family, member 3 1 1
MIRT019634 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT019635 KDELC2 KDEL (Lys-Asp-Glu-Leu) containing 2 1 1
MIRT019636 OTUD1 OTU domain containing 1 1 1
MIRT019637 RIT1 Ras-like without CAAX 1 1 1
MIRT019638 SLC35G1 solute carrier family 35, member G1 1 1
MIRT019639 ACSL3 acyl-CoA synthetase long-chain family member 3 1 1
MIRT019640 BTBD10 BTB (POZ) domain containing 10 1 1
MIRT019641 FBXL3 F-box and leucine-rich repeat protein 3 1 1
MIRT019642 NET1 neuroepithelial cell transforming 1 1 1
MIRT019643 ANKRD40 ankyrin repeat domain 40 1 2
MIRT019644 PELI1 pellino E3 ubiquitin protein ligase 1 1 1
MIRT019645 PDE4D phosphodiesterase 4D, cAMP-specific 1 2
MIRT019646 SOX4 SRY (sex determining region Y)-box 4 1 5
MIRT019647 NEK7 NIMA (never in mitosis gene a)-related kinase 7 1 1
MIRT019648 RNF11 ring finger protein 11 1 2
MIRT019649 MCMBP minichromosome maintenance complex binding protein 1 1
MIRT019650 TMEM245 transmembrane protein 245 1 1
MIRT019651 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 1
MIRT019652 KAT6B K(lysine) acetyltransferase 6B 1 1
MIRT019653 KCNK1 potassium channel, subfamily K, member 1 1 1
MIRT053008 SOX2 SRY (sex determining region Y)-box 2 2 1
MIRT053525 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 2 1
MIRT053526 MECP2 methyl CpG binding protein 2 (Rett syndrome) 2 1
MIRT054396 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 3 1
MIRT054397 PTBP1 polypyrimidine tract binding protein 1 3 1
MIRT055997 ARL5B ADP-ribosylation factor-like 5B 1 1
MIRT058232 USP28 ubiquitin specific peptidase 28 1 1
MIRT060555 CCND1 cyclin D1 1 6
MIRT061192 MED17 mediator complex subunit 17 1 1
MIRT061278 IPO7 importin 7 1 1
MIRT064860 ZBTB18 zinc finger protein 238 1 1
MIRT066168 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase, type II, gamma 1 1
MIRT071502 CALM1 calmodulin 1 (phosphorylase kinase, delta) 1 1
MIRT086182 CDCA7 cell division cycle associated 7 1 2
MIRT088050 UBXN2A UBX domain protein 2A 1 2
MIRT088450 LCLAT1 lysocardiolipin acyltransferase 1 1 1
MIRT088567 SRSF7 serine/arginine-rich splicing factor 7 1 1
MIRT089582 MAT2A methionine adenosyltransferase II, alpha 1 2
MIRT090643 U2SURP U2 snRNP-associated SURP domain containing 1 3
MIRT096489 BRIX1 BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) 1 1
MIRT103637 HOXA10 homeobox A10 1 3
MIRT109460 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT109882 BCOR BCL6 corepressor 1 1
MIRT127016 FAM208B family with sequence similarity 208, member B 1 1
MIRT157714 CAB39 calcium binding protein 39 1 1
MIRT166963 FCHO2 FCH domain only 2 1 1
MIRT178641 SLC30A7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT192772 B2M beta-2-microglobulin 1 1
MIRT195013 ATXN2L ataxin 2-like 1 1
MIRT202871 GREB1 growth regulation by estrogen in breast cancer 1 1 1
MIRT208659 EIF2A eukaryotic translation initiation factor 2A, 65kDa 1 1
MIRT209920 SNRK SNF related kinase 1 6
MIRT217322 FOXO3 forkhead box O3 1 2
MIRT227249 INIP INTS3 and NABP interacting protein 1 1
MIRT231688 PEBP1 phosphatidylethanolamine binding protein 1 1 2
MIRT253241 ZNF264 zinc finger protein 264 1 1
MIRT271528 DEGS1 delta(4)-desaturase, sphingolipid 1 1 1
MIRT272942 PRICKLE1 prickle homolog 1 (Drosophila) 1 1
MIRT297087 RGPD4 RANBP2-like and GRIP domain containing 4 1 1
MIRT300229 INO80D INO80 complex subunit D 1 1
MIRT306674 ATP13A3 ATPase type 13A3 1 1
MIRT312929 CREBRF CREB3 regulatory factor 1 1
MIRT314176 OCLN occludin 1 2
MIRT318698 RRAGD Ras-related GTP binding D 1 2
MIRT327635 ZXDB zinc finger, X-linked, duplicated B 1 2
MIRT329262 AIMP1 aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 1 1
MIRT348558 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT384558 SLC38A1 solute carrier family 38, member 1 1 1
MIRT438245 RHOA ras homolog family member A 4 1
MIRT438654 ROCK1 Rho-associated, coiled-coil containing protein kinase 1 3 1
MIRT441380 FRS2 fibroblast growth factor receptor substrate 2 1 2
MIRT441443 MTX3 metaxin 3 1 1
MIRT441942 PEX2 peroxisomal biogenesis factor 2 1 1
MIRT442174 TRIM59 tripartite motif containing 59 1 2
MIRT442231 BTD biotinidase 1 1
MIRT444252 INTS8 integrator complex subunit 8 1 1
MIRT445331 CWC27 CWC27 spliceosome-associated protein homolog (S. cerevisiae) 1 1
MIRT445490 HMGN4 high mobility group nucleosomal binding domain 4 1 1
MIRT446476 ZFAND4 zinc finger, AN1-type domain 4 1 1
MIRT447487 KIAA1715 KIAA1715 1 1
MIRT448342 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 3
MIRT449259 PALM2 paralemmin 2 1 1
MIRT449631 ELAVL4 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 1 1
MIRT450105 IMP3 IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) 1 1
MIRT450471 TRMT5 tRNA methyltransferase 5 homolog (S. cerevisiae) 1 2
MIRT450743 POLI polymerase (DNA directed) iota 1 2
MIRT450856 HMGN2 high mobility group nucleosomal binding domain 2 1 2
MIRT459236 ADRBK1 adrenergic, beta, receptor kinase 1 1 1
MIRT466706 TAF13 TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa 1 2
MIRT467575 SLITRK4 SLIT and NTRK-like family, member 4 1 1
MIRT467691 SLC38A2 solute carrier family 38, member 2 1 2
MIRT475456 HSPA8 heat shock 70kDa protein 8 1 3
MIRT475957 GXYLT1 glucoside xylosyltransferase 1 1 2
MIRT480266 C8orf4 chromosome 8 open reading frame 4 1 1
MIRT486179 ERH enhancer of rudimentary homolog (Drosophila) 1 2
MIRT492416 SCARB2 scavenger receptor class B, member 2 1 1
MIRT493331 LAPTM4A lysosomal protein transmembrane 4 alpha 1 6
MIRT494071 DUSP2 dual specificity phosphatase 2 1 2
MIRT494093 DR1 down-regulator of transcription 1, TBP-binding (negative cofactor 2) 1 2
MIRT498019 ZBTB20 zinc finger and BTB domain containing 20 1 1
MIRT501532 POM121C POM121 transmembrane nucleoporin C 1 3
MIRT502159 KIAA1109 KIAA1109 1 2
MIRT502190 IGF1R insulin-like growth factor 1 receptor 1 2
MIRT502458 FRAT2 frequently rearranged in advanced T-cell lymphomas 2 1 3
MIRT504632 MFSD8 major facilitator superfamily domain containing 8 1 3
MIRT506026 PUM1 pumilio homolog 1 (Drosophila) 1 3
MIRT506535 MORF4L1 mortality factor 4 like 1 1 4
MIRT506679 LZIC leucine zipper and CTNNBIP1 domain containing 1 2
MIRT506824 KIF23 kinesin family member 23 1 3
MIRT507068 H3F3B H3 histone, family 3B (H3.3B) 1 1
MIRT507170 GAN gigaxonin 1 3
MIRT507254 FIGN fidgetin 1 4
MIRT507281 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT507825 CD55 CD55 molecule, decay accelerating factor for complement (Cromer blood group) 1 2
MIRT513851 JARID2 jumonji, AT rich interactive domain 2 1 4
MIRT514679 ZNF701 zinc finger protein 701 1 3
MIRT514746 ACER3 alkaline ceramidase 3 1 4
MIRT517698 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT518472 C8orf37 chromosome 8 open reading frame 37 1 2
MIRT521091 SLC24A2 solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 1 3
MIRT521654 PRKD3 protein kinase D3 1 1
MIRT521767 PPIG peptidylprolyl isomerase G (cyclophilin G) 1 4
MIRT522011 PCGF2 polycomb group ring finger 2 1 3
MIRT524013 DONSON downstream neighbor of SON 1 1
MIRT525807 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT525908 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) 1 1
MIRT526189 ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 1 1
MIRT526206 SNX24 sorting nexin 24 1 1
MIRT529807 TMLHE trimethyllysine hydroxylase, epsilon 1 1
MIRT530461 SULT1B1 sulfotransferase family, cytosolic, 1B, member 1 1 1
MIRT530904 KIAA1161 KIAA1161 1 1
MIRT531738 TXK TXK tyrosine kinase 1 1
MIRT532071 LYVE1 lymphatic vessel endothelial hyaluronan receptor 1 1 1
MIRT532129 NOL11 nucleolar protein 11 1 1
MIRT532604 SPTLC2 serine palmitoyltransferase, long chain base subunit 2 1 1
MIRT534120 SOCS3 suppressor of cytokine signaling 3 1 1
MIRT534566 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 2
MIRT534637 RNASEH1 ribonuclease H1 1 2
MIRT534878 QKI QKI, KH domain containing, RNA binding 1 1
MIRT536518 KCTD10 potassium channel tetramerisation domain containing 10 1 1
MIRT538636 CCSAP centriole, cilia and spindle-associated protein 1 1
MIRT542893 HSPA1B heat shock 70kDa protein 1B 1 2
MIRT543021 CALML4 calmodulin-like 4 1 1
MIRT543381 CC2D2A coiled-coil and C2 domain containing 2A 1 1
MIRT543557 RPF2 ribosome production factor 2 homolog (S. cerevisiae) 1 2
MIRT545109 PDZRN4 PDZ domain containing ring finger 4 1 1
MIRT545592 SIGLEC9 sialic acid binding Ig-like lectin 9 1 1
MIRT545733 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 18kDa 1 1
MIRT546424 SNX5 sorting nexin 5 1 1
MIRT546454 SLC6A8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 1 2
MIRT546935 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT547611 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT548991 CCND2 cyclin D2 1 2
MIRT550071 TRAPPC2 trafficking protein particle complex 2 1 1
MIRT550225 DSN1 DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT551042 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
MIRT551094 TTC8 tetratricopeptide repeat domain 8 1 1
MIRT553318 TSPAN3 tetraspanin 3 1 1
MIRT554747 RHOC ras homolog family member C 1 1
MIRT554885 RCAN2 regulator of calcineurin 2 1 1
MIRT555130 PTPRD protein tyrosine phosphatase, receptor type, D 1 1
MIRT555490 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT555659 PGM3 phosphoglucomutase 3 1 1
MIRT556055 MTF2 metal response element binding transcription factor 2 1 1
MIRT556774 KLF6 Kruppel-like factor 6 1 1
MIRT557392 H3F3C H3 histone, family 3C 1 1
MIRT557856 FGFR1OP FGFR1 oncogene partner 1 2
MIRT558211 EFCAB14 KIAA0494 1 2
MIRT558704 CLIP1 CAP-GLY domain containing linker protein 1 1 1
MIRT560706 ZNF324B zinc finger protein 324B 1 1
MIRT561049 SKP2 S-phase kinase-associated protein 2, E3 ubiquitin protein ligase 1 1
MIRT561135 MRPL36 mitochondrial ribosomal protein L36 1 1
MIRT561184 TNFRSF10A tumor necrosis factor receptor superfamily, member 10a 1 1
MIRT561252 ZNF281 zinc finger protein 281 1 1
MIRT561539 SON SON DNA binding protein 1 1
MIRT562096 KIAA0895 KIAA0895 1 1
MIRT562840 LINC00346 long intergenic non-protein coding RNA 346 1 1
MIRT562921 TNIP2 TNFAIP3 interacting protein 2 1 1
MIRT563811 FMN1 formin 1 1 1
MIRT564355 PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 1 1
MIRT564377 BAAT bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase) 1 1
MIRT564572 ZXDA zinc finger, X-linked, duplicated A 1 1
MIRT566116 RASEF RAS and EF-hand domain containing 1 1
MIRT566294 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT566481 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 1 1
MIRT566554 PANK3 pantothenate kinase 3 1 1
MIRT567748 DLC1 deleted in liver cancer 1 1 1
MIRT567901 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT573966 DDX21 DEAD (Asp-Glu-Ala-Asp) box helicase 21 1 1
MIRT574377 YY1 YY1 transcription factor 1 1
MIRT574714 HAUS8 HAUS augmin-like complex, subunit 8 1 1
MIRT609659 ITIH5 inter-alpha-trypsin inhibitor heavy chain family, member 5 1 1
MIRT617992 IGSF11 immunoglobulin superfamily, member 11 1 2
MIRT625068 C15orf41 chromosome 15 open reading frame 41 1 1
MIRT639379 FFAR4 omega-3 fatty acid receptor 1 1 1
MIRT640140 CEP104 centrosomal protein 104kDa 1 1
MIRT645376 MKX mohawk homeobox 1 1
MIRT645473 NTM neurotrimin 1 1
MIRT652680 TIGD2 tigger transposable element derived 2 1 1
MIRT654246 RIMS4 regulating synaptic membrane exocytosis 4 1 1
MIRT654656 PSPH phosphoserine phosphatase 1 1
MIRT662120 APOL6 apolipoprotein L, 6 1 1
MIRT665757 TMEM43 transmembrane protein 43 1 1
MIRT667532 LRP2BP LRP2 binding protein 1 1
MIRT669121 CD84 CD84 molecule 1 1
MIRT690353 RPL37A ribosomal protein L37a 1 1
MIRT695761 WDR35 WD repeat domain 35 1 1
MIRT698415 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT700927 PDS5A PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) 1 1
MIRT701611 MYPN myopalladin 1 1
MIRT703006 HERPUD2 HERPUD family member 2 1 1
MIRT706805 APOL4 apolipoprotein L, 4 1 1
MIRT707565 SLCO1B3 solute carrier organic anion transporter family, member 1B3 1 1
MIRT707625 PIAS1 protein inhibitor of activated STAT, 1 1 1
MIRT708046 MCAM melanoma cell adhesion molecule 1 1
MIRT708150 CERCAM cerebral endothelial cell adhesion molecule 1 1
MIRT713950 KCTD6 potassium channel tetramerisation domain containing 6 1 1
MIRT721010 ZNF619 zinc finger protein 619 1 1
MIRT723434 ADI1 acireductone dioxygenase 1 1 1
MIRT724954 AHCY adenosylhomocysteinase 1 1
MIRT725553 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*