Accession ID: MIRT019597 [miRNA, hsa-miR-340-5p :: TNFRSF10B, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-340LinkOut: [miRBase ]
Synonyms MIRN340, hsa-mir-340, MIR340
Description Homo sapiens miR-340 stem-loop
Comment This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-340-5p
Mature Sequence 16| UUAUAAAGCAAUGAGACUGAUU |37
Evidence Experimental
Experiments Cloned
Putative hsa-miR-340-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TNFRSF10B LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CD262, DR5, KILLER, KILLER/DR5, TRAIL-R2, TRAILR2, TRICK2, TRICK2A, TRICK2B, TRICKB, ZTNFR9
Description tumor necrosis factor receptor superfamily, member 10b
Transcript NM_0038    LinkOut: [ RefSeq ]
Other Transcripts NM_1471   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TNFRSF10B LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TNFRSF10B
(miRNA target sites are highlighted)
>TNFRSF10B|NM_0038|3'UTR
   1 TAAGTGTGATTCTCTTCAGGAAGTCAGACCTTCCCTGGTTTACCTTTTTTCTGGAAAAAGCCCAACTGGACTCCAGTCAG
  81 TAGGAAAGTGCCACAATTGTCACATGACCGGTACTGGAAGAAACTCTCCCATCCAACATCACCCAGTGGATGGAACATCC
 161 TGTAACTTTTCACTGCACTTGGCATTATTTTTATAAGCTGAATGTGATAATAAGGACACTATGGAAATGTCTGGATCATT
 241 CCGTTTGTGCGTACTTTGAGATTTGGTTTGGGATGTCATTGTTTTCACAGCACTTTTTTATCCTAATGTAAATGCTTTAT
 321 TTATTTATTTGGGCTACATTGTAAGATCCATCTACACAGTCGTTGTCCGACTTCACTTGATACTATATGATATGAACCTT
 401 TTTTGGGTGGGGGGTGCGGGGCAGTTCACTCTGTCTCCCAGGCTGGAGTGCAATGGTGCAATCTTGGCTCACTATAGCCT
 481 TGACCTCTCAGGCTCAAGCGATTCTCCCACCTCAGCCATCCAAATAGCTGGGACCACAGGTGTGCACCACCACGCCCGGC
 561 TAATTTTTTGTATTTTGTCTAGATATAGGGGCTCTCTATGTTGCTCAGGGTGGTCTCGAATTCCTGGACTCAAGCAGTCT
 641 GCCCACCTCAGACTCCCAAAGCGGTGGAATTAGAGGCGTGAGCCCCCATGCTTGGCCTTACCTTTCTACTTTTATAATTC
 721 TGTATGTTATTATTTTATGAACATGAAGAAACTTTAGTAAATGTACTTGTTTACATAGTTATGTGAATAGATTAGATAAA
 801 CATAAAAGGAGGAGACATACAATGGGGGAAGAAGAAGAAGTCCCCTGTAAGATGTCACTGTCTGGGTTCCAGCCCTCCCT
 881 CAGATGTACTTTGGCTTCAATGATTGGCAACTTCTACAGGGGCCAGTCTTTTGAACTGGACAACCTTACAAGTATATGAG
 961 TATTATTTATAGGTAGTTGTTTACATATGAGTCGGGACCAAAGAGAACTGGATCCACGTGAAGTCCTGTGTGTGGCTGGT
1041 CCCTACCTGGGCAGTCTCATTTGCACCCATAGCCCCCATCTATGGACAGGCTGGGACAGAGGCAGATGGGTTAGATCACA
1121 CATAACAATAGGGTCTATGTCATATCCCAAGTGAACTTGAGCCCTGTTTGGGCTCAGGAGATAGAAGACAAAATCTGTCT
1201 CCCACGTCTGCCATGGCATCAAGGGGGAAGAGTAGATGGTGCTTGAGAATGGTGTGAAATGGTTGCCATCTCAGGAGTAG
1281 ATGGCCCGGCTCACTTCTGGTTATCTGTCACCCTGAGCCCATGAGCTGCCTTTTAGGGTACAGATTGCCTACTTGAGGAC
1361 CTTGGCCGCTCTGTAAGCATCTGACTCATCTCAGAAATGTCAATTCTTAAACACTGTGGCAACAGGACCTAGAATGGCTG
1441 ACGCATTAAGGTTTTCTTCTTGTGTCCTGTTCTATTATTGTTTTAAGACCTCAGTAACCATTTCAGCCTCTTTCCAGCAA
1521 ACCCTTCTCCATAGTATTTCAGTCATGGAAGGATCATTTATGCAGGTAGTCATTCCAGGAGTTTTTGGTCTTTTCTGTCT
1601 CAAGGCATTGTGTGTTTTGTTCCGGGACTGGTTTGGGTGGGACAAAGTTAGAATTGCCTGAAGATCACACATTCAGACTG
1681 TTGTGTCTGTGGAGTTTTAGGAGTGGGGGGTGACCTTTCTGGTCTTTGCACTTCCATCCTCTCCCACTTCCATCTGGCAT
1761 CCCACGCGTTGTCCCCTGCACTTCTGGAAGGCACAGGGTGCTGCTGCCTCCTGGTCTTTGCCTTTGCTGGGCCTTCTGTG
1841 CAGGACGCTCAGCCTCAGGGCTCAGAAGGTGCCAGTCCGGTCCCAGGTCCCTTGTCCCTTCCACAGAGGCCTTCCTAGAA
1921 GATGCATCTAGAGTGTCAGCCTTATCAGTGTTTAAGATTTTTCTTTTATTTTTAATTTTTTTGAGACAGAATCTCACTCT
2001 CTCGCCCAGGCTGGAGTGCAACGGTACGATCTTGGCTCAGTGCAACCTCCGCCTCCTGGGTTCAAGCGATTCTCGTGCCT
2081 CAGCCTCCGGAGTAGCTGGGATTGCAGGCACCCGCCACCACGCCTGGCTAATTTTTGTATTTTTAGTAGAGACGGGGTTT
2161 CACCATGTTGGTCAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCCACCTTGGCCTCCGAAAGTGCTGGGATTACAGGC
2241 GTGAGCCACCAGCCAGGCCAAGCTATTCTTTTAAAGTAAGCTTCCTGACGACATGAAATAATTGGGGGTTTTGTTGTTTA
2321 GTTACATTAGGCTTTGCTATATCCCCAGGCCAAATAGCATGTGACACAGGACAGCCATAGTATAGTGTGTCACTCGTGGT
2401 TGGTGTCCTTTCATGCTTCTGCCCTGTCAAAGGTCCCTATTTGAAATGTGTTATAATACAAACAAGGAAGCACATTGTGT
2481 ACAAAATACTTATGTATTTATGAATCCATGACCAAATTAAATATGAAACCTTATATAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuaGUCAGAGUAACGAAAUAuu 5'
             :| | | | ||||||||  
Target 5' tccTAATGTAAATGCTTTATtt 3'
301 - 322 139.00 -6.20
2
miRNA  3' uuAGUCA---GA---GUAA-CGAAAUAUu 5'
            ||| |   ||   ||||  :|||||| 
Target 5' ttTCACTGCACTTGGCATTATTTTTATAa 3'
168 - 196 136.00 -5.20
3
miRNA  3' uuAGUC--AGAGUAACGAAAUAUu 5'
            || |  | |:||| :|||||: 
Target 5' atTCTGTATGTTATTATTTTATGa 3'
717 - 740 130.00 -7.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-340-5p :: TNFRSF10B    [ Functional MTI ]
Validation Method Sequencing
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
123 hsa-miR-340-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005458 MET met proto-oncogene (hepatocyte growth factor receptor) 4 1
MIRT019532 LMNA lamin A/C 1 1
MIRT019533 SLX4 BTB (POZ) domain containing 12 1 1
MIRT019534 ZIC5 Zic family member 5 (odd-paired homolog, Drosophila) 1 1
MIRT019535 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT019536 OSBPL1A oxysterol binding protein-like 1A 1 1
MIRT019537 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT019538 ZNF776 zinc finger protein 776 1 1
MIRT019539 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 1
MIRT019540 RFWD3 ring finger and WD repeat domain 3 1 1
MIRT019541 KCTD20 potassium channel tetramerisation domain containing 20 1 1
MIRT019542 NKRF NFKB repressing factor 1 1
MIRT019543 CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 1 1
MIRT019544 BIVM basic, immunoglobulin-like variable motif containing 1 1
MIRT019545 ARHGAP12 Rho GTPase activating protein 12 1 1
MIRT019546 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 1
MIRT019547 GK5 glycerol kinase 5 (putative) 1 1
MIRT019548 LEPROT leptin receptor overlapping transcript 1 1
MIRT019549 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT019550 KIAA1586 KIAA1586 1 1
MIRT019551 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT019552 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT019553 SAMD12 sterile alpha motif domain containing 12 1 1
MIRT019554 CAPRIN2 caprin family member 2 1 1
MIRT019555 SERTAD2 SERTA domain containing 2 1 1
MIRT019556 REV3L REV3-like, catalytic subunit of DNA polymerase zeta (yeast) 1 1
MIRT019557 MPHOSPH9 M-phase phosphoprotein 9 1 1
MIRT019558 SLC39A7 solute carrier family 39 (zinc transporter), member 7 1 1
MIRT019559 ZFYVE26 zinc finger, FYVE domain containing 26 1 1
MIRT019560 TMEM138 transmembrane protein 138 1 1
MIRT019561 ZCCHC2 zinc finger, CCHC domain containing 2 1 1
MIRT019562 GID8 chromosome 20 open reading frame 11 1 1
MIRT019563 TUBB3 tubulin, beta 3 1 1
MIRT019564 SIVA1 SIVA1, apoptosis-inducing factor 1 1
MIRT019565 ZNF35 zinc finger protein 35 1 1
MIRT019566 CTTN cortactin 1 1
MIRT019567 PPP1R14C protein phosphatase 1, regulatory (inhibitor) subunit 14C 1 1
MIRT019568 NUP50 nucleoporin 50kDa 1 1
MIRT019569 MINPP1 multiple inositol-polyphosphate phosphatase 1 1 1
MIRT019570 PIM3 pim-3 oncogene 1 1
MIRT019571 ECH1 enoyl CoA hydratase 1, peroxisomal 1 1
MIRT019572 MESDC1 mesoderm development candidate 1 1 1
MIRT019573 HSDL1 hydroxysteroid dehydrogenase like 1 1 1
MIRT019574 EFHD2 EF-hand domain family, member D2 1 1
MIRT019575 TES testis derived transcript (3 LIM domains) 1 1
MIRT019576 QSOX2 quiescin Q6 sulfhydryl oxidase 2 1 1
MIRT019577 GPX8 glutathione peroxidase 8 (putative) 1 1
MIRT019578 FBXO21 F-box protein 21 1 1
MIRT019579 YIPF2 Yip1 domain family, member 2 1 1
MIRT019580 DCTN5 dynactin 5 (p25) 1 1
MIRT019581 HOXA5 homeobox A5 1 1
MIRT019582 KLHL42 kelch domain containing 5 1 1
MIRT019583 ANKRD9 ankyrin repeat domain 9 1 1
MIRT019584 KIF11 kinesin family member 11 1 1
MIRT019585 TXLNG taxilin gamma 1 1
MIRT019586 CREBZF CREB/ATF bZIP transcription factor 1 1
MIRT019587 CCBL2 cysteine conjugate-beta lyase 2 1 1
MIRT019588 DDX5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 1 1
MIRT019589 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT019590 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 1
MIRT019591 HOXA9 homeobox A9 1 1
MIRT019592 ZNF83 zinc finger protein 83 1 1
MIRT019593 ANKRD29 ankyrin repeat domain 29 1 1
MIRT019594 SLC16A14 solute carrier family 16, member 14 (monocarboxylic acid transporter 14) 1 1
MIRT019595 LRPPRC leucine-rich PPR-motif containing 1 1
MIRT019596 C1orf198 chromosome 1 open reading frame 198 1 1
MIRT019597 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 1
MIRT019598 SYPL1 synaptophysin-like 1 1 1
MIRT019599 DEPDC1 DEP domain containing 1 1 1
MIRT019600 ZNF107 zinc finger protein 107 1 1
MIRT019601 AMOT angiomotin 1 1
MIRT019602 BBS10 Bardet-Biedl syndrome 10 1 1
MIRT019603 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 1 1
MIRT019604 SHCBP1 SHC SH2-domain binding protein 1 1 1
MIRT019605 SPIN4 spindlin family, member 4 1 1
MIRT019606 ELAVL1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) 1 1
MIRT019607 RBM8A RNA binding motif protein 8A 1 1
MIRT019608 BCL10 B-cell CLL/lymphoma 10 1 1
MIRT019609 GALNT3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3) 1 1
MIRT019610 CHMP4B chromatin modifying protein 4B 1 1
MIRT019611 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT019612 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT019613 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT019614 SOWAHC ankyrin repeat domain 57 1 1
MIRT019615 TLX1 T-cell leukemia homeobox 1 1 1
MIRT019616 CD46 CD46 molecule, complement regulatory protein 1 1
MIRT019617 UBE2Z ubiquitin-conjugating enzyme E2Z 1 1
MIRT019618 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT019619 ITPR1 inositol 1,4,5-triphosphate receptor, type 1 1 1
MIRT019620 ZFHX3 zinc finger homeobox 3 1 1
MIRT019621 KLF10 Kruppel-like factor 10 1 1
MIRT019622 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT019623 ATXN1 ataxin 1 1 1
MIRT019624 SZRD1 chromosome 1 open reading frame 144 1 1
MIRT019625 HECTD2 HECT domain containing 2 1 1
MIRT019626 SMC3 structural maintenance of chromosomes 3 1 1
MIRT019627 MYLIP myosin regulatory light chain interacting protein 1 1
MIRT019628 ASF1A ASF1 anti-silencing function 1 homolog A (S. cerevisiae) 1 1
MIRT019629 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT019630 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT019631 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT019632 LBR lamin B receptor 1 1
MIRT019633 BTG3 BTG family, member 3 1 1
MIRT019634 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT019635 KDELC2 KDEL (Lys-Asp-Glu-Leu) containing 2 1 1
MIRT019636 OTUD1 OTU domain containing 1 1 1
MIRT019637 RIT1 Ras-like without CAAX 1 1 1
MIRT019638 SLC35G1 transmembrane protein 20 1 1
MIRT019639 ACSL3 acyl-CoA synthetase long-chain family member 3 1 1
MIRT019640 BTBD10 BTB (POZ) domain containing 10 1 1
MIRT019641 FBXL3 F-box and leucine-rich repeat protein 3 1 1
MIRT019642 NET1 neuroepithelial cell transforming 1 1 1
MIRT019643 ANKRD40 ankyrin repeat domain 40 1 1
MIRT019644 PELI1 pellino homolog 1 (Drosophila) 1 1
MIRT019645 PDE4D phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) 1 1
MIRT019646 SOX4 SRY (sex determining region Y)-box 4 1 1
MIRT019647 NEK7 NIMA (never in mitosis gene a)-related kinase 7 1 1
MIRT019648 RNF11 ring finger protein 11 1 1
MIRT019649 MCMBP chromosome 10 open reading frame 119 1 1
MIRT019650 TMEM245 chromosome 9 open reading frame 5 1 1
MIRT019651 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 1 1
MIRT019652 KAT6B MYST histone acetyltransferase (monocytic leukemia) 4 1 1
MIRT019653 KCNK1 potassium channel, subfamily K, member 1 1 1