Accession ID: MIRT019875 [miRNA, hsa-miR-375 :: LDHB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-375LinkOut: [miRBase ]
Synonyms MIRN375, hsa-mir-375, miRNA375, MIR375
Description Homo sapiens miR-375 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-375
Mature Sequence 40| UUUGUUCGUUCGGCUCGCGUGA |61
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-375 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LDHB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms LDH-H, TRG-5
Description lactate dehydrogenase B
Transcript NM_0011740    LinkOut: [ RefSeq ]
Other Transcripts NM_0023   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LDHB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of LDHB
(miRNA target sites are highlighted)
>LDHB|NM_0011740|3'UTR
   1 TGACTAGTGAGCTCTAGGCTGTAGAAATTTAAAAACTACAATGTGATTAACTCGAGCCTTTAGTTTTCATCCATGTACAT
  81 GGATCACAGTTTGCTTTGATCTTCTTCAATATGTGAATTTGGGCTCACAGAATCAAAGCCTATGCTTGGTTTAATGCTTG
 161 CAATCTGAGCTCTTGAACAAATAAAATTAACTATTGTAGTGTGC
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aguGCGCUCGGCUU----GCUUGUUu 5'
             :|| | |:||:    :|||||| 
Target 5' gctTGCAATCTGAGCTCTTGAACAAa 3'
156 - 181 137.00 -15.80
2
miRNA  3' agUGCGCUCGGCUUGCUU-GUUu 5'
            |: :|:||: |  ||| ||| 
Target 5' gaATTTGGGCTCACAGAATCAAa 3'
115 - 137 96.00 -8.10
3
miRNA  3' agUGCGCUCGGCUU--GCUUGuuu 5'
            |:|:||  : ||  |||:|   
Target 5' caATGTGA--TTAACTCGAGCctt 3'
39 - 60 94.00 -9.72
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-375 :: LDHB    [ Functional MTI ]
Validation Method Microarray
Article - Tsukamoto, Y. Nakada, C. Noguchi, T. et al.
- Cancer Res, 2010
We investigated expression profiles of microRNA (miRNA) in gastric carcinomas by use of a miRNA microarray platform covering a total of 470 human miRNAs. We identified 39 differentially expressed miRNAs in gastric carcinoma, of which six were significantly downregulated and the other 33 were upregulated. We found that miRNA-375 (miR-375) was the most downregulated and that its ectopic expression in gastric carcinoma cells markedly reduced cell viability via the caspase-mediated apoptosis pathway. Interestingly, we found that expression of miR-375 inhibited expression of PDK1, which is a direct target of miR-375, followed by suppression of Akt phosphorylation. Further analysis by gene expression microarray revealed that 14-3-3zeta, a potent antiapoptotic gene, was significantly downregulated at both the mRNA and protein levels in cells transfected with miR-375. The activity of a luciferase reporter containing the miR-375 binding sequence at the 3' untranslated region (UTR) of 14-3-3zeta mRNA was repressed by the ectopic expression of miR-375, suggesting that miR-375 targets the 3' UTR of 14-3-3zeta. In addition, knockdown of either PDK1 or 14-3-3zeta in gastric carcinoma cells induced caspase activation, which was also observed in miR-375-transfected cells, suggesting that miR-375 may exert its proapoptotic function, at least in part, through the downregulation of PDK1 and 14-3-3zeta. Taken together, we propose that miR-375 is a candidate tumor suppressor miRNA in gastric carcinoma.
LinkOut: [PMID: 20215506]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
424 hsa-miR-375 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000053 TIMM8A translocase of inner mitochondrial membrane 8 homolog A (yeast) 4 2
MIRT000054 MTPN myotrophin 2 1
MIRT000055 PDK1 pyruvate dehydrogenase kinase, isozyme 1 4 3
MIRT001747 USP1 ubiquitin specific peptidase 1 2 2
MIRT001748 MXI1 MAX interactor 1 1 1
MIRT001749 JAK2 Janus kinase 2 2 2
MIRT001750 ADIPOR2 adiponectin receptor 2 1 1
MIRT001751 INSM1 insulinoma-associated 1 1 1
MIRT001752 C1QBP complement component 1, q subcomponent binding protein 2 2
MIRT001753 AHR aryl hydrocarbon receptor 1 1
MIRT003057 PLAG1 pleiomorphic adenoma gene 1 2 1
MIRT004439 RASD1 RAS, dexamethasone-induced 1 4 1
MIRT004478 YY1AP1 YY1 associated protein 1 3 1
MIRT005543 ELAVL4 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) 5 1
MIRT006154 YAP1 Yes-associated protein 1 4 3
MIRT006207 MTDH metadherin 4 2
MIRT006775 SP1 Sp1 transcription factor 1 1
MIRT007200 MAP3K8 mitogen-activated protein kinase kinase kinase 8 1 1
MIRT007255 FZD8 frizzled homolog 8 (Drosophila) 1 2
MIRT019667 RRAGB Ras-related GTP binding B 1 1
MIRT019668 TAF3 TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa 1 1
MIRT019669 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT019670 USP10 ubiquitin specific peptidase 10 1 1
MIRT019671 EXO1 exonuclease 1 1 1
MIRT019672 KLK10 kallikrein-related peptidase 10 1 1
MIRT019673 DNAJC8 DnaJ (Hsp40) homolog, subfamily C, member 8 1 1
MIRT019674 GALM galactose mutarotase (aldose 1-epimerase) 1 1
MIRT019675 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 1
MIRT019676 IFI6 interferon, alpha-inducible protein 6 1 1
MIRT019677 GKAP1 G kinase anchoring protein 1 1 1
MIRT019678 ESPNL espin-like 1 1
MIRT019679 BSN bassoon (presynaptic cytomatrix protein) 1 1
MIRT019680 APH1B anterior pharynx defective 1 homolog B (C. elegans) 1 1
MIRT019681 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT019682 TNPO3 transportin 3 1 1
MIRT019683 TBC1D5 TBC1 domain family, member 5 1 1
MIRT019684 SYNCRIP synaptotagmin binding, cytoplasmic RNA interacting protein 1 1
MIRT019685 C14orf159 chromosome 14 open reading frame 159 1 1
MIRT019686 PHLDA1 pleckstrin homology-like domain, family A, member 1 1 1
MIRT019687 TRMT10A RNA (guanine-9-) methyltransferase domain containing 2 1 1
MIRT019688 NIN ninein (GSK3B interacting protein) 1 1
MIRT019689 MED8 mediator complex subunit 8 1 1
MIRT019690 SAMD11 sterile alpha motif domain containing 11 1 1
MIRT019691 GATA6 GATA binding protein 6 1 1
MIRT019692 CTGF connective tissue growth factor 1 1
MIRT019693 ZFP91 zinc finger protein 91 homolog (mouse) 1 1
MIRT019694 ENAH enabled homolog (Drosophila) 1 1
MIRT019695 UBLCP1 ubiquitin-like domain containing CTD phosphatase 1 1 1
MIRT019696 RAB10 RAB10, member RAS oncogene family 2 1
MIRT019697 SNAPC1 small nuclear RNA activating complex, polypeptide 1, 43kDa 1 1
MIRT019698 DNAJC2 DnaJ (Hsp40) homolog, subfamily C, member 2 1 1
MIRT019699 GSC goosecoid homeobox 1 1
MIRT019700 CCDC88A coiled-coil domain containing 88A 1 1
MIRT019701 KLHDC8B kelch domain containing 8B 1 1
MIRT019702 UCHL3 ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) 1 1
MIRT019703 JAG1 jagged 1 (Alagille syndrome) 1 1
MIRT019704 PIGB phosphatidylinositol glycan anchor biosynthesis, class B 1 1
MIRT019705 EXOC6 exocyst complex component 6 1 1
MIRT019706 DESI1 PPPDE peptidase domain containing 2 1 1
MIRT019707 ASAP2 ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 1 1
MIRT019708 TGFB2 transforming growth factor, beta 2 1 1
MIRT019709 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 1 1
MIRT019710 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 1 1
MIRT019711 TNFSF13 tumor necrosis factor (ligand) superfamily, member 13 1 1
MIRT019712 CPOX coproporphyrinogen oxidase 1 1
MIRT019713 IGFBP3 insulin-like growth factor binding protein 3 1 1
MIRT019714 BAK1 BCL2-antagonist/killer 1 1 1
MIRT019715 AQP11 aquaporin 11 1 1
MIRT019716 WTAP Wilms tumor 1 associated protein 1 1
MIRT019717 NAGPA N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase 1 1
MIRT019718 TMEM25 transmembrane protein 25 1 1
MIRT019719 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT019720 HRSP12 heat-responsive protein 12 1 1
MIRT019721 GTPBP4 GTP binding protein 4 1 1
MIRT019722 SP110 SP110 nuclear body protein 1 1
MIRT019723 RIMS3 regulating synaptic membrane exocytosis 3 1 1
MIRT019724 GPR157 G protein-coupled receptor 157 1 1
MIRT019725 SGOL2 shugoshin-like 2 (S. pombe) 1 1
MIRT019726 SYT15 synaptotagmin XV 1 1
MIRT019727 RRAGC Ras-related GTP binding C 1 1
MIRT019728 STPG1 chromosome 1 open reading frame 201 1 1
MIRT019729 LMAN2 lectin, mannose-binding 2 1 1
MIRT019730 HOXB13 homeobox B13 1 1
MIRT019731 PRDX3 peroxiredoxin 3 1 1
MIRT019732 GFM2 G elongation factor, mitochondrial 2 1 1
MIRT019733 RPN2 ribophorin II 1 1
MIRT019734 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT019735 FKBP1B FK506 binding protein 1B, 12.6 kDa 1 1
MIRT019736 KIAA0232 KIAA0232 1 1
MIRT019737 ANKRD46 ankyrin repeat domain 46 1 1
MIRT019738 NAT10 N-acetyltransferase 10 (GCN5-related) 1 1
MIRT019739 CCDC59 coiled-coil domain containing 59 1 1
MIRT019740 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 1 1
MIRT019741 METTL2B methyltransferase like 2B 1 1
MIRT019742 STX6 syntaxin 6 1 1
MIRT019743 ENOPH1 enolase-phosphatase 1 1 1
MIRT019744 CNN3 calponin 3, acidic 1 1
MIRT019745 SNX25 sorting nexin 25 1 1
MIRT019746 VGLL4 vestigial like 4 (Drosophila) 1 1
MIRT019747 OGFOD1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT019748 GATAD1 GATA zinc finger domain containing 1 1 1
MIRT019749 TMEM55A transmembrane protein 55A 1 1
MIRT019750 EBAG9 estrogen receptor binding site associated, antigen, 9 1 1
MIRT019751 CKAP2 cytoskeleton associated protein 2 1 1
MIRT019752 NSFL1C NSFL1 (p97) cofactor (p47) 1 1
MIRT019753 PTPMT1 protein tyrosine phosphatase, mitochondrial 1 1 1
MIRT019754 DGKD diacylglycerol kinase, delta 130kDa 1 1
MIRT019755 TNS3 tensin 3 1 1
MIRT019756 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT019757 AZI2 5-azacytidine induced 2 1 1
MIRT019758 PDGFC platelet derived growth factor C 1 1
MIRT019759 OPA1 optic atrophy 1 (autosomal dominant) 1 1
MIRT019760 OSBPL8 oxysterol binding protein-like 8 1 1
MIRT019761 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT019762 NUPL1 nucleoporin like 1 1 1
MIRT019763 HEY1 hairy/enhancer-of-split related with YRPW motif 1 1 1
MIRT019764 RHOQ ras homolog gene family, member Q 1 1
MIRT019765 KDSR 3-ketodihydrosphingosine reductase 1 1
MIRT019766 RAB3B RAB3B, member RAS oncogene family 1 1
MIRT019767 C11orf54 chromosome 11 open reading frame 54 1 1
MIRT019768 CLDN1 claudin 1 1 1
MIRT019769 SERTAD2 SERTA domain containing 2 1 1
MIRT019770 PTPN12 protein tyrosine phosphatase, non-receptor type 12 1 1
MIRT019771 BIRC3 baculoviral IAP repeat-containing 3 1 1
MIRT019772 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 1
MIRT019773 PSIP1 PC4 and SFRS1 interacting protein 1 1 1
MIRT019774 CHSY1 chondroitin sulfate synthase 1 1 1
MIRT019775 FAM63B family with sequence similarity 63, member B 1 1
MIRT019776 UNC13B unc-13 homolog B (C. elegans) 1 1
MIRT019777 SLC35B4 solute carrier family 35, member B4 1 1
MIRT019778 EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa 1 1
MIRT019779 TSC22D2 TSC22 domain family, member 2 1 1
MIRT019780 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 1
MIRT019781 RASSF8 Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 1 1
MIRT019782 AGTPBP1 ATP/GTP binding protein 1 1 1
MIRT019783 PAPD4 PAP associated domain containing 4 1 1
MIRT019784 CSTF2 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa 1 1
MIRT019785 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 1
MIRT019786 IFT80 intraflagellar transport 80 homolog (Chlamydomonas) 1 1
MIRT019787 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 1
MIRT019788 LSM12 LSM12 homolog (S. cerevisiae) 1 1
MIRT019789 RLF rearranged L-myc fusion 1 1
MIRT019790 EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 1 1
MIRT019791 PARP1 poly (ADP-ribose) polymerase 1 2 1
MIRT019792 CAB39 calcium binding protein 39 2 1
MIRT019793 MIR17HG MIR17 host gene (non-protein coding) 1 1
MIRT019794 IFT46 intraflagellar transport 46 homolog (Chlamydomonas) 1 1
MIRT019795 PBXIP1 pre-B-cell leukemia homeobox interacting protein 1 1 1
MIRT019796 FAM89A family with sequence similarity 89, member A 1 1
MIRT019797 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT019798 AXL AXL receptor tyrosine kinase 1 1
MIRT019799 SEC24C SEC24 family, member C (S. cerevisiae) 1 1
MIRT019800 CRABP2 cellular retinoic acid binding protein 2 1 1
MIRT019801 MKRN1 makorin ring finger protein 1 1 1
MIRT019802 PAQR8 progestin and adipoQ receptor family member VIII 1 1
MIRT019803 NPPB natriuretic peptide precursor B 1 1
MIRT019804 CTDSP2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 1 1
MIRT019805 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 1 1
MIRT019806 TBX19 T-box 19 1 1
MIRT019807 KHK ketohexokinase (fructokinase) 1 1
MIRT019808 SLC39A11 solute carrier family 39 (metal ion transporter), member 11 1 1
MIRT019809 SUB1 SUB1 homolog (S. cerevisiae) 1 1
MIRT019810 DOK7 docking protein 7 1 1
MIRT019811 CYP2U1 cytochrome P450, family 2, subfamily U, polypeptide 1 1 1
MIRT019812 FBXO8 F-box protein 8 1 1
MIRT019813 ABHD4 abhydrolase domain containing 4 1 1
MIRT019814 ARNTL2 aryl hydrocarbon receptor nuclear translocator-like 2 1 1
MIRT019815 ERP44 endoplasmic reticulum protein 44 1 1
MIRT019816 ZNF614 zinc finger protein 614 1 1
MIRT019817 SNRPA1 small nuclear ribonucleoprotein polypeptide A' 'protein-coding 1 1
MIRT019818 DUT deoxyuridine triphosphatase 1 1
MIRT019819 CFL2 cofilin 2 (muscle) 1 1
MIRT019820 BATF2 basic leucine zipper transcription factor, ATF-like 2 1 1
MIRT019821 RBBP8 retinoblastoma binding protein 8 1 1
MIRT019822 MOSPD3 motile sperm domain containing 3 1 1
MIRT019823 TMEM74B chromosome 20 open reading frame 46 1 1
MIRT019824 ZNF404 zinc finger protein 404 1 1
MIRT019825 PEX11B peroxisomal biogenesis factor 11 beta 1 1
MIRT019826 FAM3C family with sequence similarity 3, member C 1 1
MIRT019827 STAP2 signal transducing adaptor family member 2 1 1
MIRT019828 PEBP1 phosphatidylethanolamine binding protein 1 1 1
MIRT019829 TMEM170A transmembrane protein 170A 1 1
MIRT019830 SESN1 sestrin 1 1 1
MIRT019831 IQCE IQ motif containing E 1 1
MIRT019832 SET SET nuclear oncogene 1 1
MIRT019833 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT019834 TMTC4 transmembrane and tetratricopeptide repeat containing 4 1 1
MIRT019835 MNS1 meiosis-specific nuclear structural 1 1 1
MIRT019836 PRDX1 peroxiredoxin 1 1 1
MIRT019837 MR1 major histocompatibility complex, class I-related 1 1
MIRT019838 CEP44 KIAA1712 1 1
MIRT019839 COX20 family with sequence similarity 36, member A 1 1
MIRT019840 CENPF centromere protein F, 350/400ka (mitosin) 1 1
MIRT019841 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 1 1
MIRT019842 BAZ1A bromodomain adjacent to zinc finger domain, 1A 1 1
MIRT019843 DNAH11 dynein, axonemal, heavy chain 11 1 1
MIRT019844 KLHL7 kelch-like 7 (Drosophila) 1 1
MIRT019845 GOLGA4 golgin A4 1 1
MIRT019846 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT019847 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT019848 AKAP7 A kinase (PRKA) anchor protein 7 1 1
MIRT019849 GAS8 growth arrest-specific 8 1 1
MIRT019850 CDCA7L cell division cycle associated 7-like 1 1
MIRT019851 USP46 ubiquitin specific peptidase 46 1 1
MIRT019852 PPP2R3C protein phosphatase 2, regulatory subunit B', gamma 1 1
MIRT019853 ZC3HAV1 zinc finger CCCH-type, antiviral 1 1 1
MIRT019854 KCTD10 potassium channel tetramerisation domain containing 10 1 1
MIRT019855 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT019856 VEZT vezatin, adherens junctions transmembrane protein 1 1
MIRT019857 ZFHX2 zinc finger homeobox 2 1 1
MIRT019858 SLC35A3 solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3 1 1
MIRT019859 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT019860 UBE3A ubiquitin protein ligase E3A 1 1
MIRT019861 STRBP spermatid perinuclear RNA binding protein 1 1
MIRT019862 NXT2 nuclear transport factor 2-like export factor 2 1 1
MIRT019863 RPGRIP1L RPGRIP1-like 1 1
MIRT019864 CBWD3 COBW domain containing 3 1 1
MIRT019865 SGMS2 sphingomyelin synthase 2 1 1
MIRT019866 SAMD4A sterile alpha motif domain containing 4A 1 1
MIRT019867 PRKX protein kinase, X-linked 1 1
MIRT019868 XPR1 xenotropic and polytropic retrovirus receptor 1 1 1
MIRT019869 INSIG2 insulin induced gene 2 1 1
MIRT019870 MBD2 methyl-CpG binding domain protein 2 1 1
MIRT019871 AHCYL1 adenosylhomocysteinase-like 1 1 1
MIRT019872 TMEM106B transmembrane protein 106B 1 1
MIRT019873 AEBP2 AE binding protein 2 1 1
MIRT019874 ACSL3 acyl-CoA synthetase long-chain family member 3 1 1
MIRT019875 LDHB lactate dehydrogenase B 1 1
MIRT019876 SPAG9 sperm associated antigen 9 1 1
MIRT019877 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT019878 C12orf29 chromosome 12 open reading frame 29 1 1
MIRT019879 POC1B POC1 centriolar protein homolog B (Chlamydomonas) 1 1
MIRT019880 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT019881 DLG4 discs, large homolog 4 (Drosophila) 2 1
MIRT019882 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 2 1
MIRT019883 SETD8 SET domain containing (lysine methyltransferase) 8 2 1
MIRT019884 CASP3 caspase 3, apoptosis-related cysteine peptidase 2 1
MIRT019885 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 2 1
MIRT019886 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 5 1
MIRT019887 MAPKAP1 mitogen-activated protein kinase associated protein 1 1 1
MIRT019888 PGM2 phosphoglucomutase 2 1 1
MIRT019889 RMDN3 family with sequence similarity 82, member A2 1 1
MIRT019890 CARD8 caspase recruitment domain family, member 8 1 1
MIRT019891 SKA2 spindle and kinetochore associated complex subunit 2 1 1
MIRT019892 CMAS cytidine monophosphate N-acetylneuraminic acid synthetase 1 1
MIRT019893 NRBP1 nuclear receptor binding protein 1 1 1
MIRT019894 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT019895 FOLR1 folate receptor 1 (adult) 1 1
MIRT019896 MLEC malectin 1 1
MIRT019897 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 1 1
MIRT019898 APPL2 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 1 1
MIRT019899 RTN2 reticulon 2 1 1
MIRT019900 BOD1L1 biorientation of chromosomes in cell division 1-like 1 1
MIRT019901 ITIH4 inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein) 1 1
MIRT019902 THRA thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) 1 1
MIRT019903 SFT2D2 SFT2 domain containing 2 1 1
MIRT019904 PPCS phosphopantothenoylcysteine synthetase 1 1
MIRT019905 SH3D19 SH3 domain containing 19 1 1
MIRT019906 IDNK chromosome 9 open reading frame 103 1 1
MIRT019907 CHPT1 choline phosphotransferase 1 1 1
MIRT019908 CHPF chondroitin polymerizing factor 1 1
MIRT019909 SLC25A42 solute carrier family 25, member 42 1 1
MIRT019910 KIAA0513 KIAA0513 1 1
MIRT019911 CREB3 cAMP responsive element binding protein 3 1 1
MIRT019912 LYPD5 LY6/PLAUR domain containing 5 1 1
MIRT019913 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT019914 HK2 hexokinase 2 1 1
MIRT019915 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 1 1
MIRT019916 TMEM145 transmembrane protein 145 1 1
MIRT019917 FAM96A family with sequence similarity 96, member A 1 1
MIRT019918 ZNF540 zinc finger protein 540 1 1
MIRT019919 PROCR protein C receptor, endothelial 1 1
MIRT019920 SNPH syntaphilin 1 1
MIRT019921 LITAF lipopolysaccharide-induced TNF factor 1 1
MIRT019922 CHGB chromogranin B (secretogranin 1) 1 1
MIRT019923 PCGF5 polycomb group ring finger 5 1 1
MIRT019924 FAH fumarylacetoacetate hydrolase (fumarylacetoacetase) 1 1
MIRT019925 PRRT3 proline-rich transmembrane protein 3 1 1
MIRT019926 SERP1 stress-associated endoplasmic reticulum protein 1 1 1
MIRT019927 F3 coagulation factor III (thromboplastin, tissue factor) 1 1
MIRT019928 ZDHHC11 zinc finger, DHHC-type containing 11 1 1
MIRT019929 ZNF571 zinc finger protein 571 1 1
MIRT019930 CEP19 chromosome 3 open reading frame 34 1 1
MIRT019931 ANKRD1 ankyrin repeat domain 1 (cardiac muscle) 1 1
MIRT019932 HOMER2 homer homolog 2 (Drosophila) 1 1
MIRT019933 CBWD2 COBW domain containing 2 1 1
MIRT019934 PSME4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT019935 CORO1C coronin, actin binding protein, 1C 1 1
MIRT019936 PHTF2 putative homeodomain transcription factor 2 1 1
MIRT019937 DPY19L1 dpy-19-like 1 (C. elegans) 1 1
MIRT019938 HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 1 1
MIRT019939 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT019940 RCN2 reticulocalbin 2, EF-hand calcium binding domain 1 1
MIRT019941 SEMA3C sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C 1 1
MIRT019942 HDHD1 haloacid dehalogenase-like hydrolase domain containing 1A 1 1
MIRT019943 STX3 syntaxin 3 1 1
MIRT019944 KPNA4 karyopherin alpha 4 (importin alpha 3) 1 1
MIRT019945 MAT2B methionine adenosyltransferase II, beta 1 1
MIRT019946 RAB28 RAB28, member RAS oncogene family 1 1
MIRT019947 RPUSD4 RNA pseudouridylate synthase domain containing 4 1 1
MIRT019948 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 1 1
MIRT019949 VASN vasorin 1 1
MIRT019950 CDR2 cerebellar degeneration-related protein 2, 62kDa 1 1
MIRT019951 DCUN1D4 DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae) 1 1
MIRT019952 WWC1 WW and C2 domain containing 1 1 1
MIRT019953 NLE1 notchless homolog 1 (Drosophila) 1 1
MIRT019954 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT019955 CDKN2B cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) 1 1
MIRT019956 UXS1 UDP-glucuronate decarboxylase 1 1 1
MIRT019957 CTSC cathepsin C 1 1
MIRT019958 SH3BP4 SH3-domain binding protein 4 1 1
MIRT019959 FYTTD1 forty-two-three domain containing 1 1 1
MIRT019960 ABI2 abl-interactor 2 1 1
MIRT019961 TMED5 transmembrane emp24 protein transport domain containing 5 1 1
MIRT019962 B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) 1 1
MIRT019963 CUL5 cullin 5 1 1
MIRT019964 STK38L serine/threonine kinase 38 like 1 1
MIRT019965 FZD4 frizzled homolog 4 (Drosophila) 1 1
MIRT019966 RAB6A RAB6A, member RAS oncogene family 1 1
MIRT019967 SPRED1 sprouty-related, EVH1 domain containing 1 1 1
MIRT019968 BCL10 B-cell CLL/lymphoma 10 1 1
MIRT019969 EMC3 transmembrane protein 111 1 1
MIRT019970 TCF12 transcription factor 12 1 1
MIRT019971 PHF3 PHD finger protein 3 1 1
MIRT019972 DIP2C DIP2 disco-interacting protein 2 homolog C (Drosophila) 1 1
MIRT019973 KIAA1524 KIAA1524 1 1
MIRT019974 EIF2AK2 eukaryotic translation initiation factor 2-alpha kinase 2 2 1
MIRT019975 BCL2 B-cell CLL/lymphoma 2 2 1
MIRT019976 NCAM1 neural cell adhesion molecule 1 2 1
MIRT019977 RHOA ras homolog gene family, member A 3 1
MIRT019978 CALU calumenin 1 1
MIRT019979 RPGR retinitis pigmentosa GTPase regulator 1 1
MIRT019980 PPP1R2 protein phosphatase 1, regulatory (inhibitor) subunit 2 1 1
MIRT019981 CCDC88B coiled-coil domain containing 88B 1 1
MIRT019982 TMED8 transmembrane emp24 protein transport domain containing 8 1 1
MIRT019983 CRLF1 cytokine receptor-like factor 1 1 1
MIRT019984 EMP1 epithelial membrane protein 1 1 1
MIRT019985 WDR1 WD repeat domain 1 1 1
MIRT019986 FSTL3 follistatin-like 3 (secreted glycoprotein) 1 1
MIRT019987 SIPA1L3 signal-induced proliferation-associated 1 like 3 1 1
MIRT019988 SLC4A1AP solute carrier family 4 (anion exchanger), member 1, adaptor protein 1 1
MIRT019989 NDST1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 1 1
MIRT019990 C15orf57 chromosome 15 open reading frame 57 1 1
MIRT019991 IL17RA interleukin 17 receptor A 1 1
MIRT019992 BDH2 3-hydroxybutyrate dehydrogenase, type 2 1 1
MIRT019993 RAPGEF1 Rap guanine nucleotide exchange factor (GEF) 1 1 1
MIRT019994 KCNN4 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 1 1
MIRT019995 KRT8 keratin 8 1 1
MIRT019996 ARHGAP11A Rho GTPase activating protein 11A 1 1
MIRT019997 ALMS1 Alstrom syndrome 1 1 1
MIRT019998 SDC1 syndecan 1 1 1
MIRT019999 CRLF3 cytokine receptor-like factor 3 1 1
MIRT020000 VPS37D vacuolar protein sorting 37 homolog D (S. cerevisiae) 1 1
MIRT020001 LIMD2 LIM domain containing 2 1 1
MIRT020002 SLC25A15 solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 1 1
MIRT020003 RAB3D RAB3D, member RAS oncogene family 1 1
MIRT020004 TNNI3 troponin I type 3 (cardiac) 1 1
MIRT020005 DR1 down-regulator of transcription 1, TBP-binding (negative cofactor 2) 1 1
MIRT020006 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT020007 DCTN5 dynactin 5 (p25) 1 1
MIRT020008 ZNF785 zinc finger protein 785 1 1
MIRT020009 COL12A1 collagen, type XII, alpha 1 1 1
MIRT020010 TMX3 thioredoxin-related transmembrane protein 3 1 1
MIRT020011 PIK3IP1 phosphoinositide-3-kinase interacting protein 1 1 1
MIRT020012 OXNAD1 oxidoreductase NAD-binding domain containing 1 1 1
MIRT020013 IFIT1 interferon-induced protein with tetratricopeptide repeats 1 1 1
MIRT020014 MREG melanoregulin 1 1
MIRT020015 ARL2BP ADP-ribosylation factor-like 2 binding protein 1 1
MIRT020016 REEP3 receptor accessory protein 3 1 1
MIRT020017 SCLY selenocysteine lyase 1 1
MIRT020018 DISP2 dispatched homolog 2 (Drosophila) 1 1
MIRT020019 NELFCD TH1-like (Drosophila) 1 1
MIRT020020 METTL2A methyltransferase like 2A 1 1
MIRT020021 FAM126B family with sequence similarity 126, member B 1 1
MIRT020022 NUDT21 nudix (nucleoside diphosphate linked moiety X)-type motif 21 1 1
MIRT020023 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT020024 CEP70 centrosomal protein 70kDa 1 1
MIRT020025 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 1 1
MIRT020026 SLC7A6 solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 1 1
MIRT020027 GDAP1 ganglioside-induced differentiation-associated protein 1 1 1
MIRT020028 CEP128 chromosome 14 open reading frame 145 1 1
MIRT020029 ELL2 elongation factor, RNA polymerase II, 2 1 1
MIRT020030 SLC6A6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 1 1
MIRT020031 EFNB2 ephrin-B2 1 1
MIRT020032 DUSP6 dual specificity phosphatase 6 1 1
MIRT020033 KIAA1191 KIAA1191 1 1
MIRT020034 ATG7 ATG7 autophagy related 7 homolog (S. cerevisiae) 1 1
MIRT020035 WHSC1L1 Wolf-Hirschhorn syndrome candidate 1-like 1 1 1
MIRT020036 DAZAP2 DAZ associated protein 2 1 1
MIRT020037 COG2 component of oligomeric golgi complex 2 1 1
MIRT020038 EBPL emopamil binding protein-like 1 1
MIRT020039 TTC7B tetratricopeptide repeat domain 7B 1 1
MIRT020040 CRIM1 cysteine rich transmembrane BMP regulator 1 (chordin-like) 1 1
MIRT020041 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 1 1
MIRT020042 ODF2 outer dense fiber of sperm tails 2 1 1
MIRT020043 PHF20L1 PHD finger protein 20-like 1 1 1
MIRT020044 CEP57L1 chromosome 6 open reading frame 182 1 1
MIRT020045 PRKCA protein kinase C, alpha 1 1
MIRT020046 USP31 ubiquitin specific peptidase 31 1 1
MIRT020047 NUMB numb homolog (Drosophila) 1 1
MIRT020048 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT020049 EEA1 early endosome antigen 1 1 1
MIRT020050 CELF2 CUGBP, Elav-like family member 2 1 1
MIRT020051 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT020052 EXT1 exostosin 1 1 1
MIRT020053 UGCG UDP-glucose ceramide glucosyltransferase 1 1
MIRT020054 TPR translocated promoter region (to activated MET oncogene) 1 1
MIRT020055 HN1 hematological and neurological expressed 1 1 1
MIRT020056 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT020057 OTX1 orthodenticle homeobox 1 1 1
MIRT020058 IL1RAP interleukin 1 receptor accessory protein 1 1
MIRT020059 DPYSL3 dihydropyrimidinase-like 3 1 1
MIRT020060 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT020061 CXADR coxsackie virus and adenovirus receptor 1 1
MIRT020062 SEC23A Sec23 homolog A (S. cerevisiae) 1 1
MIRT020063 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT020064 WWC2 WW and C2 domain containing 2 1 1
MIRT020065 NT5C2 5'-nucleotidase, cytosolic II 1 1
MIRT020066 NCOA7 nuclear receptor coactivator 7 1 1
MIRT020067 C15orf41 chromosome 15 open reading frame 41 1 1
MIRT020068 RPN1 ribophorin I 1 1
MIRT020069 RB1CC1 RB1-inducible coiled-coil 1 1 1
MIRT020070 LEPROTL1 leptin receptor overlapping transcript-like 1 2 1
MIRT020071 KCNQ2 potassium voltage-gated channel, KQT-like subfamily, member 2 3 1