Accession ID: MIRT019875 [miRNA, hsa-miR-375 :: LDHB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-375LinkOut: [miRBase ]
Synonyms MIRN375, hsa-mir-375, miRNA375, MIR375
Description Homo sapiens miR-375 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-375
Mature Sequence 40| UUUGUUCGUUCGGCUCGCGUGA |61
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-375 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LDHB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms LDH-B, LDH-H, LDHBD, TRG-5
Description lactate dehydrogenase B
Transcript NM_001174097    LinkOut: [ RefSeq ]
Other Transcripts NM_002300   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LDHB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of LDHB
(miRNA target sites are highlighted)
>LDHB|NM_001174097|3'UTR
   1 CTAGTGAGCTCTAGGCTGTAGAAATTTAAAAACTACAATGTGATTAACTCGAGCCTTTAGTTTTCATCCATGTACATGGA
  81 TCACAGTTTGCTTTGATCTTCTTCAATATGTGAATTTGGGCTCACAGAATCAAAGCCTATGCTTGGTTTAATGCTTGCAA
 161 TCTGAGCTCTTGAACAAATAAAATTAACTATTGTAGTGTGC
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aguGCGCUCGGCUU----GCUUGUUu 5'
             :|| | |:||:    :|||||| 
Target 5' gctTGCAATCTGAGCTCTTGAACAAa 3'
153 - 178 137.00 -15.80
2
miRNA  3' agUGCGCUCGGCUUGCUU-GUUu 5'
            |: :|:||: |  ||| ||| 
Target 5' gaATTTGGGCTCACAGAATCAAa 3'
112 - 134 96.00 -8.10
3
miRNA  3' agUGCGCUCGGCUU--GCUUGuuu 5'
            |:|:||  : ||  |||:|   
Target 5' caATGTGA--TTAACTCGAGCctt 3'
36 - 57 94.00 -9.72
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-375 :: LDHB    [ Functional MTI ]
Validation Method Microarray
Article - Tsukamoto, Y. Nakada, C. Noguchi, T. et al.
- Cancer Res, 2010
We investigated expression profiles of microRNA (miRNA) in gastric carcinomas by use of a miRNA microarray platform covering a total of 470 human miRNAs. We identified 39 differentially expressed miRNAs in gastric carcinoma, of which six were significantly downregulated and the other 33 were upregulated. We found that miRNA-375 (miR-375) was the most downregulated and that its ectopic expression in gastric carcinoma cells markedly reduced cell viability via the caspase-mediated apoptosis pathway. Interestingly, we found that expression of miR-375 inhibited expression of PDK1, which is a direct target of miR-375, followed by suppression of Akt phosphorylation. Further analysis by gene expression microarray revealed that 14-3-3zeta, a potent antiapoptotic gene, was significantly downregulated at both the mRNA and protein levels in cells transfected with miR-375. The activity of a luciferase reporter containing the miR-375 binding sequence at the 3' untranslated region (UTR) of 14-3-3zeta mRNA was repressed by the ectopic expression of miR-375, suggesting that miR-375 targets the 3' UTR of 14-3-3zeta. In addition, knockdown of either PDK1 or 14-3-3zeta in gastric carcinoma cells induced caspase activation, which was also observed in miR-375-transfected cells, suggesting that miR-375 may exert its proapoptotic function, at least in part, through the downregulation of PDK1 and 14-3-3zeta. Taken together, we propose that miR-375 is a candidate tumor suppressor miRNA in gastric carcinoma.
LinkOut: [PMID: 20215506]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-375 :: LDHB    [ Functional MTI ]
Validation Method
Article - Isozaki, Y. Hoshino, I. Nohata, N. et al.
- Int J Oncol, 2012
The aim of this study was to determine whether histone acetylation regulates tumor suppressive microRNAs (miRNAs) in esophageal squamous cell carcinoma (ESCC) and to identify genes which are regulated by these miRNAs. We identified a miRNA that was highly upregulated in an ESCC cell line by cyclic hydroxamic acid-containing peptide 31 (CHAP31), one of the histone deacetylase inhibitors (HDACIs), using a miRNA array analysis. miR-375 was strongly upregulated by CHAP31 treatment in an ESCC cell line. The expression levels of the most upregulated miRNA, miR-375 were analyzed by quantitative real-time PCR in human ESCC specimens. The tumor suppressive function of miR-375 was revealed by restoration of miR-375 in ESCC cell lines. We performed a microarray analysis to identify target genes of miR-375. The mRNA and protein expression levels of these genes were verified in ESCC clinical specimens. LDHB and AEG-1/MTDH were detected as miR375-targeted genes. The restoration of miR-375 suppressed the expression of LDHB and AEG-1/MTDH. The ESCC clinical specimens exhibited a high level of LDHB expression at both the mRNA and protein levels. A loss-of-function assay using a siRNA analysis was performed to examine the oncogenic function of the gene. Knockdown of LDHB by RNAi showed a tumor suppressive function in the ESCC cells. The correlation between gene expression and clinicopathological features was investigated by immunohistochemistry for 94 cases of ESCC. The positive staining of LDHB correlated significantly with lymph node metastasis and tumor stage. It also had a tendency to be associated with a poor prognosis. Our results indicate that HDACIs upregulate miRNAs, at least some of which act as tumor suppressors. LDHB, which is regulated by the tumor suppressive miR-375, may therefore act as an oncogene in ESCC.
LinkOut: [PMID: 22752059]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-375 :: LDHB    [ Functional MTI ]
Validation Method
Article - Luo, D. Wilson, J. M. Harvel, N. Liu, J. et al.
- J Transl Med, 2013
In this study we performed a systematic evaluation of functional miRNA-mRNA interactions associated with the invasiveness of breast cancer cells using a combination of integrated miRNA and mRNA expression profiling, bioinformatics prediction, and functional assays. Analysis of the miRNA expression identified 11 miRNAs that were differentially expressed, including 7 down-regulated (miR-200c, miR-205, miR-203, miR-141, miR-34a, miR-183, and miR-375) and 4 up-regulated miRNAs (miR-146a, miR-138, miR-125b1 and miR-100), in invasive cell lines when compared to normal and less invasive cell lines. Transfection of miR-200c, miR-205, and miR-375 mimics into MDA-MB-231 cells led to the inhibition of in vitro cell migration and invasion. The integrated analysis of miRNA and mRNA expression identified 35 known and novel target genes of miR-200c, miR-205, and mir-375, including CFL2, LAMC1, TIMP2, ZEB1, CDH11, PRKCA, PTPRJ, PTPRM, LDHB, and SEC23A. Surprisingly, the majority of these genes (27 genes) were target genes of miR-200c, suggesting that miR-200c plays a pivotal role in regulating the invasiveness of breast cancer cells. We characterized one of the target genes of miR-200c, CFL2, and demonstrated that CFL2 is overexpressed in aggressive breast cancer cell lines and can be significantly down-regulated by exogenous miR-200c. Tissue microarray analysis further revealed that CFL2 expression in primary breast cancer tissue correlated with tumor grade. The results obtained from this study may improve our understanding of the role of these candidate miRNAs and their target genes in relation to breast cancer invasiveness and ultimately lead to the identification of novel biomarkers associated with prognosis.
LinkOut: [PMID: 23497265]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
462 hsa-miR-375 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000053 TIMM8A translocase of inner mitochondrial membrane 8 homolog A (yeast) 4 2
MIRT000054 MTPN myotrophin 2 1
MIRT000055 PDK1 pyruvate dehydrogenase kinase, isozyme 1 4 5
MIRT001747 USP1 ubiquitin specific peptidase 1 2 2
MIRT001748 MXI1 MAX interactor 1 1 1
MIRT001749 JAK2 Janus kinase 2 3 4
MIRT001750 ADIPOR2 adiponectin receptor 2 1 1
MIRT001751 INSM1 insulinoma-associated 1 1 1
MIRT001752 C1QBP complement component 1, q subcomponent binding protein 2 2
MIRT001753 AHR aryl hydrocarbon receptor 1 1
MIRT003057 PLAG1 pleiomorphic adenoma gene 1 2 1
MIRT004439 RASD1 RAS, dexamethasone-induced 1 4 1
MIRT004478 YY1AP1 YY1 associated protein 1 3 1
MIRT005543 ELAVL4 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 5 1
MIRT006154 YAP1 Yes-associated protein 1 5 4
MIRT006207 MTDH metadherin 4 3
MIRT006775 SP1 Sp1 transcription factor 3 2
MIRT007200 MAP3K8 mitogen-activated protein kinase kinase kinase 8 1 1
MIRT007255 FZD8 frizzled family receptor 8 1 2
MIRT019667 RRAGB Ras-related GTP binding B 1 1
MIRT019668 TAF3 TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa 1 1
MIRT019669 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT019670 USP10 ubiquitin specific peptidase 10 1 1
MIRT019671 EXO1 exonuclease 1 1 1
MIRT019672 KLK10 kallikrein-related peptidase 10 1 1
MIRT019673 DNAJC8 DnaJ (Hsp40) homolog, subfamily C, member 8 1 1
MIRT019674 GALM galactose mutarotase (aldose 1-epimerase) 1 1
MIRT019675 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 1
MIRT019676 IFI6 interferon, alpha-inducible protein 6 1 1
MIRT019677 GKAP1 G kinase anchoring protein 1 1 1
MIRT019678 ESPNL espin-like 1 1
MIRT019679 BSN bassoon (presynaptic cytomatrix protein) 1 1
MIRT019680 APH1B anterior pharynx defective 1 homolog B (C. elegans) 1 1
MIRT019681 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT019682 TNPO3 transportin 3 1 1
MIRT019683 TBC1D5 TBC1 domain family, member 5 1 1
MIRT019684 SYNCRIP synaptotagmin binding, cytoplasmic RNA interacting protein 1 1
MIRT019685 C14orf159 chromosome 14 open reading frame 159 1 1
MIRT019686 PHLDA1 pleckstrin homology-like domain, family A, member 1 1 1
MIRT019687 TRMT10A tRNA methyltransferase 10 homolog A (S. cerevisiae) 1 1
MIRT019688 NIN ninein (GSK3B interacting protein) 1 1
MIRT019689 MED8 mediator complex subunit 8 1 1
MIRT019690 SAMD11 sterile alpha motif domain containing 11 1 1
MIRT019691 GATA6 GATA binding protein 6 2 2
MIRT019692 CTGF connective tissue growth factor 1 1
MIRT019693 ZFP91 zinc finger protein 91 homolog (mouse) 1 1
MIRT019694 ENAH enabled homolog (Drosophila) 1 1
MIRT019695 UBLCP1 ubiquitin-like domain containing CTD phosphatase 1 1 1
MIRT019696 RAB10 RAB10, member RAS oncogene family 2 1
MIRT019697 SNAPC1 small nuclear RNA activating complex, polypeptide 1, 43kDa 1 1
MIRT019698 DNAJC2 DnaJ (Hsp40) homolog, subfamily C, member 2 1 1
MIRT019699 GSC goosecoid homeobox 1 1
MIRT019700 CCDC88A coiled-coil domain containing 88A 1 1
MIRT019701 KLHDC8B kelch domain containing 8B 1 1
MIRT019702 UCHL3 ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) 1 1
MIRT019703 JAG1 jagged 1 1 1
MIRT019704 PIGB phosphatidylinositol glycan anchor biosynthesis, class B 1 1
MIRT019705 EXOC6 exocyst complex component 6 2 2
MIRT019706 DESI1 desumoylating isopeptidase 1 1 1
MIRT019707 ASAP2 ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 1 1
MIRT019708 TGFB2 transforming growth factor, beta 2 1 1
MIRT019709 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 1 1
MIRT019710 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 1 1
MIRT019711 TNFSF13 tumor necrosis factor (ligand) superfamily, member 13 1 1
MIRT019712 CPOX coproporphyrinogen oxidase 1 1
MIRT019713 IGFBP3 insulin-like growth factor binding protein 3 1 1
MIRT019714 BAK1 BCL2-antagonist/killer 1 1 1
MIRT019715 AQP11 aquaporin 11 1 1
MIRT019716 WTAP Wilms tumor 1 associated protein 1 1
MIRT019717 NAGPA N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase 1 1
MIRT019718 TMEM25 transmembrane protein 25 1 1
MIRT019719 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT019720 HRSP12 heat-responsive protein 12 1 1
MIRT019721 GTPBP4 GTP binding protein 4 1 1
MIRT019722 SP110 SP110 nuclear body protein 1 1
MIRT019723 RIMS3 regulating synaptic membrane exocytosis 3 1 1
MIRT019724 GPR157 G protein-coupled receptor 157 1 1
MIRT019725 SGOL2 shugoshin-like 2 (S. pombe) 1 1
MIRT019726 SYT15 synaptotagmin XV 1 1
MIRT019727 RRAGC Ras-related GTP binding C 1 1
MIRT019728 STPG1 sperm-tail PG-rich repeat containing 1 1 1
MIRT019729 LMAN2 lectin, mannose-binding 2 1 1
MIRT019730 HOXB13 homeobox B13 1 1
MIRT019731 PRDX3 peroxiredoxin 3 1 1
MIRT019732 GFM2 G elongation factor, mitochondrial 2 1 1
MIRT019733 RPN2 ribophorin II 1 1
MIRT019734 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT019735 FKBP1B FK506 binding protein 1B, 12.6 kDa 1 1
MIRT019736 KIAA0232 KIAA0232 1 1
MIRT019737 ANKRD46 ankyrin repeat domain 46 1 1
MIRT019738 NAT10 N-acetyltransferase 10 (GCN5-related) 1 1
MIRT019739 CCDC59 coiled-coil domain containing 59 1 1
MIRT019740 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 1 1
MIRT019741 METTL2B methyltransferase like 2B 1 1
MIRT019742 STX6 syntaxin 6 1 1
MIRT019743 ENOPH1 enolase-phosphatase 1 1 1
MIRT019744 CNN3 calponin 3, acidic 1 1
MIRT019745 SNX25 sorting nexin 25 1 1
MIRT019746 VGLL4 vestigial like 4 (Drosophila) 1 1
MIRT019747 OGFOD1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT019748 GATAD1 GATA zinc finger domain containing 1 1 1
MIRT019749 TMEM55A transmembrane protein 55A 1 1
MIRT019750 EBAG9 estrogen receptor binding site associated, antigen, 9 1 1
MIRT019751 CKAP2 cytoskeleton associated protein 2 1 1
MIRT019752 NSFL1C NSFL1 (p97) cofactor (p47) 1 1
MIRT019753 PTPMT1 protein tyrosine phosphatase, mitochondrial 1 1 1
MIRT019754 DGKD diacylglycerol kinase, delta 130kDa 1 1
MIRT019755 TNS3 tensin 3 1 1
MIRT019756 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT019757 AZI2 5-azacytidine induced 2 1 1
MIRT019758 PDGFC platelet derived growth factor C 1 1
MIRT019759 OPA1 optic atrophy 1 (autosomal dominant) 1 1
MIRT019760 OSBPL8 oxysterol binding protein-like 8 1 1
MIRT019761 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT019762 NUPL1 nucleoporin like 1 1 1
MIRT019763 HEY1 hairy/enhancer-of-split related with YRPW motif 1 1 1
MIRT019764 RHOQ ras homolog family member Q 1 1
MIRT019765 KDSR 3-ketodihydrosphingosine reductase 1 1
MIRT019766 RAB3B RAB3B, member RAS oncogene family 1 1
MIRT019767 C11orf54 chromosome 11 open reading frame 54 1 1
MIRT019768 CLDN1 claudin 1 1 1
MIRT019769 SERTAD2 SERTA domain containing 2 1 1
MIRT019770 PTPN12 protein tyrosine phosphatase, non-receptor type 12 1 1
MIRT019771 BIRC3 baculoviral IAP repeat containing 3 1 1
MIRT019772 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 1
MIRT019773 PSIP1 PC4 and SFRS1 interacting protein 1 1 1
MIRT019774 CHSY1 chondroitin sulfate synthase 1 1 1
MIRT019775 FAM63B family with sequence similarity 63, member B 1 1
MIRT019776 UNC13B unc-13 homolog B (C. elegans) 1 1
MIRT019777 SLC35B4 solute carrier family 35, member B4 1 1
MIRT019778 EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa 2 3
MIRT019779 TSC22D2 TSC22 domain family, member 2 1 1
MIRT019780 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 1
MIRT019781 RASSF8 Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 1 1
MIRT019782 AGTPBP1 ATP/GTP binding protein 1 1 1
MIRT019783 PAPD4 PAP associated domain containing 4 1 1
MIRT019784 CSTF2 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa 1 1
MIRT019785 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 1
MIRT019786 IFT80 intraflagellar transport 80 homolog (Chlamydomonas) 1 1
MIRT019787 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 1
MIRT019788 LSM12 LSM12 homolog (S. cerevisiae) 1 1
MIRT019789 RLF rearranged L-myc fusion 1 1
MIRT019790 EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 1 1
MIRT019791 PARP1 poly (ADP-ribose) polymerase 1 2 1
MIRT019792 CAB39 calcium binding protein 39 2 1
MIRT019793 MIR17HG miR-17-92 cluster host gene (non-protein coding) 1 1
MIRT019794 IFT46 intraflagellar transport 46 homolog (Chlamydomonas) 1 1
MIRT019795 PBXIP1 pre-B-cell leukemia homeobox interacting protein 1 1 1
MIRT019796 FAM89A family with sequence similarity 89, member A 1 1
MIRT019797 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT019798 AXL AXL receptor tyrosine kinase 1 1
MIRT019799 SEC24C SEC24 family, member C (S. cerevisiae) 1 1
MIRT019800 CRABP2 cellular retinoic acid binding protein 2 1 1
MIRT019801 MKRN1 makorin ring finger protein 1 1 1
MIRT019802 PAQR8 progestin and adipoQ receptor family member VIII 1 1
MIRT019803 NPPB natriuretic peptide B 1 1
MIRT019804 CTDSP2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 1 1
MIRT019805 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 1 1
MIRT019806 TBX19 T-box 19 1 1
MIRT019807 KHK ketohexokinase (fructokinase) 1 1
MIRT019808 SLC39A11 solute carrier family 39 (metal ion transporter), member 11 1 1
MIRT019809 SUB1 SUB1 homolog (S. cerevisiae) 1 1
MIRT019810 DOK7 docking protein 7 1 1
MIRT019811 CYP2U1 cytochrome P450, family 2, subfamily U, polypeptide 1 1 1
MIRT019812 FBXO8 F-box protein 8 1 1
MIRT019813 ABHD4 abhydrolase domain containing 4 1 1
MIRT019814 ARNTL2 aryl hydrocarbon receptor nuclear translocator-like 2 1 1
MIRT019815 ERP44 endoplasmic reticulum protein 44 1 1
MIRT019816 ZNF614 zinc finger protein 614 1 1
MIRT019817 SNRPA1 small nuclear ribonucleoprotein polypeptide A' 1 1
MIRT019818 DUT deoxyuridine triphosphatase 1 1
MIRT019819 CFL2 cofilin 2 (muscle) 1 1
MIRT019820 BATF2 basic leucine zipper transcription factor, ATF-like 2 1 1
MIRT019821 RBBP8 retinoblastoma binding protein 8 1 1
MIRT019822 MOSPD3 motile sperm domain containing 3 1 1
MIRT019823 TMEM74B transmembrane protein 74B 1 1
MIRT019824 ZNF404 zinc finger protein 404 1 1
MIRT019825 PEX11B peroxisomal biogenesis factor 11 beta 1 1
MIRT019826 FAM3C family with sequence similarity 3, member C 1 1
MIRT019827 STAP2 signal transducing adaptor family member 2 1 1
MIRT019828 PEBP1 phosphatidylethanolamine binding protein 1 1 1
MIRT019829 TMEM170A transmembrane protein 170A 1 1
MIRT019830 SESN1 sestrin 1 1 1
MIRT019831 IQCE IQ motif containing E 1 1
MIRT019832 SET SET nuclear oncogene 2 2
MIRT019833 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT019834 TMTC4 transmembrane and tetratricopeptide repeat containing 4 1 1
MIRT019835 MNS1 meiosis-specific nuclear structural 1 1 1
MIRT019836 PRDX1 peroxiredoxin 1 1 1
MIRT019837 MR1 major histocompatibility complex, class I-related 1 1
MIRT019838 CEP44 centrosomal protein 44kDa 1 1
MIRT019839 COX20 COX20 Cox2 chaperone homolog (S. cerevisiae) 1 1
MIRT019840 CENPF centromere protein F, 350/400kDa (mitosin) 1 1
MIRT019841 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 1 1
MIRT019842 BAZ1A bromodomain adjacent to zinc finger domain, 1A 1 1
MIRT019843 DNAH11 dynein, axonemal, heavy chain 11 1 1
MIRT019844 KLHL7 kelch-like 7 (Drosophila) 1 1
MIRT019845 GOLGA4 golgin A4 1 1
MIRT019846 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT019847 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT019848 AKAP7 A kinase (PRKA) anchor protein 7 1 1
MIRT019849 GAS8 growth arrest-specific 8 1 1
MIRT019850 CDCA7L cell division cycle associated 7-like 1 1
MIRT019851 USP46 ubiquitin specific peptidase 46 1 1
MIRT019852 PPP2R3C protein phosphatase 2, regulatory subunit B'', gamma 1 1
MIRT019853 ZC3HAV1 zinc finger CCCH-type, antiviral 1 1 1
MIRT019854 KCTD10 potassium channel tetramerisation domain containing 10 1 1
MIRT019855 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT019856 VEZT vezatin, adherens junctions transmembrane protein 1 1
MIRT019857 ZFHX2 zinc finger homeobox 2 1 1
MIRT019858 SLC35A3 solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3 1 1
MIRT019859 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT019860 UBE3A ubiquitin protein ligase E3A 2 2
MIRT019861 STRBP spermatid perinuclear RNA binding protein 1 1
MIRT019862 NXT2 nuclear transport factor 2-like export factor 2 1 1
MIRT019863 RPGRIP1L RPGRIP1-like 1 1
MIRT019864 CBWD3 COBW domain containing 3 1 1
MIRT019865 SGMS2 sphingomyelin synthase 2 1 1
MIRT019866 SAMD4A sterile alpha motif domain containing 4A 1 1
MIRT019867 PRKX protein kinase, X-linked 1 1
MIRT019868 XPR1 xenotropic and polytropic retrovirus receptor 1 1 1
MIRT019869 INSIG2 insulin induced gene 2 1 1
MIRT019870 MBD2 methyl-CpG binding domain protein 2 1 1
MIRT019871 AHCYL1 adenosylhomocysteinase-like 1 1 1
MIRT019872 TMEM106B transmembrane protein 106B 1 1
MIRT019873 AEBP2 AE binding protein 2 1 1
MIRT019874 ACSL3 acyl-CoA synthetase long-chain family member 3 1 1
MIRT019875 LDHB lactate dehydrogenase B 4 3
MIRT019876 SPAG9 sperm associated antigen 9 1 1
MIRT019877 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT019878 C12orf29 chromosome 12 open reading frame 29 1 1
MIRT019879 POC1B POC1 centriolar protein homolog B (Chlamydomonas) 1 1
MIRT019880 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT019881 DLG4 discs, large homolog 4 (Drosophila) 2 1
MIRT019882 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 2 1
MIRT019883 SETD8 SET domain containing (lysine methyltransferase) 8 2 1
MIRT019884 CASP3 caspase 3, apoptosis-related cysteine peptidase 2 1
MIRT019885 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 2 1
MIRT019886 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 5 2
MIRT019887 MAPKAP1 mitogen-activated protein kinase associated protein 1 1 1
MIRT019888 PGM2 phosphoglucomutase 2 1 1
MIRT019889 RMDN3 family with sequence similarity 82, member A2 1 1
MIRT019890 CARD8 caspase recruitment domain family, member 8 1 1
MIRT019891 SKA2 spindle and kinetochore associated complex subunit 2 1 1
MIRT019892 CMAS cytidine monophosphate N-acetylneuraminic acid synthetase 1 1
MIRT019893 NRBP1 nuclear receptor binding protein 1 1 1
MIRT019894 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT019895 FOLR1 folate receptor 1 (adult) 1 1
MIRT019896 MLEC malectin 1 1
MIRT019897 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 1 1
MIRT019898 APPL2 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 1 1
MIRT019899 RTN2 reticulon 2 1 1
MIRT019900 BOD1L1 biorientation of chromosomes in cell division 1-like 1 1 1
MIRT019901 ITIH4 inter-alpha-trypsin inhibitor heavy chain family, member 4 1 1
MIRT019902 THRA thyroid hormone receptor, alpha 1 1
MIRT019903 SFT2D2 SFT2 domain containing 2 1 1
MIRT019904 PPCS phosphopantothenoylcysteine synthetase 1 1
MIRT019905 SH3D19 SH3 domain containing 19 1 1
MIRT019906 IDNK idnK, gluconokinase homolog (E. coli) 1 1
MIRT019907 CHPT1 choline phosphotransferase 1 1 1
MIRT019908 CHPF chondroitin polymerizing factor 1 1
MIRT019909 SLC25A42 solute carrier family 25, member 42 1 1
MIRT019910 KIAA0513 KIAA0513 1 1
MIRT019911 CREB3 cAMP responsive element binding protein 3 1 1
MIRT019912 LYPD5 LY6/PLAUR domain containing 5 1 1
MIRT019913 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT019914 HK2 hexokinase 2 1 1
MIRT019915 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 1 1
MIRT019916 TMEM145 transmembrane protein 145 1 1
MIRT019917 FAM96A family with sequence similarity 96, member A 1 1
MIRT019918 ZNF540 zinc finger protein 540 1 1
MIRT019919 PROCR protein C receptor, endothelial 1 1
MIRT019920 SNPH syntaphilin 1 1
MIRT019921 LITAF lipopolysaccharide-induced TNF factor 1 1
MIRT019922 CHGB chromogranin B (secretogranin 1) 1 1
MIRT019923 PCGF5 polycomb group ring finger 5 1 1
MIRT019924 FAH fumarylacetoacetate hydrolase (fumarylacetoacetase) 1 1
MIRT019925 PRRT3 proline-rich transmembrane protein 3 1 1
MIRT019926 SERP1 stress-associated endoplasmic reticulum protein 1 1 1
MIRT019927 F3 coagulation factor III (thromboplastin, tissue factor) 1 1
MIRT019928 ZDHHC11 zinc finger, DHHC-type containing 11 1 1
MIRT019929 ZNF571 zinc finger protein 571 1 1
MIRT019930 CEP19 centrosomal protein 19kDa 1 1
MIRT019931 ANKRD1 ankyrin repeat domain 1 (cardiac muscle) 1 1
MIRT019932 HOMER2 homer homolog 2 (Drosophila) 1 1
MIRT019933 CBWD2 COBW domain containing 2 1 1
MIRT019934 PSME4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT019935 CORO1C coronin, actin binding protein, 1C 1 1
MIRT019936 PHTF2 putative homeodomain transcription factor 2 1 1
MIRT019937 DPY19L1 dpy-19-like 1 (C. elegans) 1 1
MIRT019938 HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 1 1
MIRT019939 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT019940 RCN2 reticulocalbin 2, EF-hand calcium binding domain 1 1
MIRT019941 SEMA3C sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C 1 1
MIRT019942 HDHD1 haloacid dehalogenase-like hydrolase domain containing 1 1 1
MIRT019943 STX3 syntaxin 3 1 1
MIRT019944 KPNA4 karyopherin alpha 4 (importin alpha 3) 1 1
MIRT019945 MAT2B methionine adenosyltransferase II, beta 1 1
MIRT019946 RAB28 RAB28, member RAS oncogene family 1 1
MIRT019947 RPUSD4 RNA pseudouridylate synthase domain containing 4 1 1
MIRT019948 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 1 1
MIRT019949 VASN vasorin 1 1
MIRT019950 CDR2 cerebellar degeneration-related protein 2, 62kDa 1 1
MIRT019951 DCUN1D4 DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae) 1 1
MIRT019952 WWC1 WW and C2 domain containing 1 1 1
MIRT019953 NLE1 notchless homolog 1 (Drosophila) 1 1
MIRT019954 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT019955 CDKN2B cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) 1 1
MIRT019956 UXS1 UDP-glucuronate decarboxylase 1 1 1
MIRT019957 CTSC cathepsin C 1 1
MIRT019958 SH3BP4 SH3-domain binding protein 4 1 1
MIRT019959 FYTTD1 forty-two-three domain containing 1 1 1
MIRT019960 ABI2 abl-interactor 2 1 1
MIRT019961 TMED5 transmembrane emp24 protein transport domain containing 5 1 1
MIRT019962 B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) 1 1
MIRT019963 CUL5 cullin 5 1 1
MIRT019964 STK38L serine/threonine kinase 38 like 1 1
MIRT019965 FZD4 frizzled family receptor 4 1 1
MIRT019966 RAB6A RAB6A, member RAS oncogene family 1 1
MIRT019967 SPRED1 sprouty-related, EVH1 domain containing 1 1 1
MIRT019968 BCL10 B-cell CLL/lymphoma 10 1 1
MIRT019969 EMC3 ER membrane protein complex subunit 3 1 1
MIRT019970 TCF12 transcription factor 12 1 1
MIRT019971 PHF3 PHD finger protein 3 1 1
MIRT019972 DIP2C DIP2 disco-interacting protein 2 homolog C (Drosophila) 1 1
MIRT019973 KIAA1524 KIAA1524 4 2
MIRT019974 EIF2AK2 eukaryotic translation initiation factor 2-alpha kinase 2 2 1
MIRT019975 BCL2 B-cell CLL/lymphoma 2 2 1
MIRT019976 NCAM1 neural cell adhesion molecule 1 2 1
MIRT019977 RHOA ras homolog family member A 3 1
MIRT019978 CALU calumenin 1 1
MIRT019979 RPGR retinitis pigmentosa GTPase regulator 1 1
MIRT019980 PPP1R2 protein phosphatase 1, regulatory (inhibitor) subunit 2 1 1
MIRT019981 CCDC88B coiled-coil domain containing 88B 1 1
MIRT019982 TMED8 transmembrane emp24 protein transport domain containing 8 1 1
MIRT019983 CRLF1 cytokine receptor-like factor 1 1 1
MIRT019984 EMP1 epithelial membrane protein 1 1 1
MIRT019985 WDR1 WD repeat domain 1 1 1
MIRT019986 FSTL3 follistatin-like 3 (secreted glycoprotein) 1 1
MIRT019987 SIPA1L3 signal-induced proliferation-associated 1 like 3 1 1
MIRT019988 SLC4A1AP solute carrier family 4 (anion exchanger), member 1, adaptor protein 1 1
MIRT019989 NDST1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 1 1
MIRT019990 C15orf57 chromosome 15 open reading frame 57 1 1
MIRT019991 IL17RA interleukin 17 receptor A 1 1
MIRT019992 BDH2 3-hydroxybutyrate dehydrogenase, type 2 1 1
MIRT019993 RAPGEF1 Rap guanine nucleotide exchange factor (GEF) 1 1 1
MIRT019994 KCNN4 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 1 1
MIRT019995 KRT8 keratin 8 1 1
MIRT019996 ARHGAP11A Rho GTPase activating protein 11A 1 1
MIRT019997 ALMS1 Alstrom syndrome 1 1 1
MIRT019998 SDC1 syndecan 1 1 1
MIRT019999 CRLF3 cytokine receptor-like factor 3 1 1
MIRT020000 VPS37D vacuolar protein sorting 37 homolog D (S. cerevisiae) 1 1
MIRT020001 LIMD2 LIM domain containing 2 1 1
MIRT020002 SLC25A15 solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 1 1
MIRT020003 RAB3D RAB3D, member RAS oncogene family 1 1
MIRT020004 TNNI3 troponin I type 3 (cardiac) 1 1
MIRT020005 DR1 down-regulator of transcription 1, TBP-binding (negative cofactor 2) 1 1
MIRT020006 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT020007 DCTN5 dynactin 5 (p25) 1 1
MIRT020008 ZNF785 zinc finger protein 785 1 1
MIRT020009 COL12A1 collagen, type XII, alpha 1 1 1
MIRT020010 TMX3 thioredoxin-related transmembrane protein 3 1 1
MIRT020011 PIK3IP1 phosphoinositide-3-kinase interacting protein 1 1 1
MIRT020012 OXNAD1 oxidoreductase NAD-binding domain containing 1 1 1
MIRT020013 IFIT1 interferon-induced protein with tetratricopeptide repeats 1 1 1
MIRT020014 MREG melanoregulin 1 1
MIRT020015 ARL2BP ADP-ribosylation factor-like 2 binding protein 1 1
MIRT020016 REEP3 receptor accessory protein 3 1 1
MIRT020017 SCLY selenocysteine lyase 1 1
MIRT020018 DISP2 dispatched homolog 2 (Drosophila) 1 1
MIRT020019 NELFCD TH1-like (Drosophila) 1 1
MIRT020020 METTL2A methyltransferase like 2A 1 1
MIRT020021 FAM126B family with sequence similarity 126, member B 1 1
MIRT020022 NUDT21 nudix (nucleoside diphosphate linked moiety X)-type motif 21 1 1
MIRT020023 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT020024 CEP70 centrosomal protein 70kDa 1 1
MIRT020025 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 1 1
MIRT020026 SLC7A6 solute carrier family 7 (amino acid transporter light chain, y+L system), member 6 1 1
MIRT020027 GDAP1 ganglioside induced differentiation associated protein 1 1 1
MIRT020028 CEP128 centrosomal protein 128kDa 1 1
MIRT020029 ELL2 elongation factor, RNA polymerase II, 2 1 1
MIRT020030 SLC6A6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 1 1
MIRT020031 EFNB2 ephrin-B2 1 1
MIRT020032 DUSP6 dual specificity phosphatase 6 1 1
MIRT020033 KIAA1191 KIAA1191 2 2
MIRT020034 ATG7 autophagy related 7 1 1
MIRT020035 WHSC1L1 Wolf-Hirschhorn syndrome candidate 1-like 1 1 1
MIRT020036 DAZAP2 DAZ associated protein 2 2 2
MIRT020037 COG2 component of oligomeric golgi complex 2 1 1
MIRT020038 EBPL emopamil binding protein-like 1 1
MIRT020039 TTC7B tetratricopeptide repeat domain 7B 1 1
MIRT020040 CRIM1 cysteine rich transmembrane BMP regulator 1 (chordin-like) 1 1
MIRT020041 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 1 1
MIRT020042 ODF2 outer dense fiber of sperm tails 2 1 1
MIRT020043 PHF20L1 PHD finger protein 20-like 1 1 1
MIRT020044 CEP57L1 centrosomal protein 57kDa-like 1 1 1
MIRT020045 PRKCA protein kinase C, alpha 1 1
MIRT020046 USP31 ubiquitin specific peptidase 31 1 1
MIRT020047 NUMB numb homolog (Drosophila) 1 1
MIRT020048 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT020049 EEA1 early endosome antigen 1 1 1
MIRT020050 CELF2 CUGBP, Elav-like family member 2 1 1
MIRT020051 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT020052 EXT1 exostosin 1 1 1
MIRT020053 UGCG UDP-glucose ceramide glucosyltransferase 1 1
MIRT020054 TPR translocated promoter region, nuclear basket protein 1 1
MIRT020055 HN1 hematological and neurological expressed 1 1 1
MIRT020056 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT020057 OTX1 orthodenticle homeobox 1 1 1
MIRT020058 IL1RAP interleukin 1 receptor accessory protein 1 1
MIRT020059 DPYSL3 dihydropyrimidinase-like 3 1 1
MIRT020060 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT020061 CXADR coxsackie virus and adenovirus receptor 1 1
MIRT020062 SEC23A Sec23 homolog A (S. cerevisiae) 1 1
MIRT020063 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT020064 WWC2 WW and C2 domain containing 2 1 1
MIRT020065 NT5C2 5'-nucleotidase, cytosolic II 1 1
MIRT020066 NCOA7 nuclear receptor coactivator 7 1 1
MIRT020067 C15orf41 chromosome 15 open reading frame 41 1 1
MIRT020068 RPN1 ribophorin I 1 1
MIRT020069 RB1CC1 RB1-inducible coiled-coil 1 1 1
MIRT020070 LEPROTL1 leptin receptor overlapping transcript-like 1 2 1
MIRT020071 KCNQ2 potassium voltage-gated channel, KQT-like subfamily, member 2 3 1
MIRT053533 TP53 tumor protein p53 3 1
MIRT053780 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 4 2
MIRT054558 IGF1R insulin-like growth factor 1 receptor 3 1
MIRT054839 PIK3CA phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha 4 1
MIRT438164 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT439093 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 0 1
MIRT450239 TRIM66 tripartite motif containing 66 1 1
MIRT452999 CCDC115 coiled-coil domain containing 115 1 8
MIRT464582 UBN2 ubinuclein 2 1 1
MIRT467646 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT471877 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT476638 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 1 1
MIRT506335 NUP54 nucleoporin 54kDa 1 2
MIRT535329 PHACTR2 phosphatase and actin regulator 2 1 1
MIRT539445 ADAT2 adenosine deaminase, tRNA-specific 2 1 1
MIRT547898 HOXB3 homeobox B3 1 1
MIRT558167 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT562577 CBX3 chromobox homolog 3 1 1
MIRT563274 BBS10 Bardet-Biedl syndrome 10 1 1
MIRT565806 SDCCAG3 serologically defined colon cancer antigen 3 1 1
MIRT566778 KIAA1804 mixed lineage kinase 4 1 1
MIRT567791 DEK DEK oncogene 1 1
MIRT621706 TRPS1 trichorhinophalangeal syndrome I 1 1
MIRT642046 MAL2 mal, T-cell differentiation protein 2 (gene/pseudogene) 1 1
MIRT644551 SPOP speckle-type POZ protein 1 1
MIRT657248 ICOSLG inducible T-cell co-stimulator ligand 1 1
MIRT665368 XIAP X-linked inhibitor of apoptosis 1 1
MIRT698534 TFRC transferrin receptor (p90, CD71) 1 1
MIRT699787 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT709142 ZNF799 zinc finger protein 799 1 1
MIRT709716 FAM196B family with sequence similarity 196, member B 1 1
MIRT712716 NCAPG2 non-SMC condensin II complex, subunit G2 1 1
MIRT721161 FAM200B family with sequence similarity 200, member B 1 1
MIRT722007 TAF2 TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa 1 1
MIRT722397 BCAS2 breast carcinoma amplified sequence 2 1 1
MIRT723363 ZNF470 zinc finger protein 470 1 1
MIRT724593 AP3B1 adaptor-related protein complex 3, beta 1 subunit 1 1
MIRT724967 TNS1 tensin 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*