Accession ID: MIRT021308 [miRNA, hsa-miR-125a-5p :: PDPK1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-125aLinkOut: [miRBase ]
Description Homo sapiens miR-125a stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-125a-5p
Mature Sequence 15| UCCCUGAGACCCUUUAACCUGUGA |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-125a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol PDPK1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms PDK1, PRO0461
Description 3-phosphoinositide dependent protein kinase-1
Transcript NM_0026    LinkOut: [ RefSeq ]
Other Transcripts NM_0312   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on PDPK1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of PDPK1
(miRNA target sites are highlighted)
>PDPK1|NM_0026|3'UTR
   1 CGTGGCCTGCGGCCGGGCTGCCCTTCGCTGCCAGGACACCTGCCCCAGCGCGGCTTGGCCGCCATCCGGGACGCTTCCAG
  81 ACCACCTGCCAGCCATCACAAGGGGAACGCAGAGGCGGAAACCTTGCAGCATTTTTATTTAAAAGAAAAGAAGAAAAAAA
 161 ACACCCAACCACACAAAGAACAAAACCAGTAACAAACACAAAGGAATTCAGGGTCGCTTTGCTTGCTCTCTGTGCTCCGT
 241 GGAGGCCTCCGTGTGCCCTCGTTGCCGTGGGGACCCAGCTCCATGCACGTCAACCCAGTCCCGCCCAGACTAGTGGACAG
 321 ACCTGGTGTCACCAGTTTTTCCTAGCATCAGTCCGAACCATGCGCCCGCCCTGCCCCAACTGTGTGCTGGTCCTGCTGTG
 401 GCCGAGGGGACCGGGTGTGTTTGGCTCTTTATGCCCCTCCCGCTGTGGTCCTGGAACTCTTCACCAGGGAGGGAGCCCTG
 481 CGGGGGCCGCAGCTTTGTGGAGGGAGCCGCCGTGCTTCTGTCACCTGCTCCCTTTCTTGCGTCTCCCTGTGATGGGCCCT
 561 TAGGCCTGGCTGGGCCCATTACATATCCCTGTGGTGGCTCTGGTGGCAGCTTTCTGTGGCCCCTGCTGTGTTGGCAGGCA
 641 GGTTTGCGTGGTGAGGAGCGGGAGGGGTTGGAGTGGTGCGGGAGCAGGCTGCCGAGTGGAGGGTGCCATCGAGGGCTCCG
 721 GATCCCTTATCCTACTTAGCAGTGTTGGTCTCTGGGGCTGGAAGCCGAGCGCATGCTGGGAGCGGTACTGTCAGAAGTGA
 801 GCCCAGTTAGTACCCCGCTGGCTCACTGCACGAGAGAGTCCTGCCCCGAGCCCTAGGTGGGGCCAGGAGGTGCCTTGGAG
 881 AAGCCAGCCAGAGCAGAGAGGGCTGCTGACTTCCGTGTGGAGCAGAGAGGCCTGAGGGCCTCCTAAAAGGTTTAAATGTC
 961 CACGCCTCTCCAGTTGCTGAAGTAGGGTCTGAGAGAACCCTGGCATCAGCAGACCCAGGGTGCTTCTGTCTCCTGCAGAC
1041 CACGCCAGGGAGTGCAGACACCACCGTCACACACGCCCCTTTTGTGTTTTGGTTCAAGTTTCTCAGAGCCCCTCAGAGCT
1121 TCTACATCTGTGCATCAGAAATCTCACAGCCTTCTCATGCTGCCGGCTCATCTGGGCCCATAGAGTGGGCTTTGCCAGTT
1201 GCTGTTGCACAGGAGGCGAGAACAGCACACTTCAACCCCAGCTTGCTGGTCGGCTTTCCTCTAGAGAGAGCCGGTTTTGG
1281 GGCCATTTCCCTTTGATGCTTTGGTGGCCTTGCCCCGCTCTGCAGCACAGACAGGCCAGATGCATTTGTCCTTTGCCTAG
1361 CTACTCCCCAGGTAGAGAGTGCTCCTGGTGGCCTGGCAGGTCTGGGCCCTTCTCTCCCTGCCCAGGTTGTCCCTGGAGGG
1441 CAGCCCTCACTCCCTTTGGGGGAGAGGCAGACATTGCTGCCCACAGACCTGCCTCTGACTCAACTGTGTCCACCCTCCCT
1521 GGTCCCTACCCCCAAGTCACAGGTGACTCAGCAGTGACCCTGTGTGCCAGGCCAGATCCAAACTGAGAGGGAAGGTGTCG
1601 TTTTTACACTGCTAATGACGAGAGTGGCTCTTTTTAGCTAGGCGAGTACAGACGGGGCCTGGGAGGGGGCAGAGATGTTC
1681 CCCAGGCCCTGCCTGTGGTTCCTGCCTGGGCCTTGGCTGCTGCTGTGTGAGAGCTGCATGTGAGCCTGTGACCGTGAGCT
1761 GGGGTGAGCTGGGCCGCACCTACCCTGGGGCCCCAGGGAGCAGGACGCTCCGGGGCCCAGCACGTTGCCCTGGGCCTGTG
1841 GCCGGAGTCGGAGTCCTCTCTCCTCCTCCTGGCTTTTGGAAAGGCTTGGCTGTGTTGGGGAGTCTCTCTTAGCCCTTTCA
1921 GGAATTTCTGTTCAGGCTTCCTCCTCCTCATCAGCTATTTTACCCATCTCAGAACGTCCTGTGTCTCCATGTAGGAGAGT
2001 GGCTCTCTCAGATCTCTCAGGGCGTCTGGTTATAGGGAAACAAGTGGAGCAGGGACGTGGCTTTAATTGGAGCACTCGGC
2081 TGGGCTGCTTGGGGAGACTCTTCCGTGCGTTCTTCCTCTGGATAGAACCACCACCTCCTGGGCGTCACTGACAAGCTCCA
2161 TCTTAACCTCCAAAGCCACAGAACTAGGGGCTCAGAGCCAGAGCTGGCAGCCGCCAGCCAAAATGATGCCATTGCCTGAG
2241 CTGACAGCCAAGCCCTTCTGTGGGTCACCTTTCTCCTCACCCAGCCCCTTGCTCTTCCCTTTTGAAAGGCCCGTGTGTTT
2321 TCTTTCCTTACCCTGTGCTTGCTCATGTCTACTCCGGTTTTCTCTACCACATCCTTAGAGCCATCACCTGGCACGCAGGC
2401 GCCTTACATTCTACGGTAGAACGTGGGGTACTGTGTGTGCACATAGACACACTTACGTGGAATTACAGTTGTGGGTTTAT
2481 CCAAGATGAGGAAGATTTCACCTGCTGTTTAATAGACTTGGGGCCATGTGCCTCCCCACACATGGGCAAGGACAGGTGGA
2561 ATGTCGGGACCACACTGTGCGGCTTCTCGGCACAAAGCGGAGGGAGGCTGTGGTCGCTGCCGGCCTAGGTGTCCCAGGTG
2641 CCCCGCCTTTCTCTGGGACACAGTTGGGGGCTGGCTTCTGAGGGATTCCTTTCTCCCCTCTTTGTGTGGCCCCAGCCAGG
2721 GCGGTGGGCAGTCCTGGTGTAGAGCACAAGCCTCTCCACCCTAGAGAAATGCCTCTGTACCACGGCTACCATGTGGAACC
2801 TTAACTTGCAGAAGGCTTGTTAACAATTGTTTTGAGAGAGATGGCTGGTCATGCCACAGCTGCTGGGGACTCCGCCTACT
2881 CCAGCCCTCTTGGGACACACTGTGGGATTTGTGGCCCTTCCCCAGAGGAATTGTGGAGACTGTCCCATGGAACAAACCCT
2961 CAGGCACCAGCACAGGGCTCTGGGTGACTCAGTAAAACTAACGTTTGTCTCTGACAAGATCAGCTGTAGGCTCACCGGCC
3041 AGAGAAGACCACTGTGAGCATTTTGCCGTATATCCTGCCCTGCCATTTGTTCACTTTTTAAACTAAAATAGGAACATCCG
3121 ACACACACCGTTTGCATCGTCTTCTCCCTTGATATTTTAAGCATTTTCCCATGTCATGAGTTTCTCAGAAACATGTTTTT
3201 AACAATTGTACTATTTAGTCATTGTCCATTTACTATAATTTATCTGACCATTTCCCTACTGTAAAATACTTAAGACGGTT
3281 TCTGATTTTTCCACTATTTAAATAATGCTGTGATGAATATCTTTAAAATCTTCTGATTTCTTACTTTTTTCCCCCTTAGA
3361 TGCCTGGAAGTGGTATTTTGAGGTGAAAGAGTTTGTTCATTTTGAAGATATTTCTGTCTCTCTCTCGACCTGATGTGTAG
3441 ACGCTCACTTCCAGTAGCAGAACCACCTTAGTTGTGTCTTACAGATTCTGAACAAATCGGTTTCTGATAAGCCATGTGTT
3521 CCAAAGAATGTCTGAATAAGACCGCTCTTTATTTAAATGCTAAGAGGATGTCACTACTGCAATCCATCTGTGGCCGATTT
3601 TTTCCAAGAGCCAATTTCCTTGTTTTGGTTGCAAGAACCTGGCTCTGCCTGCATGTCAGCTCTCTGCCCTCCCTGCTGCC
3681 GTGGCTTTCAAGCGCTTGGCAGAATCTTGTACTTCGTGTCCACAATGGTACTGAATTTGCATCTGCACAGTCAGCAGAGA
3761 TAACAAGTGTTGAACTGACCTTGCCACATGCTTAGTGAGTGATTTGTAATTAAGTTTATAGACTCAGAAGGTATATTAGG
3841 ACATTTGGAATCAGTAGCAGAGCAAAGCCTCTTTGAAAAAAACCACGTAGCTGATTGGGTTTTACAAGAGTGCATTTGTC
3921 TCCCCCTTCCACCCGTGGGGCCCCACCTTCAGGTCTTAGTGGTTCACAAGAGCCCAGCAGCCAGGCTGGCTTTTTCATTG
4001 TAGGGCGTGGTTGTCCCAGCTGGTGTAGATTTCAGGCCGCCCCCCCCAACTCCCTGCCCACAGTGTTGCAGATTGCCTGG
4081 CTGGCAGCAAGTCCAGACCACCCAAATTTGGTTGGATTCTTCATTTCTCCACTGTAGTTGGGGTCCATTGATTGTGCAGG
4161 GGAACGTGCAGGAGGTTTTTCTAGGCACCGTGTTCAGTGCTGCTTCACTCTACCAGAGATTATGGCCAAATTGCACGGAA
4241 TTTGGTTTCTTGCCCTCTGAAGCCTGAGGGCCCCCCCTTGCCTGGCTGGTTGACAGACCCGGGGTGGTCACTGCTGAGAC
4321 TTCAGAGATCGCAGCTGCTGTGAGAATACGGTGAAGGTACTTTGTTCTGGAAGATGTTGTCATACACTTTTCCCCAGTTA
4401 TTTTCAAACTTGACATGAGCCTATGTTGACTCACTGGGTGGGGGTCCCTTCTTACGCAGCACACGTGGCAAGTGCCTGAA
4481 TCGGGGCTGGAGGCACTTCAGAGCCTCTGAGGGGCCACCACTTCTGGCCCAAAATTGCAGGGTTGTAGATGAGGCTGCCT
4561 GTGGAGAACTGGTGTGAGGAGGAAGCTGTTTCCAACAAAGAGCACTTTCATCTGTTGAGATGGCTGTGGTGAGCAACTGA
4641 ACGAGCCTACGTGTGTACCTGAATTTTCCCCGTAACTCATTTCTTCCATATGAAGAAACACCAAACTATGTACAGAGAAC
4721 TTTTTACAAAAGGCAGACCTTTTTTAAGCTGTGTAACCCACATAGCCTAACCACCTGGCAGAATGACTACGAATAGGGGT
4801 CATTGTGCTGGTAAAAGCCTCTATTACGACTGTAAGTAAGTTGGATGTTGGCAAAATTAAATTGTTACAGTATTTAGAGC
4881 TGCTGTAGCTGTTCCTTCACAACATAAAATAGGATAAATGACTAGTACGTCTTTCAGGTGGGTGGCAAGCAGAACATGCG
4961 TAATATTCTCTACCTGGTCTGTAGCTGTAACTGTGATGTACAGACAAAGCAAAAATTAAAAGAACTTATGAAAACAAATG
5041 CAATGATACTAGGATATACACTTTTGTATTTTTATTCTTATATAAGGTTATTTGCTGGCTATTGTTGGCCTCTAGTTCAG
5121 TCTGTGTTATTTAAATTCTAATATATGAATTATTTGAATTGAATTCATGTTCGGGGCCACGTTGTTGTATGTATTGATGT
5201 ACAGCCTTGAATGTGAATAATTATTGTAAACTATATTTTACAACTTTTTTTCTGGCTTTATTATATAAATTTTCTATTGG
5281 GTCAGTGATTTAATCATATAATTTAATGAATCTGTTTATCCTTTTTTTTTTTCCAAATACTTGTGCTTTAGGTGTAGTTA
5361 CCAGATGATGAATTTTCCTCGTATGGTCAGTAGTCTTGTAATAAAAAGCATGTAGAGTGTA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aguguccaauuucccAGAGUCCCu 5'
                         |||||||| 
Target 5' tggctctctcagatcTCTCAGGGc 3'
2000 - 2023 145.00 -13.00
2
miRNA  3' aguguccaaUUUCCCAGAGUCCCu 5'
                   |||||  :|||||| 
Target 5' aacaaacacAAAGGAATTCAGGGt 3'
191 - 214 143.00 -18.30
3
miRNA  3' aguguCCAAUUUCCCAGAGUCCCu 5'
               |||| |||  |||||| | 
Target 5' gttttGGTTCAAGTTTCTCAGAGc 3'
1086 - 1109 139.00 -12.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-125a-5p :: PDPK1    [ Functional MTI ]
Validation Method Sequencing
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
138 hsa-miR-125a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000602 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 4 1
MIRT003738 LIN28A lin-28 homolog A (C. elegans) 2 2
MIRT003755 NTRK3 neurotrophic tyrosine kinase, receptor, type 3 3 5
MIRT004052 CD34 CD34 molecule 4 1
MIRT004071 TP53 tumor protein p53 4 2
MIRT004326 LIF leukemia inhibitory factor 1 1
MIRT004388 MTUS1 microtubule associated tumor suppressor 1 2 1
MIRT004389 RARA retinoic acid receptor, alpha 2 1
MIRT004445 VEGFA vascular endothelial growth factor A 2 1
MIRT005117 ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 5 3
MIRT005118 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 4 3
MIRT005339 KLF13 Kruppel-like factor 13 4 1
MIRT005350 BAK1 BCL2-antagonist/killer 1 4 1
MIRT005419 ARID3B AT rich interactive domain 3B (BRIGHT-like) 3 1
MIRT005421 ELAVL1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) 3 1
MIRT005678 CCL5 chemokine (C-C motif) ligand 5 0 1
MIRT006471 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 2 1
MIRT006809 SMAD4 SMAD family member 4 2 1
MIRT006905 MMP11 matrix metallopeptidase 11 (stromelysin 3) 3 1
MIRT006944 HK2 hexokinase 2 1 1
MIRT021283 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 1 1
MIRT021284 E2F7 E2F transcription factor 7 1 1
MIRT021285 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT021286 CREB5 cAMP responsive element binding protein 5 1 1
MIRT021287 OMA1 OMA1 zinc metallopeptidase homolog (S. cerevisiae) 1 1
MIRT021288 OSTM1 osteopetrosis associated transmembrane protein 1 1 1
MIRT021289 MAPK8 mitogen-activated protein kinase 8 1 1
MIRT021290 RBM17 RNA binding motif protein 17 1 1
MIRT021291 PUM2 pumilio homolog 2 (Drosophila) 1 1
MIRT021292 NR1D2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT021293 HOXC4 homeobox C4 1 1
MIRT021294 SNX4 sorting nexin 4 1 1
MIRT021295 NDUFB6 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa 1 1
MIRT021296 NOP16 NOP16 nucleolar protein homolog (yeast) 1 1
MIRT021297 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT021298 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT021299 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT021300 TCEB2 transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) 1 1
MIRT021301 PANX1 pannexin 1 1 1
MIRT021302 ZFAND1 zinc finger, AN1-type domain 1 1 1
MIRT021303 CORO1C coronin, actin binding protein, 1C 1 1
MIRT021304 CLDN12 claudin 12 1 1
MIRT021305 ZNF776 zinc finger protein 776 1 1
MIRT021306 TNPO2 transportin 2 1 1
MIRT021307 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 1 1
MIRT021308 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT021309 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 1 2
MIRT021310 DUSP3 dual specificity phosphatase 3 1 1
MIRT021311 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT021312 ATXN1 ataxin 1 1 1
MIRT021313 TMEM101 transmembrane protein 101 1 1
MIRT021314 ERMP1 endoplasmic reticulum metallopeptidase 1 1 1
MIRT021315 GUCD1 chromosome 22 open reading frame 13 1 1
MIRT021316 RBAK RB-associated KRAB zinc finger 1 1
MIRT021317 ATL2 atlastin GTPase 2 1 1
MIRT045697 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 1
MIRT045698 PREPL prolyl endopeptidase-like 1 1
MIRT045699 PPP2R5E protein phosphatase 2, regulatory subunit B', epsilon isoform 1 1
MIRT045700 TFRC transferrin receptor (p90, CD71) 1 1
MIRT045701 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 1 1
MIRT045702 PLS3 plastin 3 1 1
MIRT045703 TTC30B tetratricopeptide repeat domain 30B 1 1
MIRT045704 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT045705 COIL coilin 1 1
MIRT045706 NDEL1 nudE nuclear distribution E homolog (A. nidulans)-like 1 1 1
MIRT045707 ATXN7L3 ataxin 7-like 3 1 1
MIRT045708 PRC1 protein regulator of cytokinesis 1 1 1
MIRT045709 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT045710 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT045711 KIAA0232 KIAA0232 1 1
MIRT045712 TOR4A torsin family 4, member A 1 1
MIRT045713 TPI1 triosephosphate isomerase 1 1 1
MIRT045714 PCDHGB2 protocadherin gamma subfamily B, 2 1 1
MIRT045715 UBE2G2 ubiquitin-conjugating enzyme E2G 2 1 1
MIRT045716 SPRTN SprT-like N-terminal domain 1 1
MIRT045717 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT045718 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT045719 OSBPL9 oxysterol binding protein-like 9 1 1
MIRT045720 LBX2 ladybird homeobox 2 1 1
MIRT045721 SEPW1 selenoprotein W, 1 1 1
MIRT045722 PGM3 phosphoglucomutase 3 1 1
MIRT045723 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT045724 PC pyruvate carboxylase 1 1
MIRT045725 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT045726 TBC1D1 TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 1 1
MIRT045727 PLA2G4F phospholipase A2, group IVF 1 1
MIRT045728 PEG10 paternally expressed 10 1 1
MIRT045729 ATP5G2 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) 1 1
MIRT045730 FBXO10 F-box protein 10 1 1
MIRT045731 TDG thymine-DNA glycosylase 1 1
MIRT045732 SP1 Sp1 transcription factor 1 1
MIRT045733 DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) 1 1
MIRT045734 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT045735 RALBP1 ralA binding protein 1 1 1
MIRT045736 RPS2 ribosomal protein S2 1 1
MIRT045737 MRPL50 mitochondrial ribosomal protein L50 1 1
MIRT045738 NIN ninein (GSK3B interacting protein) 1 1
MIRT045739 MORC2 MORC family CW-type zinc finger 2 1 1
MIRT045740 ZZEF1 zinc finger, ZZ-type with EF-hand domain 1 1 1
MIRT045741 PDCL3 phosducin-like 3 1 1
MIRT045742 RPL35A ribosomal protein L35a 1 1
MIRT045743 ND6 NADH dehydrogenase, subunit 6 (complex I) 1 1
MIRT045744 TPM4 tropomyosin 4 1 1
MIRT045745 RPL9 ribosomal protein L9 1 1
MIRT045746 ENO1 enolase 1, (alpha) 1 1
MIRT045747 CLCN7 chloride channel, voltage-sensitive 7 1 1
MIRT045748 COL4A1 collagen, type IV, alpha 1 1 1
MIRT045749 NME2 NME/NM23 nucleoside diphosphate kinase 2 1 1
MIRT045750 GGCT gamma-glutamylcyclotransferase 1 1
MIRT045751 CGNL1 cingulin-like 1 1 1
MIRT045752 ZMYND19 zinc finger, MYND-type containing 19 1 1
MIRT045753 MAT2A methionine adenosyltransferase II, alpha 1 1
MIRT045754 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT045755 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT045756 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 1 1
MIRT045757 EMID1 EMI domain containing 1 1 1
MIRT045758 ATP5J2 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2 1 1
MIRT045759 STAT2 signal transducer and activator of transcription 2, 113kDa 1 1
MIRT045760 FERMT1 fermitin family member 1 1 1
MIRT045761 DIP2A DIP2 disco-interacting protein 2 homolog A (Drosophila) 1 1
MIRT045762 MAP3K1 mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase 1 1
MIRT045763 SLFN11 schlafen family member 11 1 1
MIRT045764 AGTRAP angiotensin II receptor-associated protein 1 1
MIRT045765 KIF6 kinesin family member 6 1 1
MIRT045766 TRMT2A tRNA methyltransferase 2 homolog A (S. cerevisiae) 1 1
MIRT045767 PAM peptidylglycine alpha-amidating monooxygenase 1 1
MIRT045768 UNC45A unc-45 homolog A (C. elegans) 1 1
MIRT045769 MAP2K7 mitogen-activated protein kinase kinase 7 1 1
MIRT045770 LYPLA1 lysophospholipase I 1 1
MIRT045771 LAMB1 laminin, beta 1 1 1
MIRT045772 NCKIPSD NCK interacting protein with SH3 domain 1 1
MIRT045773 OTUB2 OTU domain, ubiquitin aldehyde binding 2 1 1
MIRT045774 CASC4 cancer susceptibility candidate 4 1 1
MIRT045775 ZDHHC9 zinc finger, DHHC-type containing 9 1 1
MIRT045776 ARHGAP12 Rho GTPase activating protein 12 1 1
MIRT045777 YIPF4 Yip1 domain family, member 4 1 1
MIRT045778 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT045779 C17orf80 chromosome 17 open reading frame 80 1 1