Accession ID: MIRT021427 [miRNA, hsa-miR-9-5p :: SLC22A5, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-9-1LinkOut: [miRBase ]
Synonyms MIRN9-1, hsa-mir-9-1, miRNA9-1, MIR9-1
Description Homo sapiens miR-9-1 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-9-5p
Mature Sequence 16| UCUUUGGUUAUCUAGCUGUAUGA |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-9-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SLC22A5 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDSP, FLJ46769, OCTN2, OCTN2VT
Description solute carrier family 22 (organic cation/carnitine transporter), member 5
Transcript NM_0030    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SLC22A5 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SLC22A5
(miRNA target sites are highlighted)
>SLC22A5|NM_0030|3'UTR
   1 TAACATCGCTTCCAGTAAGGGAGAAACTGAAGAGGAAAGACTGTCTTGCCAGAAATGGCCAGCTTGTGCAGACTCCGAGT
  81 CCTTCAGTGACAAAAGGCCTTTGCTGTTTGTCCTCTTGACCTGTGTCTGACTTGCTCCTGGATGGGCACCCACACTCAGA
 161 GGCTACATATGGCCCTAGAGCACCACCTTCCTCTAGGGACACTGGGGCTACCTACAGACAACTTCATCTAAGTCCTAACT
 241 ATTACAATGATGGACTCAGCACCTCCAAAGCAGTTAATTTTTCACTAGAACCAGTGAGATCTGGAGGAATGTGAGAAGCA
 321 TATGCTAAATGTACATTTTAATTTTAGACTACTTGAAAAGGCCCCTAATAAGGCTAGAGGTCTAAGTCCCCCACCCCTTT
 401 CCCCACTCCCCTCTAGTGGTGAACTTTAGAGGAAAAGGAAGTAATTGCACAAGGAGTTTGATTCTTACCTTTTCTCAGTT
 481 ACAGAGGACATTAACTGGATCATTGCTTCCCCAGGGCAGGAGAGCGCAGAGCTAGGGAAAGTGAAAGGTAATGAAGATGG
 561 AGCAGAATGAGCAGATGCAGATCACCAGCAAAGTGCACTGATGTGTGAGCTCTTAAGACCACTCAGCATGACGACTGAGT
 641 AGACTTGTTTACATCTGATCAAAGCACTGGGCTTGTCCAGGCTCATAATAAATGCTCCATTGAATCTACTATTCTTGTTT
 721 TCCACTGCTGTGGAAACCTCCTTGCTACTATAGCGTCTTATGTATGGTTTAAAGGAAATTTATCAGGTGAGAGAGATGAG
 801 CAACGTTGTCTTTTCTCTCAAAGCTGTAATGTGGGTTTTGTTTTATTGTTTATTTGTTTGTTGTTGTATCCTTTTCTCCT
 881 TGTTATTTGCCCTTCAGAATGCACTTGGGAAAGGCTGGTTCCTTAGCCTCCTGGTTTGTGTCTTTTTTTTTTTTTTTTTA
 961 AAACAGAATCACTCTGGCAATTGTCTGCAGCTGCCACTGGTGCAAGGCCTTACCAGCCCTAGCCTCTAGCACTTCTCTAA
1041 GTGCCAAAAACAGTGTCATTGTGTGTGTTCCTTTCTTGATACTTAGTCATGGGAGGATATTACAAAAAAGAAATTTAAAT
1121 TGTGTTCATAGTCTTTCAGAGTAGCTCACTTTAGTCCTGTAACTTTATTGGGTGATATTTTGTGTTCAGTGTAATTGTCT
1201 TCTCTTTGCTGATTATGTTACCATGGTACTCCTAAAGCATATGCCTCACCTGGTTAAAAAAGAACAAACATGTTTTTGTG
1281 AAAGCTACTGAAGTGCCTTGGGAAATGAGAAAGTTTTAATAAGTAAAATGATTTTTTAAATAACAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aguAUGUCGAUCUAUUGGUUUCu 5'
             |||| |    |:|:||||| 
Target 5' gttTACATC----TGATCAAAGc 3'
647 - 665 138.00 -7.80
2
miRNA  3' agUAUGUCGAUCUAUUGGUUUCu 5'
            :|| ||  ||| |||::||| 
Target 5' caGTA-AGGGAGA-AACTGAAGa 3'
13 - 33 127.00 -10.50
3
miRNA  3' agUAUGUCGAUCUAUUGGUUUCu 5'
            ||:||| |  |  | ||||| 
Target 5' agATGCAGAT-CACCAGCAAAGt 3'
573 - 594 124.00 -9.32
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-9-5p :: SLC22A5    [ Functional MTI ]
Validation Method Microarray
Article - Grimson, A. Farh, K. K. Johnston, W. K. et al.
- Mol Cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
197 hsa-miR-9-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000025 MMP13 matrix metallopeptidase 13 (collagenase 3) 2 1
MIRT000026 REST RE1-silencing transcription factor 3 2
MIRT000029 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 3 2
MIRT000639 POU2F2 POU class 2 homeobox 2 2 1
MIRT000640 BCL6 B-cell CLL/lymphoma 6 2 1
MIRT000641 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 2 2
MIRT001202 RAB34 RAB34, member RAS oncogene family 3 1
MIRT001736 BACE1 beta-site APP-cleaving enzyme 1 2 1
MIRT001937 PRDM1 PR domain containing 1, with ZNF domain 4 3
MIRT003193 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 4 4
MIRT003300 FOXO1 forkhead box O1 4 2
MIRT003323 NTRK3 neurotrophic tyrosine kinase, receptor, type 3 3 5
MIRT004982 NR2E1 nuclear receptor subfamily 2, group E, member 1 4 1
MIRT005390 ONECUT2 one cut homeobox 2 5 2
MIRT005783 CDX2 caudal type homeobox 2 2 1
MIRT006781 AP3B1 adaptor-related protein complex 3, beta 1 subunit 4 1
MIRT006782 CCNG1 cyclin G1 4 2
MIRT006833 SRF serum response factor (c-fos serum response element-binding transcription factor) 2 1
MIRT006892 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 3 2
MIRT006894 TGFBI transforming growth factor, beta-induced, 68kDa 1 1
MIRT007035 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT007060 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 2 1
MIRT007326 FOXO3 forkhead box O3 1 1
MIRT007372 CCND1 cyclin D1 1 1
MIRT021318 KLRC1 killer cell lectin-like receptor subfamily C, member 1 1 1
MIRT021319 DSP desmoplakin 1 1
MIRT021320 POGZ pogo transposable element with ZNF domain 1 1
MIRT021321 CCL19 chemokine (C-C motif) ligand 19 1 1
MIRT021322 EFNA1 ephrin-A1 1 1
MIRT021323 SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1 1
MIRT021324 NRIP3 nuclear receptor interacting protein 3 1 1
MIRT021325 MYF6 myogenic factor 6 (herculin) 1 1
MIRT021326 LRP1 low density lipoprotein receptor-related protein 1 1 1
MIRT021327 SLC35E2 solute carrier family 35, member E2 1 1
MIRT021328 HOXC12 homeobox C12 1 1
MIRT021329 SYNE1 spectrin repeat containing, nuclear envelope 1 1 1
MIRT021330 STK3 serine/threonine kinase 3 (STE20 homolog, yeast) 1 1
MIRT021331 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 1
MIRT021332 PLEKHB1 pleckstrin homology domain containing, family B (evectins) member 1 1 1
MIRT021333 RASSF8 Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 1 1
MIRT021334 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT021335 ATG10 ATG10 autophagy related 10 homolog (S. cerevisiae) 1 1
MIRT021336 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT021337 C7orf31 chromosome 7 open reading frame 31 1 1
MIRT021338 CMTM2 CKLF-like MARVEL transmembrane domain containing 2 1 1
MIRT021339 CERS4 LAG1 homolog, ceramide synthase 4 1 1
MIRT021340 PPAP2A phosphatidic acid phosphatase type 2A 1 1
MIRT021341 KCNJ15 potassium inwardly-rectifying channel, subfamily J, member 15 1 1
MIRT021342 SUMF2 sulfatase modifying factor 2 1 1
MIRT021343 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT021344 CXXC5 CXXC finger 5 1 1
MIRT021345 TCL1B T-cell leukemia/lymphoma 1B 1 1
MIRT021346 EP300 E1A binding protein p300 1 1
MIRT021347 AUH AU RNA binding protein/enoyl-CoA hydratase 1 1
MIRT021348 TRRAP transformation/transcription domain-associated protein 1 1
MIRT021349 DMXL1 Dmx-like 1 1 1
MIRT021350 EOGT chromosome 3 open reading frame 64 1 1
MIRT021351 RCC2 regulator of chromosome condensation 2 1 1
MIRT021352 PIGB phosphatidylinositol glycan anchor biosynthesis, class B 1 1
MIRT021353 NAV1 neuron navigator 1 1 1
MIRT021354 ATP6V1C2 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2 1 1
MIRT021355 PLCB4 phospholipase C, beta 4 1 1
MIRT021356 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT021357 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT021358 AVIL advillin 1 1
MIRT021359 APBB2 amyloid beta (A4) precursor protein-binding, family B, member 2 1 1
MIRT021360 CA13 carbonic anhydrase XIII 1 1
MIRT021361 FLNB filamin B, beta 1 1
MIRT021362 IREB2 iron-responsive element binding protein 2 1 1
MIRT021363 KLRK1 killer cell lectin-like receptor subfamily K, member 1 1 1
MIRT021364 CDH3 cadherin 3, type 1, P-cadherin (placental) 1 1
MIRT021365 MCC mutated in colorectal cancers 1 1
MIRT021366 SYNE2 spectrin repeat containing, nuclear envelope 2 1 1
MIRT021367 MAP1B microtubule-associated protein 1B 1 1
MIRT021368 NFATC3 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 1 1
MIRT021369 SPAG9 sperm associated antigen 9 1 1
MIRT021370 ZNF407 zinc finger protein 407 1 1
MIRT021371 SEC23IP SEC23 interacting protein 1 1
MIRT021372 NBEA neurobeachin 1 1
MIRT021373 SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 1 1
MIRT021374 PQLC3 PQ loop repeat containing 3 1 1
MIRT021375 C9orf89 chromosome 9 open reading frame 89 1 1
MIRT021376 NCOR2 nuclear receptor corepressor 2 1 1
MIRT021377 P4HA2 prolyl 4-hydroxylase, alpha polypeptide II 1 1
MIRT021378 MYLK myosin light chain kinase 1 1
MIRT021379 NIN ninein (GSK3B interacting protein) 1 1
MIRT021380 FERMT1 fermitin family homolog 1 (Drosophila) 1 1
MIRT021381 PRKD3 protein kinase D3 1 1
MIRT021382 SYAP1 synapse associated protein 1, SAP47 homolog (Drosophila) 1 1
MIRT021383 TRPM7 transient receptor potential cation channel, subfamily M, member 7 1 1
MIRT021384 GPBP1L1 GC-rich promoter binding protein 1-like 1 1 1
MIRT021385 UHMK1 U2AF homology motif (UHM) kinase 1 1 1
MIRT021386 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT021387 SNX7 sorting nexin 7 1 1
MIRT021388 LMNA lamin A/C 1 1
MIRT021389 FBN2 fibrillin 2 1 1
MIRT021390 PXDN peroxidasin homolog (Drosophila) 1 1
MIRT021391 TBPL1 TBP-like 1 1 1
MIRT021392 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 1
MIRT021393 FAIM Fas apoptotic inhibitory molecule 1 1
MIRT021394 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT021395 VIM vimentin 1 1
MIRT021396 CHSY1 chondroitin sulfate synthase 1 1 1
MIRT021397 XRN2 5'-3' exoribonuclease 2 1 1
MIRT021398 HIST1H4H histone cluster 1, H4h 1 1
MIRT021399 TWISTNB TWIST neighbor 2 2
MIRT021400 ZBED3 zinc finger, BED-type containing 3 2 2
MIRT021401 VEGFA vascular endothelial growth factor A 2 1
MIRT021402 CHMP2B chromatin modifying protein 2B 2 1
MIRT021403 STMN1 stathmin 1 3 1
MIRT021404 GRN granulin 1 1
MIRT021405 TTC7B tetratricopeptide repeat domain 7B 1 1
MIRT021406 TAGLN transgelin 1 1
MIRT021407 EFCAB14 KIAA0494 1 1
MIRT021408 FSTL3 follistatin-like 3 (secreted glycoprotein) 1 1
MIRT021409 BIK BCL2-interacting killer (apoptosis-inducing) 1 1
MIRT021410 SPI1 spleen focus forming virus (SFFV) proviral integration oncogene spi1 1 1
MIRT021411 HLA-A major histocompatibility complex, class I, A 1 1
MIRT021412 CALML5 calmodulin-like 5 1 1
MIRT021413 HTR3A 5-hydroxytryptamine (serotonin) receptor 3A 1 1
MIRT021414 F2 coagulation factor II (thrombin) 1 1
MIRT021415 LPXN leupaxin 1 1
MIRT021416 LINC00483 chromosome 17 open reading frame 73 1 1
MIRT021417 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT021418 MTX3 metaxin 3 1 1
MIRT021419 AKR1CL1 aldo-keto reductase family 1, member C-like 1 1 1
MIRT021420 IDS iduronate 2-sulfatase 1 1
MIRT021421 ELF3 E74-like factor 3 (ets domain transcription factor, epithelial-specific ) 1 1
MIRT021422 GNAT2 guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 1 1
MIRT021423 SLC30A4 solute carrier family 30 (zinc transporter), member 4 1 1
MIRT021424 IPO7 importin 7 1 1
MIRT021425 WNT8A wingless-type MMTV integration site family, member 8A 1 1
MIRT021426 GIP gastric inhibitory polypeptide 1 1
MIRT021427 SLC22A5 solute carrier family 22 (organic cation/carnitine transporter), member 5 1 1
MIRT021428 SPON2 spondin 2, extracellular matrix protein 1 1
MIRT021429 MAGEA2B melanoma antigen family A, 2B 1 1
MIRT021430 ATL1 atlastin GTPase 1 1 1
MIRT021431 RHOV ras homolog gene family, member V 1 1
MIRT021432 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT021433 LRRTM1 leucine rich repeat transmembrane neuronal 1 1 1
MIRT021434 WNT6 wingless-type MMTV integration site family, member 6 1 1
MIRT021435 NKX2-2 NK2 homeobox 2 1 1
MIRT021436 SLC25A30 solute carrier family 25, member 30 1 1
MIRT021437 CUEDC1 CUE domain containing 1 1 1
MIRT021438 ALDH1A3 aldehyde dehydrogenase 1 family, member A3 1 1
MIRT021439 MN1 meningioma (disrupted in balanced translocation) 1 1 1
MIRT021440 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT021441 SLC22A3 solute carrier family 22 (extraneuronal monoamine transporter), member 3 1 1
MIRT021442 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 1 1
MIRT021443 KIF1B kinesin family member 1B 1 1
MIRT021444 E2F7 E2F transcription factor 7 1 1
MIRT021445 HN1L hematological and neurological expressed 1-like 1 1
MIRT021447 CYP39A1 cytochrome P450, family 39, subfamily A, polypeptide 1 1 1
MIRT021448 MORF4L1 mortality factor 4 like 1 1 1
MIRT021449 ARHGEF10 Rho guanine nucleotide exchange factor (GEF) 10 1 1
MIRT021450 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT021451 TBC1D9 TBC1 domain family, member 9 (with GRAM domain) 1 1
MIRT021452 ATP11C ATPase, class VI, type 11C 1 1
MIRT021453 FRMD4B FERM domain containing 4B 1 1
MIRT021454 SNAI2 snail homolog 2 (Drosophila) 1 1
MIRT021455 OPTN optineurin 1 1
MIRT021456 FNBP1 formin binding protein 1 1 1
MIRT021457 PTPRK protein tyrosine phosphatase, receptor type, K 1 1
MIRT021458 PRG4 p53-responsive gene 4 1 1
MIRT021459 SDC1 syndecan 1 1 1
MIRT021460 EEF2K eukaryotic elongation factor-2 kinase 1 1
MIRT021461 ATP7A ATPase, Cu++ transporting, alpha polypeptide 1 1
MIRT021462 CERS2 LAG1 homolog, ceramide synthase 2 1 1
MIRT021463 ACADSB acyl-CoA dehydrogenase, short/branched chain 1 1
MIRT021464 COL12A1 collagen, type XII, alpha 1 1 1
MIRT021465 PDZK1 PDZ domain containing 1 1 1
MIRT021466 CAPZA1 capping protein (actin filament) muscle Z-line, alpha 1 1 1
MIRT021467 PPP4R2 protein phosphatase 4, regulatory subunit 2 1 1
MIRT021468 SERAC1 serine active site containing 1 1 1
MIRT021469 TESK2 testis-specific kinase 2 1 1
MIRT021470 LDLRAP1 low density lipoprotein receptor adaptor protein 1 1 1
MIRT021471 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT021472 KLF5 Kruppel-like factor 5 (intestinal) 1 1
MIRT021473 FAM46A family with sequence similarity 46, member A 1 1
MIRT021474 CCNDBP1 cyclin D-type binding-protein 1 1 1
MIRT021475 RBFOX2 RNA binding motif protein 9 1 1
MIRT021476 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT021477 POU2F1 POU class 2 homeobox 1 1 1
MIRT021478 SYNGR2 synaptogyrin 2 1 1
MIRT021479 SYPL1 synaptophysin-like 1 1 1
MIRT021480 GFOD1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT021481 RNF44 ring finger protein 44 1 1
MIRT021482 TC2N tandem C2 domains, nuclear 1 1
MIRT021483 COLEC12 collectin sub-family member 12 1 1
MIRT021484 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT021485 CNOT6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT021486 CD34 CD34 molecule 1 1
MIRT021487 MESDC1 mesoderm development candidate 1 1 1
MIRT045780 BOD1L1 biorientation of chromosomes in cell division 1-like 1 1
MIRT045781 ITGB3BP integrin beta 3 binding protein (beta3-endonexin) 1 1
MIRT045782 QARS glutaminyl-tRNA synthetase 1 1
MIRT045783 KIF1A kinesin family member 1A 1 1