Accession ID: MIRT021559 [miRNA, hsa-miR-142-3p :: ETNK2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-142LinkOut: [miRBase ]
Description Homo sapiens miR-142 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-142-3p
Mature Sequence 52| UGUAGUGUUUCCUACUUUAUGGA |74
Evidence Experimental
Experiments Cloned
Putative hsa-miR-142-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ETNK2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms EKI2, HMFT1716
Description ethanolamine kinase 2
Transcript NM_018208    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ETNK2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ETNK2
(miRNA target sites are highlighted)
>ETNK2|NM_018208|3'UTR
   1 TATCGTGGGAGAGCCTGGGCAGGATCCCATCAGAAAGGTGCTGACTAAACTGGTTGCCCGGACACTCAACAGCCTCCACC
  81 TCCCTTTCTACCCTCACAGCTCCTGGGGCCTTCCTGGCTCTGGCCCAGAAAGTGATTCATTTGTAAATTATCATGGTTTT
 161 CTTTCTGCATTAAAATGCTCATTTCCGGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agguAUUUCAUC--C---UUUGUGAugu 5'
              |||| |:|  |   ::|||||   
Target 5' tgacTAAACTGGTTGCCCGGACACTcaa 3'
42 - 69 113.00 -9.80
2
miRNA  3' agGUAUUUCAUCCUUUGUGAugu 5'
            || |||||  ||  ||:|   
Target 5' ccCAGAAAGT--GATTCATTtgt 3'
124 - 144 81.00 -8.42
3
miRNA  3' agguAUUUCAUCCUUUGUGAUgu 5'
              ||  ||:|||:|  ||:  
Target 5' ----TATCGTGGGAGAGCCTGgg 3'
1 - 19 71.00 -9.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-142-3p :: ETNK2    [ Functional MTI ]
Validation Method Microarray
Article - Grimson, A. Farh, K. K. Johnston, W. K. et al.
- Mol Cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
379 hsa-miR-142-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000315 ADCY9 adenylate cyclase 9 1 1
MIRT006370 RAC1 ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) 4 3
MIRT006654 ARNTL aryl hydrocarbon receptor nuclear translocator-like 5 5
MIRT006790 IL6 interleukin 6 (interferon, beta 2) 2 1
MIRT021541 TNIP3 TNFAIP3 interacting protein 3 1 1
MIRT021542 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT021543 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 2 2
MIRT021544 HOXA13 homeobox A13 1 1
MIRT021545 NAP1L2 nucleosome assembly protein 1-like 2 1 1
MIRT021546 CLOCK clock homolog (mouse) 1 1
MIRT021547 ARHGAP12 Rho GTPase activating protein 12 1 1
MIRT021548 IRF2BP1 interferon regulatory factor 2 binding protein 1 1 1
MIRT021549 KCND3 potassium voltage-gated channel, Shal-related subfamily, member 3 1 1
MIRT021550 MESP2 mesoderm posterior 2 homolog (mouse) 1 1
MIRT021551 CRH corticotropin releasing hormone 1 1
MIRT021552 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 1 1
MIRT021553 SLC37A3 solute carrier family 37 (glycerol-3-phosphate transporter), member 3 2 2
MIRT021554 PPP2R2C protein phosphatase 2, regulatory subunit B, gamma 1 1
MIRT021555 ARL14EP ADP-ribosylation factor-like 14 effector protein 1 1
MIRT021556 CDCA4 cell division cycle associated 4 1 1
MIRT021557 SH2D1A SH2 domain containing 1A 1 1
MIRT021558 MROH7 HEAT repeat containing 8 1 1
MIRT021559 ETNK2 ethanolamine kinase 2 1 1
MIRT021560 PCDHB14 protocadherin beta 14 1 1
MIRT021561 C2 complement component 2 1 1
MIRT021562 FAM209A family with sequence similarity 209, member A 1 1
MIRT021563 PCDHGA2 protocadherin gamma subfamily A, 2 1 1
MIRT021564 KRTAP4-5 keratin associated protein 4-5 1 1
MIRT021565 C4BPB complement component 4 binding protein, beta 1 1
MIRT021566 ZNF608 zinc finger protein 608 1 1
MIRT021567 GPC4 glypican 4 1 1
MIRT021568 GPD1L glycerol-3-phosphate dehydrogenase 1-like 1 1
MIRT021569 EVI2B ecotropic viral integration site 2B 1 1
MIRT021570 ZNF236 zinc finger protein 236 1 1
MIRT021571 NEFH neurofilament, heavy polypeptide 1 1
MIRT021572 HSFY2 heat shock transcription factor, Y linked 2 1 1
MIRT021573 ZNF701 zinc finger protein 701 1 1
MIRT021574 UGT2B17 UDP glucuronosyltransferase 2 family, polypeptide B17 1 1
MIRT021575 INSIG2 insulin induced gene 2 1 1
MIRT021576 TAS2R7 taste receptor, type 2, member 7 1 1
MIRT021577 RGS5 regulator of G-protein signaling 5 1 1
MIRT021578 TPSG1 tryptase gamma 1 1 1
MIRT021579 ARL6IP6 ADP-ribosylation-like factor 6 interacting protein 6 1 1
MIRT021580 PCDHGA10 protocadherin gamma subfamily A, 10 1 1
MIRT021581 SIGLEC10 sialic acid binding Ig-like lectin 10 1 1
MIRT021582 MRGPRX1 MAS-related GPR, member X1 1 1
MIRT021583 AGBL2 ATP/GTP binding protein-like 2 1 1
MIRT021584 PSMD12 proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 1 1
MIRT021585 BMP8A bone morphogenetic protein 8a 1 1
MIRT021586 C11orf16 chromosome 11 open reading frame 16 1 1
MIRT021587 INCENP inner centromere protein antigens 135/155kDa 1 1
MIRT021588 ALAD aminolevulinate dehydratase 1 1
MIRT021589 TRIM36 tripartite motif containing 36 1 1
MIRT021590 AGTR2 angiotensin II receptor, type 2 1 1
MIRT021591 TUBAL3 tubulin, alpha-like 3 1 1
MIRT021592 RNF170 ring finger protein 170 1 1
MIRT021593 NCKAP1 NCK-associated protein 1 1 1
MIRT021594 FAM65A family with sequence similarity 65, member A 1 1
MIRT021595 C7orf31 chromosome 7 open reading frame 31 1 1
MIRT021596 CLUAP1 clusterin associated protein 1 1 1
MIRT021597 ENAH enabled homolog (Drosophila) 1 1
MIRT021598 TMEM136 transmembrane protein 136 1 1
MIRT021599 CLEC4D C-type lectin domain family 4, member D 1 1
MIRT021600 KCTD12 potassium channel tetramerisation domain containing 12 1 1
MIRT021601 ABCC9 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 1 1
MIRT021602 CDC6 cell division cycle 6 homolog (S. cerevisiae) 1 1
MIRT021603 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT021604 DOCK10 dedicator of cytokinesis 10 1 1
MIRT021605 DCTN4 dynactin 4 (p62) 1 1
MIRT021606 SECISBP2 SECIS binding protein 2 2 2
MIRT021607 KIAA1191 KIAA1191 2 3
MIRT021608 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT021609 SYT4 synaptotagmin IV 1 1
MIRT021610 ARF4 ADP-ribosylation factor 4 1 1
MIRT021611 FAM98A family with sequence similarity 98, member A 1 1
MIRT021612 RRM2B ribonucleotide reductase M2 B (TP53 inducible) 1 1
MIRT021613 UBE2W ubiquitin-conjugating enzyme E2W (putative) 1 1
MIRT021614 ARL10 ADP-ribosylation factor-like 10 1 1
MIRT021615 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT021616 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT021617 MORF4L1 mortality factor 4 like 1 2 5
MIRT021618 TSPAN6 tetraspanin 6 1 1
MIRT021619 GOLGA5 golgin A5 1 1
MIRT021620 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 1 1
MIRT021621 ARL15 ADP-ribosylation factor-like 15 2 2
MIRT021622 FAM177A1 family with sequence similarity 177, member A1 1 1
MIRT021623 CA5B carbonic anhydrase VB, mitochondrial 1 1
MIRT021624 NSFL1C NSFL1 (p97) cofactor (p47) 1 1
MIRT021625 MAN1A2 mannosidase, alpha, class 1A, member 2 1 1
MIRT021626 SKP2 S-phase kinase-associated protein 2, E3 ubiquitin protein ligase 1 1
MIRT021627 FBXO3 F-box protein 3 1 1
MIRT021628 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT021629 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT021630 CNIH4 cornichon homolog 4 (Drosophila) 1 1
MIRT021631 CCNJ cyclin J 1 1
MIRT021632 RPE ribulose-5-phosphate-3-epimerase 1 1
MIRT021633 CLIC4 chloride intracellular channel 4 2 2
MIRT021634 TGFBR1 transforming growth factor, beta receptor 1 5 3
MIRT021635 ZCCHC14 zinc finger, CCHC domain containing 14 2 2
MIRT021636 C5orf24 chromosome 5 open reading frame 24 1 1
MIRT021637 MORF4L2 mortality factor 4 like 2 2 2
MIRT021638 SLC35F5 solute carrier family 35, member F5 2 3
MIRT021639 TAOK1 TAO kinase 1 1 1
MIRT021640 GNAQ guanine nucleotide binding protein (G protein), q polypeptide 1 1
MIRT021641 ITGAV integrin, alpha V 2 2
MIRT021642 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 2 2
MIRT021643 BOD1 biorientation of chromosomes in cell division 1 2 2
MIRT021644 C9orf72 chromosome 9 open reading frame 72 2 2
MIRT021645 PROM1 prominin 1 2 2
MIRT052902 ROCK2 Rho-associated, coiled-coil containing protein kinase 2 4 2
MIRT052995 CCNT2 cyclin T2 3 4
MIRT052996 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 3 2
MIRT053117 Wasl Wiskott-Aldrich syndrome-like (human) 2 1
MIRT053121 HMGA1 high mobility group AT-hook 1 4 2
MIRT053242 PTPN23 protein tyrosine phosphatase, non-receptor type 23 3 1
MIRT053247 EGR2 early growth response 2 3 1
MIRT054374 IL1A interleukin 1, alpha 2 1
MIRT066518 HMGA2 high mobility group AT-hook 2 1 3
MIRT084981 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT100421 HSPA1B heat shock 70kDa protein 1B 3 5
MIRT107700 CLTA clathrin, light chain A 1 1
MIRT127013 FAM208B family with sequence similarity 208, member B 1 3
MIRT127801 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT128307 RAB39A RAB39A, member RAS oncogene family 1 1
MIRT128862 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 2
MIRT136323 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT136938 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT141398 WHAMM WAS protein homolog associated with actin, golgi membranes and microtubules 1 1
MIRT142774 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 1
MIRT148083 CEP192 centrosomal protein 192kDa 1 1
MIRT149046 TWSG1 twisted gastrulation homolog 1 (Drosophila) 1 1
MIRT151995 ATF5 activating transcription factor 5 1 1
MIRT152171 ZNF460 zinc finger protein 460 1 1
MIRT152457 DTD1 D-tyrosyl-tRNA deacylase 1 1 1
MIRT153187 MANBAL mannosidase, beta A, lysosomal-like 1 1
MIRT154882 GNAS GNAS complex locus 1 3
MIRT157856 ATG16L1 autophagy related 16-like 1 (S. cerevisiae) 1 1
MIRT159778 PNO1 partner of NOB1 homolog (S. cerevisiae) 1 1
MIRT160145 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT160565 TFG TRK-fused gene 1 1
MIRT161242 U2SURP U2 snRNP-associated SURP domain containing 1 1
MIRT162814 DAG1 dystroglycan 1 (dystrophin-associated glycoprotein 1) 1 1
MIRT165080 APC adenomatous polyposis coli 2 2
MIRT165495 RBM27 RNA binding motif protein 27 1 1
MIRT166752 PAPD7 PAP associated domain containing 7 1 1
MIRT167069 SCAMP1 secretory carrier membrane protein 1 1 2
MIRT167643 MARCKS myristoylated alanine-rich protein kinase C substrate 1 1
MIRT170275 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
MIRT172913 RAB2A RAB2A, member RAS oncogene family 3 2
MIRT173258 DPY19L4 dpy-19-like 4 (C. elegans) 1 1
MIRT173362 TNKS tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 1 1
MIRT176511 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT177101 INPP5A inositol polyphosphate-5-phosphatase, 40kDa 1 1
MIRT177133 STAM signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 1 1
MIRT179440 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT184833 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 1 1
MIRT187980 MBD6 methyl-CpG binding domain protein 6 1 1
MIRT197415 KAT7 K(lysine) acetyltransferase 7 1 1
MIRT198832 C18ORF25 chromosome 18 open reading frame 25 2 1
MIRT203665 DIP2A DIP2 disco-interacting protein 2 homolog A (Drosophila) 1 1
MIRT206479 EML4 echinoderm microtubule associated protein like 4 1 1
MIRT208842 TIPARP TCDD-inducible poly(ADP-ribose) polymerase 2 1
MIRT209673 KAT2B K(lysine) acetyltransferase 2B 2 1
MIRT213721 AFF1 AF4/FMR2 family, member 1 1 5
MIRT227686 TBC1D13 TBC1 domain family, member 13 1 1
MIRT235432 TSEN34 tRNA splicing endonuclease 34 homolog (S. cerevisiae) 1 1
MIRT237292 LPP LIM domain containing preferred translocation partner in lipoma 1 1
MIRT239936 CLDN12 claudin 12 1 1
MIRT336736 ZNF678 zinc finger protein 678 1 1
MIRT366070 FAM127A family with sequence similarity 127, member A 1 2
MIRT375956 HGS hepatocyte growth factor-regulated tyrosine kinase substrate 1 1
MIRT389726 COPG1 coatomer protein complex, subunit gamma 1 1 1
MIRT404627 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT437600 MGLL monoglyceride lipase 3 2
MIRT437601 USP6NL USP6 N-terminal like 3 2
MIRT437602 CCDC6 coiled-coil domain containing 6 2 1
MIRT437603 HECTD1 HECT domain containing E3 ubiquitin protein ligase 1 3 3
MIRT437604 WASL Wiskott-Aldrich syndrome-like 3 2
MIRT437606 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 3 3
MIRT437607 C1orf9 SUN domain containing ossification factor 3 2
MIRT437871 ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 2 1
MIRT437872 LGR5 leucine-rich repeat containing G protein-coupled receptor 5 2 1
MIRT438329 HOXA10 homeobox A10 1 1
MIRT438330 HOXA7 homeobox A7 1 1
MIRT438331 HOXA9 homeobox A9 1 1
MIRT438904 LRRC32 leucine rich repeat containing 32 3 1
MIRT439187 ZNF676 zinc finger protein 676 1 1
MIRT439201 ZNF473 zinc finger protein 473 1 1
MIRT439218 ZNF217 zinc finger protein 217 1 1
MIRT439226 ZMYND8 zinc finger, MYND-type containing 8 1 1
MIRT439235 ZFX zinc finger protein, X-linked 1 1
MIRT439236 ZFPM1 zinc finger protein, multitype 1 1 1
MIRT439284 WIZ widely interspaced zinc finger motifs 1 1
MIRT439383 TSPYL1 TSPY-like 1 1 1
MIRT439406 TNRC18 trinucleotide repeat containing 18 1 1
MIRT439429 TMEM59 transmembrane protein 59 1 2
MIRT439496 SYPL1 synaptophysin-like 1 1 1
MIRT439514 STX2 syntaxin 2 1 1
MIRT439519 STRN3 striatin, calmodulin binding protein 3 1 1
MIRT439540 SS18 synovial sarcoma translocation, chromosome 18 1 1
MIRT439582 SMG1 smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT439593 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 1
MIRT439636 SIK2 salt-inducible kinase 2 1 1
MIRT439638 SIK1 salt-inducible kinase 1 1 1
MIRT439646 SGMS1 sphingomyelin synthase 1 1 1
MIRT439755 RNF38 ring finger protein 38 1 1
MIRT439769 RICTOR RPTOR independent companion of MTOR, complex 2 1 1
MIRT439855 PUM1 pumilio homolog 1 (Drosophila) 1 1
MIRT439883 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT439919 PPP1R2 protein phosphatase 1, regulatory (inhibitor) subunit 2 1 1
MIRT439925 PPFIA1 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 1 1
MIRT439973 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma 1 1
MIRT440010 PDSS2 prenyl (decaprenyl) diphosphate synthase, subunit 2 1 1
MIRT440076 NUDT8 nudix (nucleoside diphosphate linked moiety X)-type motif 8 1 1
MIRT440094 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 1
MIRT440096 NR2C1 nuclear receptor subfamily 2, group C, member 1 1 1
MIRT440172 MTUS1 microtubule associated tumor suppressor 1 1 1
MIRT440201 MTMR9 myotubularin related protein 9 1 1
MIRT440218 MRFAP1 Morf4 family associated protein 1 1 1
MIRT440226 MMD monocyte to macrophage differentiation-associated 1 1
MIRT440256 MEF2D myocyte enhancer factor 2D 1 1
MIRT440367 KIF5B kinesin family member 5B 1 2
MIRT440429 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT440452 INPP5F inositol polyphosphate-5-phosphatase F 1 1
MIRT440484 HSD17B4 hydroxysteroid (17-beta) dehydrogenase 4 1 1
MIRT440503 HIST1H4D histone cluster 1, H4d 1 1
MIRT440544 GOLGA1 golgin A1 1 1
MIRT440549 GNB2 guanine nucleotide binding protein (G protein), beta polypeptide 2 1 1
MIRT440565 GLCE glucuronic acid epimerase 1 1
MIRT440577 GFI1 growth factor independent 1 transcription repressor 1 1
MIRT440602 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT440717 EPM2AIP1 EPM2A (laforin) interacting protein 1 1 1
MIRT440747 EEF2K eukaryotic elongation factor-2 kinase 1 1
MIRT440827 DEPDC1 DEP domain containing 1 1 1
MIRT440855 CUL5 cullin 5 1 1
MIRT440881 CREB3L2 cAMP responsive element binding protein 3-like 2 1 1
MIRT441026 CALM1 calmodulin 1 (phosphorylase kinase, delta) 1 1
MIRT441074 FAM222B family with sequence similarity 222, member B 1 1
MIRT441096 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT441110 BCLAF1 BCL2-associated transcription factor 1 1 1
MIRT441125 SLC7A9 solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9 1 1
MIRT441152 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
MIRT441240 AKT1S1 AKT1 substrate 1 (proline-rich) 1 1
MIRT441251 AFF4 AF4/FMR2 family, member 4 1 1
MIRT441285 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT441290 ACSL1 acyl-CoA synthetase long-chain family member 1 1 1
MIRT441299 ACACA acetyl-CoA carboxylase alpha 1 1
MIRT441592 PSTK phosphoseryl-tRNA kinase 1 1
MIRT442461 SLC25A13 solute carrier family 25 (aspartate/glutamate carrier), member 13 1 1
MIRT442622 LOX lysyl oxidase 1 1
MIRT443098 RNF20 ring finger protein 20, E3 ubiquitin protein ligase 1 1
MIRT444058 SERPINA4 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4 1 1
MIRT444636 HSBP1 heat shock factor binding protein 1 1 1
MIRT446866 NBPF3 neuroblastoma breakpoint family, member 3 1 1
MIRT447573 CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) 1 1
MIRT450392 CHRNA6 cholinergic receptor, nicotinic, alpha 6 (neuronal) 1 1
MIRT450753 POLI polymerase (DNA directed) iota 1 1
MIRT451108 RPS19 ribosomal protein S19 1 1
MIRT454085 TMEM209 transmembrane protein 209 1 1
MIRT456654 TIFA TRAF-interacting protein with forkhead-associated domain 1 1
MIRT457488 SLC35F6 chromosome 2 open reading frame 18 1 1
MIRT458148 LYRM4 LYR motif containing 4 1 3
MIRT463775 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT463973 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 2
MIRT464486 UCK2 uridine-cytidine kinase 2 1 1
MIRT466842 STX6 syntaxin 6 1 1
MIRT467074 SRRD SRR1 domain containing 1 2
MIRT467246 SPPL2A signal peptide peptidase like 2A 1 1
MIRT470461 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT474689 KIF5A kinesin family member 5A 1 1
MIRT477480 ELL2 elongation factor, RNA polymerase II, 2 1 1
MIRT477821 DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1 1
MIRT478677 CSRP2 cysteine and glycine-rich protein 2 1 2
MIRT484256 FZD7 frizzled family receptor 7 1 2
MIRT486705 TROVE2 TROVE domain family, member 2 1 2
MIRT488422 COPA coatomer protein complex, subunit alpha 1 1
MIRT488446 ACBD3 acyl-CoA binding domain containing 3 1 1
MIRT488721 ADPRHL1 ADP-ribosylhydrolase like 1 1 1
MIRT488793 MALT1 mucosa associated lymphoid tissue lymphoma translocation gene 1 1 1
MIRT489318 PEX26 peroxisomal biogenesis factor 26 1 1
MIRT490876 OSBP oxysterol binding protein 1 1
MIRT491780 ZNF24 zinc finger protein 24 1 1
MIRT491909 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT491913 XIAP X-linked inhibitor of apoptosis 1 1
MIRT491962 VPS52 vacuolar protein sorting 52 homolog (S. cerevisiae) 1 1
MIRT491971 USP37 ubiquitin specific peptidase 37 1 1
MIRT492062 TMEM245 transmembrane protein 245 1 1
MIRT492073 TMED7 transmembrane emp24 protein transport domain containing 7 1 1
MIRT492243 SLC39A9 solute carrier family 39 (zinc transporter), member 9 1 1
MIRT492431 RGL2 ral guanine nucleotide dissociation stimulator-like 2 1 1
MIRT492586 PPIL4 peptidylprolyl isomerase (cyclophilin)-like 4 1 1
MIRT492979 NCK2 NCK adaptor protein 2 1 1
MIRT493064 MTFR1 mitochondrial fission regulator 1 1 1
MIRT493074 MTCH1 mitochondrial carrier 1 1 1
MIRT493092 MMGT1 membrane magnesium transporter 1 1 6
MIRT493502 IPMK inositol polyphosphate multikinase 1 1
MIRT493516 IL6ST interleukin 6 signal transducer (gp130, oncostatin M receptor) 1 2
MIRT493747 GOLT1B golgi transport 1B 1 1
MIRT493835 FRS2 fibroblast growth factor receptor substrate 2 1 3
MIRT493926 FAM127B family with sequence similarity 127, member B 1 2
MIRT494004 ECT2 epithelial cell transforming sequence 2 oncogene 1 1
MIRT494152 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT494317 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 1
MIRT494451 BTG2 BTG family, member 2 1 1
MIRT494556 BAK1 BCL2-antagonist/killer 1 1 1
MIRT494581 ATG9A autophagy related 9A 1 1
MIRT494674 ARL5B ADP-ribosylation factor-like 5B 1 1
MIRT497475 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT498198 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 1 1
MIRT500051 S100A11 S100 calcium binding protein A11 1 1
MIRT502512 ESR1 estrogen receptor 1 1 1
MIRT504634 MFSD8 major facilitator superfamily domain containing 8 1 3
MIRT506219 PHF12 PHD finger protein 12 1 1
MIRT506496 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 1
MIRT507535 DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 1 3
MIRT508200 SLC35E1 solute carrier family 35, member E1 1 1
MIRT511293 KLHL15 kelch-like 15 (Drosophila) 1 2
MIRT511401 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 3
MIRT512223 ATXN3 ataxin 3 1 3
MIRT512483 VAPB VAMP (vesicle-associated membrane protein)-associated protein B and C 1 1
MIRT520013 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 1 2
MIRT520690 TMED4 transmembrane emp24 protein transport domain containing 4 1 1
MIRT521445 RAD51 RAD51 homolog (S. cerevisiae) 1 1
MIRT522423 MON1B MON1 homolog B (yeast) 1 2
MIRT523917 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT524299 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 2
MIRT525932 C11orf74 chromosome 11 open reading frame 74 1 1
MIRT527433 DDX17 DEAD (Asp-Glu-Ala-Asp) box helicase 17 1 1
MIRT528632 PRPF38B PRP38 pre-mRNA processing factor 38 (yeast) domain containing B 1 2
MIRT531445 HSD17B12 hydroxysteroid (17-beta) dehydrogenase 12 1 1
MIRT534820 RAB30 RAB30, member RAS oncogene family 1 1
MIRT538217 CYR61 cysteine-rich, angiogenic inducer, 61 1 1
MIRT541032 STRBP spermatid perinuclear RNA binding protein 1 4
MIRT543171 FICD FIC domain containing 1 1
MIRT545473 TRIM37 tripartite motif containing 37 1 1
MIRT546477 SLC17A5 solute carrier family 17 (anion/sugar transporter), member 5 1 1
MIRT548769 CNN3 calponin 3, acidic 1 1
MIRT549117 C16orf70 chromosome 16 open reading frame 70 1 2
MIRT549484 ACBD5 acyl-CoA binding domain containing 5 1 1
MIRT549595 TMEM101 transmembrane protein 101 1 1
MIRT550391 TBX4 T-box 4 1 1
MIRT552283 CBY1 chibby homolog 1 (Drosophila) 1 2
MIRT552562 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 2
MIRT553470 TNPO1 transportin 1 1 2
MIRT554063 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT555123 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT555352 PPP1R14C protein phosphatase 1, regulatory (inhibitor) subunit 14C 1 1
MIRT556638 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT557393 H3F3C H3 histone, family 3C 1 1
MIRT559625 AKIRIN2 akirin 2 1 1
MIRT561978 LRRC59 leucine rich repeat containing 59 1 1
MIRT562533 CCNG1 cyclin G1 1 1
MIRT565171 LINC00598 long intergenic non-protein coding RNA 598 1 1
MIRT565497 AZF1 azoospermia factor 1 1 1
MIRT565821 SDCCAG3 serologically defined colon cancer antigen 3 1 1
MIRT566569 OTUD4 OTU domain containing 4 1 1
MIRT567079 KBTBD2 kelch repeat and BTB (POZ) domain containing 2 1 1
MIRT567335 HMGB1 high mobility group box 1 1 1
MIRT567865 DCAF12 DDB1 and CUL4 associated factor 12 1 1
MIRT568564 AK4 adenylate kinase 4 1 1
MIRT572513 KIAA0232 KIAA0232 1 1
MIRT574187 ZNF264 zinc finger protein 264 1 1
MIRT632624 PARP2 poly (ADP-ribose) polymerase 2 1 1
MIRT638234 SNTN sentan, cilia apical structure protein 1 1
MIRT653177 SPPL3 signal peptide peptidase like 3 1 1
MIRT667875 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT668141 GINS2 GINS complex subunit 2 (Psf2 homolog) 1 1
MIRT672604 IRF1 interferon regulatory factor 1 1 1
MIRT683830 ZNF682 zinc finger protein 682 1 1
MIRT684470 INTS7 integrator complex subunit 7 1 1
MIRT688694 CPS1 carbamoyl-phosphate synthase 1, mitochondrial 1 1
MIRT694276 ZNF529 zinc finger protein 529 1 2
MIRT699374 SLC30A6 solute carrier family 30 (zinc transporter), member 6 1 1
MIRT699726 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 1 1
MIRT701874 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT704262 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 1 1
MIRT710284 CSNK1G3 casein kinase 1, gamma 3 1 1
MIRT715118 PANK3 pantothenate kinase 3 1 1
MIRT716825 PSME4 proteasome (prosome, macropain) activator subunit 4 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*