Accession ID: MIRT021559 [miRNA, hsa-miR-142-3p :: ETNK2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-142LinkOut: [miRBase ]
Description Homo sapiens miR-142 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-142-3p
Mature Sequence 52| UGUAGUGUUUCCUACUUUAUGGA |74
Evidence Experimental
Experiments Cloned
Putative hsa-miR-142-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ETNK2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms EKI2, FLJ10761, HMFT1716
Description ethanolamine kinase 2
Transcript NM_0182    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ETNK2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ETNK2
(miRNA target sites are highlighted)
>ETNK2|NM_0182|3'UTR
   1 TATCGTGGGAGAGCCTGGGCAGGATCCCATCAGAAAGGTGCTGACTAAACTGGTTGCCCGGACACTCAACAGCCTCCACC
  81 TCCCTTTCTACCCTCACAGCTCCTGGGGCCTTCCTGGCTCTGGCCCAGAAAGTGATTCATTTGTAAATTATCATGGTTTT
 161 CTTTCTGCATTAAAATGCTCATTTCCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agguAUUUCAUC--C---UUUGUGAugu 5'
              |||| |:|  |   ::|||||   
Target 5' tgacTAAACTGGTTGCCCGGACACTcaa 3'
42 - 69 113.00 -9.80
2
miRNA  3' agGUAUUUCAUCCUUUGUGAugu 5'
            || |||||  ||  ||:|   
Target 5' ccCAGAAAGT--GATTCATTtgt 3'
124 - 144 81.00 -8.42
3
miRNA  3' agguAUUUCAUCCUUUGUGAUgu 5'
              ||  ||:|||:|  ||:  
Target 5' ----TATCGTGGGAGAGCCTGgg 3'
1 - 19 71.00 -9.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-142-3p :: ETNK2    [ Functional MTI ]
Validation Method Microarray
Article - Grimson, A. Farh, K. K. Johnston, W. K. et al.
- Mol Cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
109 hsa-miR-142-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000315 ADCY9 adenylate cyclase 9 1 1
MIRT006370 RAC1 ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) 1 1
MIRT006654 ARNTL aryl hydrocarbon receptor nuclear translocator-like 3 3
MIRT006790 IL6 interleukin 6 (interferon, beta 2) 2 1
MIRT021541 TNIP3 TNFAIP3 interacting protein 3 1 1
MIRT021542 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT021543 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT021544 HOXA13 homeobox A13 1 1
MIRT021545 NAP1L2 nucleosome assembly protein 1-like 2 1 1
MIRT021546 CLOCK clock homolog (mouse) 1 1
MIRT021547 ARHGAP12 Rho GTPase activating protein 12 1 1
MIRT021548 IRF2BP1 interferon regulatory factor 2 binding protein 1 1 1
MIRT021549 KCND3 potassium voltage-gated channel, Shal-related subfamily, member 3 1 1
MIRT021550 MESP2 mesoderm posterior 2 homolog (mouse) 1 1
MIRT021551 CRH corticotropin releasing hormone 1 1
MIRT021552 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 1 1
MIRT021553 SLC37A3 solute carrier family 37 (glycerol-3-phosphate transporter), member 3 1 1
MIRT021554 PPP2R2C protein phosphatase 2, regulatory subunit B, gamma 1 1
MIRT021555 ARL14EP chromosome 11 open reading frame 46 1 1
MIRT021556 CDCA4 cell division cycle associated 4 1 1
MIRT021557 SH2D1A SH2 domain containing 1A 1 1
MIRT021558 MROH7 chromosome 1 open reading frame 175 1 1
MIRT021559 ETNK2 ethanolamine kinase 2 1 1
MIRT021560 PCDHB14 protocadherin beta 14 1 1
MIRT021561 C2 complement component 2 1 1
MIRT021562 FAM209A chromosome 20 open reading frame 106 1 1
MIRT021563 PCDHGA2 protocadherin gamma subfamily A, 2 1 1
MIRT021564 KRTAP4-5 keratin associated protein 4-5 1 1
MIRT021565 C4BPB complement component 4 binding protein, beta 1 1
MIRT021566 ZNF608 zinc finger protein 608 1 1
MIRT021567 GPC4 glypican 4 1 1
MIRT021568 GPD1L glycerol-3-phosphate dehydrogenase 1-like 1 1
MIRT021569 EVI2B ecotropic viral integration site 2B 1 1
MIRT021570 ZNF236 zinc finger protein 236 1 1
MIRT021571 NEFH neurofilament, heavy polypeptide 1 1
MIRT021572 HSFY2 heat shock transcription factor, Y linked 2 1 1
MIRT021573 ZNF701 zinc finger protein 701 1 1
MIRT021574 UGT2B17 UDP glucuronosyltransferase 2 family, polypeptide B17 1 1
MIRT021575 INSIG2 insulin induced gene 2 1 1
MIRT021576 TAS2R7 taste receptor, type 2, member 7 1 1
MIRT021577 RGS5 regulator of G-protein signaling 5 1 1
MIRT021578 TPSG1 tryptase gamma 1 1 1
MIRT021579 ARL6IP6 ADP-ribosylation-like factor 6 interacting protein 6 1 1
MIRT021580 PCDHGA10 protocadherin gamma subfamily A, 10 1 1
MIRT021581 SIGLEC10 sialic acid binding Ig-like lectin 10 1 1
MIRT021582 MRGPRX1 MAS-related GPR, member X1 1 1
MIRT021583 AGBL2 ATP/GTP binding protein-like 2 1 1
MIRT021584 PSMD12 proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 1 1
MIRT021585 BMP8A bone morphogenetic protein 8a 1 1
MIRT021586 C11orf16 chromosome 11 open reading frame 16 1 1
MIRT021587 INCENP inner centromere protein antigens 135/155kDa 1 1
MIRT021588 ALAD aminolevulinate dehydratase 1 1
MIRT021589 TRIM36 tripartite motif-containing 36 1 1
MIRT021590 AGTR2 angiotensin II receptor, type 2 1 1
MIRT021591 TUBAL3 tubulin, alpha-like 3 1 1
MIRT021592 RNF170 ring finger protein 170 1 1
MIRT021593 NCKAP1 NCK-associated protein 1 1 1
MIRT021594 FAM65A family with sequence similarity 65, member A 1 1
MIRT021595 C7orf31 chromosome 7 open reading frame 31 1 1
MIRT021596 CLUAP1 clusterin associated protein 1 1 1
MIRT021597 ENAH enabled homolog (Drosophila) 1 1
MIRT021598 TMEM136 transmembrane protein 136 1 1
MIRT021599 CLEC4D C-type lectin domain family 4, member D 1 1
MIRT021600 KCTD12 potassium channel tetramerisation domain containing 12 1 1
MIRT021601 ABCC9 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 1 1
MIRT021602 CDC6 cell division cycle 6 homolog (S. cerevisiae) 1 1
MIRT021603 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT021604 DOCK10 dedicator of cytokinesis 10 1 1
MIRT021605 DCTN4 dynactin 4 (p62) 1 1
MIRT021606 SECISBP2 SECIS binding protein 2 1 1
MIRT021607 KIAA1191 KIAA1191 1 1
MIRT021608 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT021609 SYT4 synaptotagmin IV 1 1
MIRT021610 ARF4 ADP-ribosylation factor 4 1 1
MIRT021611 FAM98A family with sequence similarity 98, member A 1 1
MIRT021612 RRM2B ribonucleotide reductase M2 B (TP53 inducible) 1 1
MIRT021613 UBE2W ubiquitin-conjugating enzyme E2W (putative) 1 1
MIRT021614 ARL10 ADP-ribosylation factor-like 10 1 1
MIRT021615 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT021616 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT021617 MORF4L1 mortality factor 4 like 1 1 1
MIRT021618 TSPAN6 tetraspanin 6 1 1
MIRT021619 GOLGA5 golgin A5 1 1
MIRT021620 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 1 1
MIRT021621 ARL15 ADP-ribosylation factor-like 15 1 1
MIRT021622 FAM177A1 family with sequence similarity 177, member A1 1 1
MIRT021623 CA5B carbonic anhydrase VB, mitochondrial 1 1
MIRT021624 NSFL1C NSFL1 (p97) cofactor (p47) 1 1
MIRT021625 MAN1A2 mannosidase, alpha, class 1A, member 2 1 1
MIRT021626 SKP2 S-phase kinase-associated protein 2 (p45) 1 1
MIRT021627 FBXO3 F-box protein 3 1 1
MIRT021628 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT021629 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT021630 CNIH4 cornichon homolog 4 (Drosophila) 1 1
MIRT021631 CCNJ cyclin J 1 1
MIRT021632 RPE ribulose-5-phosphate-3-epimerase 1 1
MIRT021633 CLIC4 chloride intracellular channel 4 1 1
MIRT021634 TGFBR1 transforming growth factor, beta receptor 1 1 1
MIRT021635 ZCCHC14 zinc finger, CCHC domain containing 14 1 1
MIRT021636 C5orf24 chromosome 5 open reading frame 24 1 1
MIRT021637 MORF4L2 mortality factor 4 like 2 1 1
MIRT021638 SLC35F5 solute carrier family 35, member F5 1 1
MIRT021639 TAOK1 TAO kinase 1 1 1
MIRT021640 GNAQ guanine nucleotide binding protein (G protein), q polypeptide 1 1
MIRT021641 ITGAV integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) 1 1
MIRT021642 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT021643 BOD1 biorientation of chromosomes in cell division 1 1 1
MIRT021644 C9orf72 chromosome 9 open reading frame 72 1 1
MIRT021645 PROM1 prominin 1 1 1