Accession ID: MIRT021778 [miRNA, hsa-miR-132-3p :: KRT6C, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-132LinkOut: [miRBase ]
Description Homo sapiens miR-132 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-132-3p
Mature Sequence 59| UAACAGUCUACAGCCAUGGUCG |80
Evidence Experimental
Experiments Cloned
Putative hsa-miR-132-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KRT6C LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms K6E, KRT6E, MGC102925, MGC163455, MGC163457
Description keratin 6C
Transcript NM_1730    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KRT6C LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of KRT6C
(miRNA target sites are highlighted)
>KRT6C|NM_1730|3'UTR
   1 AATGGCGAAGGCGTTGGACAAGTCAACGTCTCTGTAGTACAGTCCACCATCTCCAGTGGCTATGGCGGTGCCAGCGGTGT
  81 CGGCAGTGGCTTAGGCCTGGGTGGAGGAAGCAGCTACTCCTATGGCAGTGGTCTTGGCATTGGAGGTGGCTTCAGTTCCA
 161 GCAGTGGCAGAGCCATTGGGGGTGGCCTCAGCTCTGTTGGAGGCGGCAGTTCCACCATCAAGTACACCACCACCTCCTCC
 241 TCCAGCAGGAAGAGCTACAAGCACTAAAGTGCTGCCTCCAGCTCTCGGTCCCACAGTCCTCAGGCCCTTCTCTGGCTGCA
 321 GAGCCGTCTCCTCAGGTTGCCTATCCTCTCCTGGCCTCTAGTCTTCCCTGCTCTCCGAGGTAGAGCTGGGTATGGATGCT
 401 TAGTGCCCTCACTTCTCTCTGTCTATACCTGCCCCATCTGAGCACCCATTGCTCACCATCAGATCAACCTTTGATTTTAC
 481 ATCATAATGTATTCACCAATGGAGCTTCACTTTGTTACTAAATTATTAATTTCTTGCCTCCAAAATTGTTCTCTCTGAGG
 561 CTGAGCATTATAAGAAAATGATCTCTGTTCCTTTTCATTACTGAAAATCGCCTGGGGCTTATTTCAGAACAACTTCCACT
 641 TATTTTCCATTGGCCCCCAAACTCCCTAAGTTAAAAGTATTGTGAACCCCCGCCCCGCAGTATGCATGGAAGCACAAGTG
 721 ACTAGTCGTATGATGTACACAGTCTTTCTCCCTGTGATGATTTCTCTGCTCTTTGCTCTTTGTAATTTCTAAATAAAGCA
 801 GGTTTTAGAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gcugguaccgacaucuGACAAu 5'
                          ||||| 
Target 5' gggggtggcctcagctCTGTTg 3'
178 - 199 100.00 -11.90
2
miRNA  3' gcugguaccgacaucuGACAAu 5'
                          ||||| 
Target 5' tataagaaaatgatctCTGTTc 3'
569 - 590 100.00 -5.97
3
miRNA  3' gcuGGU-ACCGACAUCUGACAau 5'
             ||| ||||| | |:| ||  
Target 5' tctCCAGTGGCTAT-GGCGGTgc 3'
50 - 71 98.00 -14.49
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-132-3p :: KRT6C    [ Functional MTI ]
Validation Method Microarray
Article - Grimson, A. Farh, K. K. Johnston, W. K. et al.
- Mol Cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
173 hsa-miR-132-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000333 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 3 1
MIRT000334 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 1
MIRT000601 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 4 1
MIRT002329 RFX4 regulatory factor X, 4 (influences HLA class II expression) 1 1
MIRT003926 ARHGAP32 Rho GTPase activating protein 32 4 3
MIRT006503 RB1 retinoblastoma 1 3 1
MIRT006628 Mecp2 methyl CpG binding protein 2 4 1
MIRT006659 HBEGF heparin-binding EGF-like growth factor 4 3
MIRT007010 RASA1 RAS p21 protein activator (GTPase activating protein) 1 1 1
MIRT007166 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 2 2
MIRT007167 TJAP1 tight junction associated protein 1 (peripheral) 1 1
MIRT007253 TLN2 talin 2 1 2
MIRT021716 ARL6IP6 ADP-ribosylation-like factor 6 interacting protein 6 1 1
MIRT021717 COX8C cytochrome c oxidase subunit 8C 1 1
MIRT021718 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase, type I, alpha 1 1
MIRT021719 CDH3 cadherin 3, type 1, P-cadherin (placental) 1 1
MIRT021720 LOXL1 lysyl oxidase-like 1 1 1
MIRT021721 TNFRSF17 tumor necrosis factor receptor superfamily, member 17 1 1
MIRT021722 ADH1A alcohol dehydrogenase 1A (class I), alpha polypeptide 1 1
MIRT021723 KCTD4 potassium channel tetramerisation domain containing 4 1 1
MIRT021724 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT021725 WNT3A wingless-type MMTV integration site family, member 3A 1 1
MIRT021726 KCNJ9 potassium inwardly-rectifying channel, subfamily J, member 9 1 1
MIRT021727 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT021728 KIR3DL1 killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 1 1
MIRT021729 ARF6 ADP-ribosylation factor 6 1 1
MIRT021730 PLSCR1 phospholipid scramblase 1 1 1
MIRT021731 CSTF2T cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant 1 1
MIRT021732 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT021733 NR1D2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT021734 EPHA4 EPH receptor A4 1 1
MIRT021736 MUC17 mucin 17, cell surface associated 1 1
MIRT021737 CA1 carbonic anhydrase I 1 1
MIRT021738 S100A1 S100 calcium binding protein A1 1 1
MIRT021739 FKBP10 FK506 binding protein 10, 65 kDa 1 1
MIRT021740 PLA2G4C phospholipase A2, group IVC (cytosolic, calcium-independent) 1 1
MIRT021741 GSTCD glutathione S-transferase, C-terminal domain containing 1 1
MIRT021742 LIG4 ligase IV, DNA, ATP-dependent 1 1
MIRT021743 POLK polymerase (DNA directed) kappa 1 1
MIRT021744 STMN1 stathmin 1 1 1
MIRT021745 DMGDH dimethylglycine dehydrogenase 1 1
MIRT021746 MLLT10 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 1 1
MIRT021747 TRIM36 tripartite motif-containing 36 1 1
MIRT021748 EOGT chromosome 3 open reading frame 64 1 1
MIRT021749 ANKRD28 ankyrin repeat domain 28 1 1
MIRT021750 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 1 1
MIRT021751 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT021752 SSR3 signal sequence receptor, gamma (translocon-associated protein gamma) 1 1
MIRT021753 KBTBD3 kelch repeat and BTB (POZ) domain containing 3 1 1
MIRT021754 SYT14 synaptotagmin XIV 1 1
MIRT021755 MAP1B microtubule-associated protein 1B 1 1
MIRT021756 YKT6 YKT6 v-SNARE homolog (S. cerevisiae) 1 1
MIRT021757 CD55 CD55 molecule, decay accelerating factor for complement (Cromer blood group) 1 1
MIRT021758 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 1 1
MIRT021759 UBE2W ubiquitin-conjugating enzyme E2W (putative) 1 1
MIRT021760 GBAS glioblastoma amplified sequence 1 1
MIRT021761 TMEM47 transmembrane protein 47 1 1
MIRT021762 BNIP2 BCL2/adenovirus E1B 19kDa interacting protein 2 1 1
MIRT021763 ZNF652 zinc finger protein 652 1 1
MIRT021764 FAM199X family with sequence similarity 199, X-linked 1 1
MIRT021765 FAM81A family with sequence similarity 81, member A 1 1
MIRT021766 CHRNA5 cholinergic receptor, nicotinic, alpha 5 1 1
MIRT021767 FRY furry homolog (Drosophila) 1 1
MIRT021768 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1 1
MIRT021769 TUSC2 tumor suppressor candidate 2 1 1
MIRT021770 OSBPL8 oxysterol binding protein-like 8 1 1
MIRT021771 CTDSPL2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 1 1
MIRT021772 MEF2A myocyte enhancer factor 2A 1 1
MIRT021773 PSMD12 proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 1 1
MIRT021774 SPAST spastin 1 1
MIRT021775 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT021776 PRSS22 protease, serine, 22 1 1
MIRT021777 SH3BGRL SH3 domain binding glutamic acid-rich protein like 1 1
MIRT021778 KRT6C keratin 6C 1 1
MIRT021779 CST9L cystatin 9-like 1 1
MIRT021780 EBPL emopamil binding protein-like 1 1
MIRT021781 SYNE3 chromosome 14 open reading frame 49 1 1
MIRT021782 FAM221B chromosome 9 open reading frame 128 1 1
MIRT021783 GATA3 GATA binding protein 3 1 1
MIRT021784 EMILIN3 elastin microfibril interfacer 3 1 1
MIRT021785 ARL13B ADP-ribosylation factor-like 13B 1 1
MIRT021786 CYP26A1 cytochrome P450, family 26, subfamily A, polypeptide 1 1 1
MIRT021787 SAMSN1 SAM domain, SH3 domain and nuclear localization signals 1 1 1
MIRT021788 GNL3L guanine nucleotide binding protein-like 3 (nucleolar)-like 1 1
MIRT021789 ETNK2 ethanolamine kinase 2 1 1
MIRT021790 DEPDC7 DEP domain containing 7 1 1
MIRT021791 FGF22 fibroblast growth factor 22 1 1
MIRT021792 FUT1 fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) 1 1
MIRT021793 KRTAP4-11 keratin associated protein 4-11 1 1
MIRT021794 SEC61A1 Sec61 alpha 1 subunit (S. cerevisiae) 1 1
MIRT021795 CR2 complement component (3d/Epstein Barr virus) receptor 2 1 1
MIRT021796 MMP13 matrix metallopeptidase 13 (collagenase 3) 1 1
MIRT021797 SYNDIG1L transmembrane protein 90A 1 1
MIRT021798 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 1 1
MIRT021799 RNF128 ring finger protein 128 1 1
MIRT021800 SFXN2 sideroflexin 2 1 1
MIRT021801 PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 1 1
MIRT021802 FABP7 fatty acid binding protein 7, brain 1 1
MIRT021803 CNTNAP1 contactin associated protein 1 1 1
MIRT021804 FBN3 fibrillin 3 1 1
MIRT021805 KIR3DL2 killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2 1 1
MIRT021806 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 1 1
MIRT021807 B3GAT1 beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P) 1 1
MIRT021808 ARR3 arrestin 3, retinal (X-arrestin) 1 1
MIRT021809 GK glycerol kinase 1 1
MIRT021810 SMN1 survival of motor neuron 1, telomeric 1 1
MIRT021811 ALK anaplastic lymphoma receptor tyrosine kinase 1 1
MIRT021812 PRX periaxin 1 1
MIRT021813 CYP2E1 cytochrome P450, family 2, subfamily E, polypeptide 1 1 1
MIRT021814 ADAMTSL1 ADAMTS-like 1 1 1
MIRT021815 NCS1 neuronal calcium sensor 1 1 1
MIRT021816 CFTR cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) 1 1
MIRT021817 OAS2 2'-5'-oligoadenylate synthetase 2, 69/71kDa 1 1
MIRT021818 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT021819 FAT4 FAT tumor suppressor homolog 4 (Drosophila) 1 1
MIRT021820 GPR115 G protein-coupled receptor 115 1 1
MIRT021821 ZDHHC2 zinc finger, DHHC-type containing 2 1 1
MIRT021822 INTS8 integrator complex subunit 8 1 1
MIRT021823 IMPA1 inositol(myo)-1(or 4)-monophosphatase 1 1 1
MIRT021824 FAT3 FAT tumor suppressor homolog 3 (Drosophila) 1 1
MIRT021825 VPS13D vacuolar protein sorting 13 homolog D (S. cerevisiae) 1 1
MIRT021826 DOCK10 dedicator of cytokinesis 10 1 1
MIRT021827 LCA5 Leber congenital amaurosis 5 1 1
MIRT021828 ARL14EP chromosome 11 open reading frame 46 1 1
MIRT021829 MTMR10 myotubularin related protein 10 1 1
MIRT021830 TRIM23 tripartite motif-containing 23 1 1
MIRT021831 CHL1 cell adhesion molecule with homology to L1CAM (close homolog of L1) 1 1
MIRT021832 NDUFB10 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa 1 1
MIRT021833 NBN nibrin 1 1
MIRT021834 THBS1 thrombospondin 1 1 1
MIRT021835 GJE1 gap junction protein, epsilon 1, 23kDa 1 1
MIRT021836 SNX7 sorting nexin 7 1 1
MIRT021837 EYA4 eyes absent homolog 4 (Drosophila) 1 1
MIRT021838 CASP7 caspase 7, apoptosis-related cysteine peptidase 1 1
MIRT021839 ECT2 epithelial cell transforming sequence 2 oncogene 1 1
MIRT021840 EXOC5 exocyst complex component 5 1 1
MIRT021841 CD164 CD164 molecule, sialomucin 1 1
MIRT021842 STAU1 staufen, RNA binding protein, homolog 1 (Drosophila) 1 1
MIRT021843 ANKRD29 ankyrin repeat domain 29 1 1
MIRT021844 CCSER2 family with sequence similarity 190, member B 1 1
MIRT021845 RTN4 reticulon 4 1 1
MIRT021846 MDFIC MyoD family inhibitor domain containing 1 1
MIRT021847 ZNF236 zinc finger protein 236 1 1
MIRT021848 SDF2 stromal cell-derived factor 2 1 1
MIRT021849 SPRED1 sprouty-related, EVH1 domain containing 1 1 1
MIRT021850 CMTM3 CKLF-like MARVEL transmembrane domain containing 3 1 1
MIRT021851 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT021852 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 1
MIRT021853 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT021854 FBXO28 F-box protein 28 1 1
MIRT021855 LGR4 leucine-rich repeat-containing G protein-coupled receptor 4 1 1
MIRT021856 ZNF148 zinc finger protein 148 1 1
MIRT021857 TBC1D9 TBC1 domain family, member 9 (with GRAM domain) 1 1
MIRT021858 VDAC2 voltage-dependent anion channel 2 1 1
MIRT021859 CC2D1B coiled-coil and C2 domain containing 1B 1 1
MIRT021860 MUC13 mucin 13, cell surface associated 1 1
MIRT021861 TSPAN6 tetraspanin 6 1 1
MIRT021862 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 1 1
MIRT021863 CALU calumenin 1 1
MIRT021864 CAMSAP2 calmodulin regulated spectrin-associated protein 1-like 1 1 1
MIRT021865 CCNA2 cyclin A2 2 1
MIRT021866 CCNB1 cyclin B1 2 1
MIRT045838 PARP10 poly (ADP-ribose) polymerase family, member 10 1 1
MIRT045839 RPL7 ribosomal protein L7 1 1
MIRT045840 FOXO1 forkhead box O1 1 1
MIRT045841 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT045842 CSTF3 cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa 1 1
MIRT045843 RPSA ribosomal protein SA 1 1
MIRT045844 ANXA2 annexin A2 1 1
MIRT045845 NCKAP1 NCK-associated protein 1 1 1
MIRT045846 RPS5 ribosomal protein S5 1 1
MIRT045847 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT045848 PDLIM7 PDZ and LIM domain 7 (enigma) 1 1