Accession ID: MIRT023441 [miRNA, hsa-miR-30b-5p :: GNA13, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-30bLinkOut: [miRBase ]
Description Homo sapiens miR-30b stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-30b-5p
Mature Sequence 17| UGUAAACAUCCUACACUCAGCU |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-30b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol GNA13 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms G13
Description guanine nucleotide binding protein (G protein), alpha 13
Transcript NM_0065    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on GNA13 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of GNA13
(miRNA target sites are highlighted)
>GNA13|NM_0065|3'UTR
   1 TGTACAAAAGACTTGCTGTTTTAATATCTTTTTGTGTTTTTGATGTTTTCTGTTTGTTTTGTTTTTTAAAATAGCAGTTT
  81 ACAACCAGAATTAGAACAATCTTAATTCTACGTTTAACTTCTTGAAAATCTTAGTACTTTTTCTGCGGCCTTTGGTTTGT
 161 GGCTGAAAGCTGTTGAGTGACTCATCGCCAAGATTTGCTGTAATGCAGGCTTTGATCTGTTTCACCATGGCTTCTATTCA
 241 AGTCCAGTTAAAACCTCCCAGCTGACCTCAGACTAGGCATATTTCAGGCTTTAAATTATTCTACTTTCCAAACTGAATTC
 321 TCCTGCAGTGCCAAGTATCAAAGGTGTCCTTAAATACTTGTAGGGATGAGGTTAGGAATATTCAGTTCCAAAACAAGATA
 401 TCTTCTGTCCGCCTTACATATAGCAGTGACACTTGTTGCCTAACTTTATGGTGACCTCCTATTTTGTAAGGGCTGTTAGA
 481 AGTTCTATCTAAGAAATGGCATTCTGTAGGTTTATAGAAGGTTTAGCCTTCATATTTTAATTGCTTGTATACACAACAGC
 561 TGTTTTGCTTTTAGATTTCTGTGTTTCTGAAGGTAATGTTCTTCCTGTTTTCAAGTTTACATAAGGATCTTTGGTCTGAT
 641 GCTGATGAAGAGTTCACAGGTGGTATGGGAGAGCAAAAGGCAAGCTAATGCTGTTTACCGTGTTTTGGTCAAACGTAACG
 721 AGTGAAATAGAATTTGCCTTTCTCATATTTAATTATCATGTAGTTTAATGTACCATATGTGAAACATTCTGGCCATAGCA
 801 GCAACTAAAAACTGCAAGCAACTTGGTAACAGAACTTTCTAAATAAACTTAACCTGTTCCAGAATGTCATGTATTTGACT
 881 TTTAAGCCCTATCTCAGTTGGTCAGTAAAGACCAATCCTTACTGTAGGAAATCATTGTTGTATCATCACAAACATCTATC
 961 TTTTGCTGTCCTGTCCAGTCCCATCAACTCCACACTGTGCCATTTGTGGCATCGTTTTGTTTATTTGGAGTTTGCTAAGG
1041 GCAGTATTTTTCTGTCAAGACTATTCAAGAAGGCATTATTTGAGATTCCTGTTCATTCTTGGTGTGTCTCTAACAGATAC
1121 AGTATGTATACATTTGTATAATTGTTGTTGTTGAAAGTCCAGCTTTTTTGAGGTATATTTTAAATGTTTTAAGGATGCTT
1201 CTAAGGATCAGTAGTAATTTTTTTAGTTCGCACCTAAAGATGATTACATTGACCTCCCCCGACTGCTTACCAAATTAAAA
1281 TGTGTCCACGAAGTAGCTTTGTGATCGCAGATACATTCATAGTGAACTCATCAGAATGGCTGGTTTGCAGTACTGAAATA
1361 CTATCTTCTAGGCTGTATGTAGTGCTACAATTAGAGAAACAGAAGTCCAAGGCTGGCGACAGCTTGAAAAGTCTGACAGC
1441 TTTTCTACTTTTCCTGAAAATTTTAAGACTGTGATATCTGTCATTTTACTGTATAGCTGACTGTGTACTCAGGTATTTTA
1521 TTGGTCCTTGAAAGATTGGTCGTTATGGATCACCCAGCCTTTCCAAGTCAGTGGCTGTTGTTCTGTCTTGCTGTCTGATA
1601 CGAGAGTGGGGCTTTTCAGTGAACTAACCAGGGATTGTTCTTGACATACCTGACTTTTCTCACATTTGAACTTCCACTAT
1681 CATTGTATCCATATAACTTCTAGCATTTTCATGCCATGGTAATCCATGAGCTACACATACGTAGCCCGGCACCGTGATGC
1761 AAGTTCATGGTATCGTGCATGTTCGTGGTATCATGGTATCATTCATGCGTGTTTGAATAGTTCTACATCTAGTGCTTCTT
1841 GCCAAAAAGAATACATTGTTTAAATTCACAAAATTAGCATAATTGCAGTGCTAATGAATATCGGAATATGTGCACAGTAA
1921 CATTTGGACTATTCATTGGAGAGTTTACCCATACATTTAGCAAATTGAATGGCCAAAACATTTGACTCCAGTGAGGGCTC
2001 AAGTTAGATCCCTATAGAAAGAGGACACTTCATCTTACTTAAGTCATAGTTAAGATCTGTGATACGAACCATAGATATTG
2081 CCTGACAAAGCAGAAATCACCAAGTTTCCCCCTTTTGAATTACCACCAAGAAGTGTTGAAACACCAAATAGATATCATGT
2161 TATTTTGGGCATTTGCAGTTTTCTTCCCTGCTGCATGTAATGTCTCAGAATCAACATTCTTTTAAAATCTAGACTATATT
2241 TTGAGGCAATGAATTACTTATATTCAACTTAGGCTTGTTTTGACATTCAGTAGAACTTTAAGTTCAATCTAAAGGCTTCA
2321 GTCCACATTTTTTTATACGTTGTATTTTAAAAACGTTTGAAAGGAGTCTTACACCTGTATCATGAAAACTGAATCCTTTT
2401 GAAATACCACTATATGAAGAGAGAGATGAAATTTAGTGAACAGAATTGAAAAGGTGCTCATAATTTCACTATGCAAACTT
2481 ACCCCAGTCTCTAAAAAAGTAATTTAGATTTAAAGTTCTTTGATGTATTTGATTTTCTAAATCTTTATGGTTATGATTTG
2561 GAATAAAATGTGCCTAATCCTGTGTTACATTCTGTTCTTAAATCTGAATGCCTTCTCATTTAATTCTGAGGAAATATCAC
2641 ACAAGTGTCTTCATTGACCTTGAAGAAATGTATATACAGTTGCCTTATAAAACAACATAAATTTAGACCATAACTTTTAT
2721 AGAGAAAGGGTTTTGTCAAATGTTTTCTGAAAATCTGAGTAATTCAAAGCATGCCTCTGCCCCTTTAATATTTTTAATAA
2801 CCTGCATTGTTGCTGTCTGCCAAATATTAAATTGAAATCTTCATTTCAATTTTATTATCTGGAAAGGGCACTGGATTGCT
2881 CTGCAACCAAAGAAAGCAATATGGAATGAAAAAACTCATTCACTTTTGTCTTATTTTCTTTTAAGGTGTATTGGCATGTA
2961 ATTTGCATAGAGAAGGTCCTCTGGTTAGTCTCTCAAATTGAGGCTGTTTAGGGAAATCCTTATTCAGTTGGTGGCAGTGG
3041 TTGGTTTAAAGTAGAAGGAAATAAGATCGCCTTAATACCAGAAATGATTAGAAGTGCTGATTTAGATTCAACAAATACCA
3121 TATGTCCTTATCATTTTTTGTAAGAAGAAATTGGTTAAGTCCTAACTTTCAATGTGTACCCAAATACTTGTATTTATGCT
3201 TTTGATAAAATGTATTTTCAGCATTAATACACATCCGATTATGCCTTATTTATATATGAAGAATAAAGTTACCATGTTAT
3281 ACTGTTATGTCCTAAAATTCAAATCACTATTTGAGAAACCCTCAAATTGGTGCTTTCATTATATAATGATACATTTAGAC
3361 AAAACCCCAAACTAAGCCATTTGAAACAAGATTCTCTCCATTGCAGTTTGTAGCAATGTTATTTCTGTGTATGTCATGAG
3441 AAGGCTAAATATCAGTGTTAATTTCTTGTTTGAATCCGTGAAATCATGCCTGTAAAGCCCAAACATTTGTAACAAACTCC
3521 CTAATAAATTTAGAGAAAGTCACTCTGTTACCATTTCATTTATTTTAGTTTTATTTGAGAAATTAAGACCAGAAGTTTTG
3601 CTCATGTCTTTTTCACTTGGAAATCTGACTTAGTACCTAGTTAATTTGTCTCTCTCCCATCATTTTAAGGCGTTCGCTTC
3681 TGTTAATCACAGATGATCTGTCCTTGTGTTGTGCTGCTTGACTAAAAGCACTGTTTTGTTTTGTTTTGTTTTGTTTTTTA
3761 ATGATAGGATACAGGGTGGCTTTTCAGTCTAGTAAACATGAGGAGGGGAGAGATTGTGGGTGGGTGTGGGTGTGTCCGCA
3841 TGTCCCAAATACAGCACATGCCCATTTTTTTATGGTACGAGGTTAGGGCTTATTAATAAATGTATACTAGATCTTGAAGT
3921 GTAAGTCTAAGTCTGAACATTTTAAACAAGTTGGACTTTATGGCTTTTTCAAGTTCCATCAAGTAGATACTAGTCTTAGG
4001 CTGGTAGGTGATTAACAACATCATTTGGAGTACAGTGTTTGTACCACTAGCATTCTTATGTCTGTACTTGAACGTGTAGT
4081 TAGCATTTAAGTTATGTTCACTCTTGTAGCATTCAGGTCTTACCATCTGGTTTCAAATGCGAGAGCTTATATGAACATTG
4161 TTTTGAAAGCATGAATGATATGGCAATATTTTATGTCTTGATAAGGAGAGTTTTGTGACATATACAAATCTGCTGTTGAT
4241 GATGAAAGTTTACAGGTGGATCAGAGTATGCTGGAACTCAGTGTGCATAAAATTTCAGTCAGTGAATATCACTGAACGTC
4321 ATATACTACTTGGTATGTGACTTTGGTTTGTGTTAAGAAAGCTTGTATATAATATTTTTTGCCATAGTAAGTGAGAAATT
4401 GTCCTTAATCATGCCTGTTTGATGGTACTAGGAAAGAAAGGGGTAGAGATTAATTCTTGCACAGTATAAGCAACAGTGCA
4481 ACAAACTATGCCATTTACCTTTTACCTCTTACTTGAAGGCAGAATCGCAAAACGTTTGAAATGGCTTTTCTAAACTACTC
4561 TACTCTGGTGAGAGCTCATTTACCACAAGAAGCCTTATAAAAAAGTATATTTTGTAATAACCCCGTAGATACTGTACCTA
4641 ACAAAACATGACTCGTATTAGCTCTATAAAATATTTGTGGCTTAGGATTTTTTTTTTACATATATCTTTTTATAACTTTC
4721 CAGGAACTAAGCACATTATCTGATAATTGTTGTAAATTTTTTTGTCAGTGCTTTAGTTCAGGATGGGCAATAAATTATTT
4801 CTAAAGGAGGTCTAAAAGTGGAAAGAATGGTTTGATTTTATAAAATGAGTTGCTAGTTCATTACAGCTTTTTACTTTTGT
4881 ACATATTTTGCAAAACATTTGCCTCTTGCTATTAATATTTGCTTTGTAAAAATTACTGACATTTAATAAACATTTGTAAA
4961 CAATTCAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucgacUCACAUCCUACAAAUGu 5'
               ||   | | ||||||| 
Target 5' aggcaAGCTAATGCTGTTTACc 3'
678 - 699 145.00 -5.60
2
miRNA  3' ucgacUCACAUCCUACAAAUgu 5'
               | || ||| ||||||  
Target 5' ctcaaATTG-AGGCTGTTTAgg 3'
2992 - 3012 136.00 -7.39
3
miRNA  3' ucGACUCACAUCCUACAAAUGu 5'
            :|| || |  ||||||| | 
Target 5' ttTTGTGTTTTTGATGTTTTCt 3'
30 - 51 132.00 -8.12
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30b-5p :: GNA13    [ Functional MTI ]
Validation Method Sequencing
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
126 hsa-miR-30b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006303 CCNE2 cyclin E2 2 1
MIRT006320 SMAD1 SMAD family member 1 2 1
MIRT006324 BCL6 B-cell CLL/lymphoma 6 3 1
MIRT006325 SOCS1 suppressor of cytokine signaling 1 3 1
MIRT006610 Snai1 snail homolog 1 (Drosophila) 2 1
MIRT006761 SNAI1 snail homolog 1 (Drosophila) 3 1
MIRT007067 CAT catalase 3 1
MIRT023404 KLHL28 kelch-like 28 (Drosophila) 1 1
MIRT023405 USP53 ubiquitin specific peptidase 53 1 1
MIRT023406 CHD1 chromodomain helicase DNA binding protein 1 1 1
MIRT023407 COPS7B COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) 1 1
MIRT023408 MYO1E myosin IE 1 1
MIRT023409 RGMB RGM domain family, member B 1 1
MIRT023410 FBXO3 F-box protein 3 1 1
MIRT023411 SRPR signal recognition particle receptor (docking protein) 1 1
MIRT023412 BLOC1S6 biogenesis of lysosomal organelles complex-1, subunit 6, pallidin 1 1
MIRT023413 PLIN3 perilipin 3 1 1
MIRT023414 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT023415 ZNF543 zinc finger protein 543 1 1
MIRT023416 ZFYVE20 zinc finger, FYVE domain containing 20 1 1
MIRT023417 FAM8A1 family with sequence similarity 8, member A1 1 1
MIRT023418 NCOA6 nuclear receptor coactivator 6 1 1
MIRT023419 TRERF1 transcriptional regulating factor 1 1 1
MIRT023420 ZNF567 zinc finger protein 567 1 1
MIRT023421 DCAF12 DDB1 and CUL4 associated factor 12 1 1
MIRT023422 CLDN12 claudin 12 1 1
MIRT023423 PNN pinin, desmosome associated protein 1 1
MIRT023424 WDR89 WD repeat domain 89 1 1
MIRT023425 PHF13 PHD finger protein 13 1 1
MIRT023426 RRAGD Ras-related GTP binding D 1 1
MIRT023427 ZBTB38 zinc finger and BTB domain containing 38 1 1
MIRT023428 PDCD10 programmed cell death 10 1 1
MIRT023429 ZNF770 zinc finger protein 770 1 1
MIRT023430 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 1
MIRT023431 FRZB frizzled-related protein 1 1
MIRT023432 METTL21D methyltransferase like 21D 1 1
MIRT023433 ZDHHC17 zinc finger, DHHC-type containing 17 1 1
MIRT023434 CDCA7 cell division cycle associated 7 1 1
MIRT023435 HIC2 hypermethylated in cancer 2 1 1
MIRT023436 OTUD4 OTU domain containing 4 1 1
MIRT023437 GLCE glucuronic acid epimerase 1 1
MIRT023438 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT023439 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 1
MIRT023440 AZIN1 antizyme inhibitor 1 1 1
MIRT023441 GNA13 guanine nucleotide binding protein (G protein), alpha 13 1 1
MIRT023442 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 1
MIRT023443 CD2AP CD2-associated protein 1 1
MIRT023444 TNRC6C trinucleotide repeat containing 6C 1 1
MIRT023445 SOX4 SRY (sex determining region Y)-box 4 1 1
MIRT023446 EML4 echinoderm microtubule associated protein like 4 1 1
MIRT023447 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 1 1
MIRT023448 ATG12 autophagy related 12 1 1
MIRT023449 SYPL1 synaptophysin-like 1 1 1
MIRT023450 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 1 1
MIRT023451 PGM3 phosphoglucomutase 3 1 1
MIRT023452 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT023453 SH2B3 SH2B adaptor protein 3 1 1
MIRT023454 RFX7 regulatory factor X, 7 1 1
MIRT023455 KLF10 Kruppel-like factor 10 1 1
MIRT023456 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT023457 GNPDA1 glucosamine-6-phosphate deaminase 1 1 1
MIRT023458 TAOK1 TAO kinase 1 1 1
MIRT023459 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 1
MIRT023460 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT023461 MIER3 mesoderm induction early response 1, family member 3 1 1
MIRT023462 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase, type II, alpha 1 1
MIRT046108 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT046109 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT046110 KLF4 Kruppel-like factor 4 (gut) 1 1
MIRT046111 LRP8 low density lipoprotein receptor-related protein 8, apolipoprotein e receptor 1 1
MIRT046112 TSHZ3 teashirt zinc finger homeobox 3 1 1
MIRT046113 ATP5C1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 1 1
MIRT046114 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT046115 RUNX2 runt-related transcription factor 2 1 1
MIRT046116 NIPBL Nipped-B homolog (Drosophila) 1 1
MIRT046117 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT046118 WDR43 WD repeat domain 43 1 1
MIRT046119 STX17 syntaxin 17 1 1
MIRT046120 IKZF4 IKAROS family zinc finger 4 (Eos) 1 1
MIRT046121 CSF1 colony stimulating factor 1 (macrophage) 1 1
MIRT046122 POLRMT polymerase (RNA) mitochondrial (DNA directed) 1 1
MIRT046123 CHAT choline O-acetyltransferase 1 1
MIRT046124 CEP152 centrosomal protein 152kDa 1 1
MIRT046125 FERMT2 fermitin family member 2 1 1
MIRT046126 HEY1 hairy/enhancer-of-split related with YRPW motif 1 1 1
MIRT046127 RAB18 RAB18, member RAS oncogene family 1 1
MIRT046128 OLFML2B olfactomedin-like 2B 1 1
MIRT046129 RBBP7 retinoblastoma binding protein 7 1 1
MIRT046130 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT046131 MATR3 matrin 3 1 1
MIRT046132 RPS4X ribosomal protein S4, X-linked 1 1
MIRT046133 EYA3 eyes absent homolog 3 (Drosophila) 1 1
MIRT046134 APLN apelin 1 1
MIRT046135 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT046136 RAB22A RAB22A, member RAS oncogene family 1 1
MIRT046137 PARP1 poly (ADP-ribose) polymerase 1 1 1
MIRT046138 TMED5 transmembrane emp24 protein transport domain containing 5 1 1
MIRT046139 EIF2B1 eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa 1 1
MIRT046140 ACER3 alkaline ceramidase 3 1 1
MIRT046141 WDR37 WD repeat domain 37 1 1
MIRT046142 CYB5B cytochrome b5 type B (outer mitochondrial membrane) 1 1
MIRT046143 HMGN2 high mobility group nucleosomal binding domain 2 1 1
MIRT046144 ACTR10 actin-related protein 10 homolog (S. cerevisiae) 1 1
MIRT046145 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT046146 C1QBP complement component 1, q subcomponent binding protein 1 1
MIRT046147 PPP1R12B protein phosphatase 1, regulatory subunit 12B 1 1
MIRT046148 FAM134C family with sequence similarity 134, member C 1 1
MIRT046149 RNF34 ring finger protein 34, E3 ubiquitin protein ligase 1 1
MIRT046150 TRIM59 tripartite motif containing 59 1 1
MIRT046151 TMEM106B transmembrane protein 106B 1 1
MIRT046152 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT046153 RPS27A ribosomal protein S27a 1 1
MIRT046154 SNRNP200 small nuclear ribonucleoprotein 200kDa (U5) 1 1
MIRT046155 ZNF589 zinc finger protein 589 1 1
MIRT046156 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT046157 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT046158 ZNF646 zinc finger protein 646 1 1
MIRT046159 GNAZ guanine nucleotide binding protein (G protein), alpha z polypeptide 1 1
MIRT046160 ARF1 ADP-ribosylation factor 1 1 1
MIRT046161 RBM14 RNA binding motif protein 14 1 1
MIRT046162 SKIL SKI-like oncogene 1 1
MIRT046163 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT046164 PRMT7 protein arginine methyltransferase 7 1 1
MIRT046165 POU4F1 POU class 4 homeobox 1 1 1
MIRT046166 PCNT pericentrin 1 1
MIRT046167 ELOVL4 ELOVL fatty acid elongase 4 1 1