Accession ID: MIRT023441 [miRNA, hsa-miR-30b-5p :: GNA13, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-30bLinkOut: [miRBase ]
Description Homo sapiens miR-30b stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-30b-5p
Mature Sequence 17| UGUAAACAUCCUACACUCAGCU |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-30b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol GNA13 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms G13
Description guanine nucleotide binding protein (G protein), alpha 13
Transcript NM_006572    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on GNA13 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of GNA13
(miRNA target sites are highlighted)
>GNA13|NM_006572|3'UTR
   1 TGTACAAAAGACTTGCTGTTTTAATATCTTTTTGTGTTTTTGATGTTTTCTGTTTGTTTTGTTTTTTAAAATAGCAGTTT
  81 ACAACCAGAATTAGAACAATCTTAATTCTACGTTTAACTTCTTGAAAATCTTAGTACTTTTTCTGCGGCCTTTGGTTTGT
 161 GGCTGAAAGCTGTTGAGTGACTCATCGCCAAGATTTGCTGTAATGCAGGCTTTGATCTGTTTCACCATGGCTTCTATTCA
 241 AGTCCAGTTAAAACCTCCCAGCTGACCTCAGACTAGGCATATTTCAGGCTTTAAATTATTCTACTTTCCAAACTGAATTC
 321 TCCTGCAGTGCCAAGTATCAAAGGTGTCCTTAAATACTTGTAGGGATGAGGTTAGGAATATTCAGTTCCAAAACAAGATA
 401 TCTTCTGTCCGCCTTACATATAGCAGTGACACTTGTTGCCTAACTTTATGGTGACCTCCTATTTTGTAAGGGCTGTTAGA
 481 AGTTCTATCTAAGAAATGGCATTCTGTAGGTTTATAGAAGGTTTAGCCTTCATATTTTAATTGCTTGTATACACAACAGC
 561 TGTTTTGCTTTTAGATTTCTGTGTTTCTGAAGGTAATGTTCTTCCTGTTTTCAAGTTTACATAAGGATCTTTGGTCTGAT
 641 GCTGATGAAGAGTTCACAGGTGGTATGGGAGAGCAAAAGGCAAGCTAATGCTGTTTACCGTGTTTTGGTCAAACGTAACG
 721 AGTGAAATAGAATTTGCCTTTCTCATATTTAATTATCATGTAGTTTAATGTACCATATGTGAAACATTCTGGCCATAGCA
 801 GCAACTAAAAACTGCAAGCAACTTGGTAACAGAACTTTCTAAATAAACTTAACCTGTTCCAGAATGTCATGTATTTGACT
 881 TTTAAGCCCTATCTCAGTTGGTCAGTAAAGACCAATCCTTACTGTAGGAAATCATTGTTGTATCATCACAAACATCTATC
 961 TTTTGCTGTCCTGTCCAGTCCCATCAACTCCACACTGTGCCATTTGTGGCATCGTTTTGTTTATTTGGAGTTTGCTAAGG
1041 GCAGTATTTTTCTGTCAAGACTATTCAAGAAGGCATTATTTGAGATTCCTGTTCATTCTTGGTGTGTCTCTAACAGATAC
1121 AGTATGTATACATTTGTATAATTGTTGTTGTTGAAAGTCCAGCTTTTTTGAGGTATATTTTAAATGTTTTAAGGATGCTT
1201 CTAAGGATCAGTAGTAATTTTTTTAGTTCGCACCTAAAGATGATTACATTGACCTCCCCCGACTGCTTACCAAATTAAAA
1281 TGTGTCCACGAAGTAGCTTTGTGATCGCAGATACATTCATAGTGAACTCATCAGAATGGCTGGTTTGCAGTACTGAAATA
1361 CTATCTTCTAGGCTGTATGTAGTGCTACAATTAGAGAAACAGAAGTCCAAGGCTGGCGACAGCTTGAAAAGTCTGACAGC
1441 TTTTCTACTTTTCCTGAAAATTTTAAGACTGTGATATCTGTCATTTTACTGTATAGCTGACTGTGTACTCAGGTATTTTA
1521 TTGGTCCTTGAAAGATTGGTCGTTATGGATCACCCAGCCTTTCCAAGTCAGTGGCTGTTGTTCTGTCTTGCTGTCTGATA
1601 CGAGAGTGGGGCTTTTCAGTGAACTAACCAGGGATTGTTCTTGACATACCTGACTTTTCTCACATTTGAACTTCCACTAT
1681 CATTGTATCCATATAACTTCTAGCATTTTCATGCCATGGTAATCCATGAGCTACACATACGTAGCCCGGCACCGTGATGC
1761 AAGTTCATGGTATCGTGCATGTTCGTGGTATCATGGTATCATTCATGCGTGTTTGAATAGTTCTACATCTAGTGCTTCTT
1841 GCCAAAAAGAATACATTGTTTAAATTCACAAAATTAGCATAATTGCAGTGCTAATGAATATCGGAATATGTGCACAGTAA
1921 CATTTGGACTATTCATTGGAGAGTTTACCCATACATTTAGCAAATTGAATGGCCAAAACATTTGACTCCAGTGAGGGCTC
2001 AAGTTAGATCCCTATAGAAAGAGGACACTTCATCTTACTTAAGTCATAGTTAAGATCTGTGATACGAACCATAGATATTG
2081 CCTGACAAAGCAGAAATCACCAAGTTTCCCCCTTTTGAATTACCACCAAGAAGTGTTGAAACACCAAATAGATATCATGT
2161 TATTTTGGGCATTTGCAGTTTTCTTCCCTGCTGCATGTAATGTCTCAGAATCAACATTCTTTTAAAATCTAGACTATATT
2241 TTGAGGCAATGAATTACTTATATTCAACTTAGGCTTGTTTTGACATTCAGTAGAACTTTAAGTTCAATCTAAAGGCTTCA
2321 GTCCACATTTTTTTATACGTTGTATTTTAAAAACGTTTGAAAGGAGTCTTACACCTGTATCATGAAAACTGAATCCTTTT
2401 GAAATACCACTATATGAAGAGAGAGATGAAATTTAGTGAACAGAATTGAAAAGGTGCTCATAATTTCACTATGCAAACTT
2481 ACCCCAGTCTCTAAAAAAGTAATTTAGATTTAAAGTTCTTTGATGTATTTGATTTTCTAAATCTTTATGGTTATGATTTG
2561 GAATAAAATGTGCCTAATCCTGTGTTACATTCTGTTCTTAAATCTGAATGCCTTCTCATTTAATTCTGAGGAAATATCAC
2641 ACAAGTGTCTTCATTGACCTTGAAGAAATGTATATACAGTTGCCTTATAAAACAACATAAATTTAGACCATAACTTTTAT
2721 AGAGAAAGGGTTTTGTCAAATGTTTTCTGAAAATCTGAGTAATTCAAAGCATGCCTCTGCCCCTTTAATATTTTTAATAA
2801 CCTGCATTGTTGCTGTCTGCCAAATATTAAATTGAAATCTTCATTTCAATTTTATTATCTGGAAAGGGCACTGGATTGCT
2881 CTGCAACCAAAGAAAGCAATATGGAATGAAAAAACTCATTCACTTTTGTCTTATTTTCTTTTAAGGTGTATTGGCATGTA
2961 ATTTGCATAGAGAAGGTCCTCTGGTTAGTCTCTCAAATTGAGGCTGTTTAGGGAAATCCTTATTCAGTTGGTGGCAGTGG
3041 TTGGTTTAAAGTAGAAGGAAATAAGATCGCCTTAATACCAGAAATGATTAGAAGTGCTGATTTAGATTCAACAAATACCA
3121 TATGTCCTTATCATTTTTTGTAAGAAGAAATTGGTTAAGTCCTAACTTTCAATGTGTACCCAAATACTTGTATTTATGCT
3201 TTTGATAAAATGTATTTTCAGCATTAATACACATCCGATTATGCCTTATTTATATATGAAGAATAAAGTTACCATGTTAT
3281 ACTGTTATGTCCTAAAATTCAAATCACTATTTGAGAAACCCTCAAATTGGTGCTTTCATTATATAATGATACATTTAGAC
3361 AAAACCCCAAACTAAGCCATTTGAAACAAGATTCTCTCCATTGCAGTTTGTAGCAATGTTATTTCTGTGTATGTCATGAG
3441 AAGGCTAAATATCAGTGTTAATTTCTTGTTTGAATCCGTGAAATCATGCCTGTAAAGCCCAAACATTTGTAACAAACTCC
3521 CTAATAAATTTAGAGAAAGTCACTCTGTTACCATTTCATTTATTTTAGTTTTATTTGAGAAATTAAGACCAGAAGTTTTG
3601 CTCATGTCTTTTTCACTTGGAAATCTGACTTAGTACCTAGTTAATTTGTCTCTCTCCCATCATTTTAAGGCGTTCGCTTC
3681 TGTTAATCACAGATGATCTGTCCTTGTGTTGTGCTGCTTGACTAAAAGCACTGTTTTGTTTTGTTTTGTTTTGTTTTTTA
3761 ATGATAGGATACAGGGTGGCTTTTCAGTCTAGTAAACATGAGGAGGGGAGAGATTGTGGGTGGGTGTGGGTGTGTCCGCA
3841 TGTCCCAAATACAGCACATGCCCATTTTTTTATGGTACGAGGTTAGGGCTTATTAATAAATGTATACTAGATCTTGAAGT
3921 GTAAGTCTAAGTCTGAACATTTTAAACAAGTTGGACTTTATGGCTTTTTCAAGTTCCATCAAGTAGATACTAGTCTTAGG
4001 CTGGTAGGTGATTAACAACATCATTTGGAGTACAGTGTTTGTACCACTAGCATTCTTATGTCTGTACTTGAACGTGTAGT
4081 TAGCATTTAAGTTATGTTCACTCTTGTAGCATTCAGGTCTTACCATCTGGTTTCAAATGCGAGAGCTTATATGAACATTG
4161 TTTTGAAAGCATGAATGATATGGCAATATTTTATGTCTTGATAAGGAGAGTTTTGTGACATATACAAATCTGCTGTTGAT
4241 GATGAAAGTTTACAGGTGGATCAGAGTATGCTGGAACTCAGTGTGCATAAAATTTCAGTCAGTGAATATCACTGAACGTC
4321 ATATACTACTTGGTATGTGACTTTGGTTTGTGTTAAGAAAGCTTGTATATAATATTTTTTGCCATAGTAAGTGAGAAATT
4401 GTCCTTAATCATGCCTGTTTGATGGTACTAGGAAAGAAAGGGGTAGAGATTAATTCTTGCACAGTATAAGCAACAGTGCA
4481 ACAAACTATGCCATTTACCTTTTACCTCTTACTTGAAGGCAGAATCGCAAAACGTTTGAAATGGCTTTTCTAAACTACTC
4561 TACTCTGGTGAGAGCTCATTTACCACAAGAAGCCTTATAAAAAAGTATATTTTGTAATAACCCCGTAGATACTGTACCTA
4641 ACAAAACATGACTCGTATTAGCTCTATAAAATATTTGTGGCTTAGGATTTTTTTTTTACATATATCTTTTTATAACTTTC
4721 CAGGAACTAAGCACATTATCTGATAATTGTTGTAAATTTTTTTGTCAGTGCTTTAGTTCAGGATGGGCAATAAATTATTT
4801 CTAAAGGAGGTCTAAAAGTGGAAAGAATGGTTTGATTTTATAAAATGAGTTGCTAGTTCATTACAGCTTTTTACTTTTGT
4881 ACATATTTTGCAAAACATTTGCCTCTTGCTATTAATATTTGCTTTGTAAAAATTACTGACATTTAATAAACATTTGTAAA
4961 CAATTCAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucgacUCACAUCCUACAAAUGu 5'
               ||   | | ||||||| 
Target 5' aggcaAGCTAATGCTGTTTACc 3'
678 - 699 145.00 -5.60
2
miRNA  3' ucgacUCACAUCCUACAAAUgu 5'
               | || ||| ||||||  
Target 5' ctcaaATTG-AGGCTGTTTAgg 3'
2992 - 3012 136.00 -7.39
3
miRNA  3' ucGACUCACAUCCUACAAAUGu 5'
            :|| || |  ||||||| | 
Target 5' ttTTGTGTTTTTGATGTTTTCt 3'
30 - 51 132.00 -8.12
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30b-5p :: GNA13    [ Functional MTI ]
Validation Method Sequencing
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30b-5p :: GNA13    [ Functional MTI ]
Validation Method
Article - Gottwein, E. Corcoran, D. L. Mukherjee, N. et al.
- Cell Host Microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000439174.2 | 3UTR | UUUUUUAAAAUAGCAGUUUACAACCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000439174.2 | 3UTR | UUUUUUAAAAUAGCAGUUUACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000439174.2 | 3UTR | UUUUUUAAAAUAGCAGUUUAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000439174.2 | 3UTR | UUUUUUAAAAUAGCAGUUUAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000439174.2 | 3UTR | UCAAGUUUACAUAAGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000439174.2 | 3UTR | UCAAGUUUACAUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
397 hsa-miR-30b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006303 CCNE2 cyclin E2 2 1
MIRT006320 SMAD1 SMAD family member 1 2 1
MIRT006324 BCL6 B-cell CLL/lymphoma 6 3 1
MIRT006325 SOCS1 suppressor of cytokine signaling 1 4 4
MIRT006610 Snai1 snail homolog 1 (Drosophila) 2 1
MIRT006761 SNAI1 snail homolog 1 (Drosophila) 3 1
MIRT007067 CAT catalase 3 1
MIRT023404 KLHL28 kelch-like 28 (Drosophila) 1 1
MIRT023405 USP53 ubiquitin specific peptidase 53 1 1
MIRT023406 CHD1 chromodomain helicase DNA binding protein 1 1 2
MIRT023407 COPS7B COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) 1 1
MIRT023408 MYO1E myosin IE 1 1
MIRT023409 RGMB RGM domain family, member B 1 1
MIRT023410 FBXO3 F-box protein 3 1 1
MIRT023411 SRPR signal recognition particle receptor (docking protein) 1 2
MIRT023412 BLOC1S6 biogenesis of lysosomal organelles complex-1, subunit 6, pallidin 1 1
MIRT023413 PLIN3 perilipin 3 1 1
MIRT023414 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 2
MIRT023415 ZNF543 zinc finger protein 543 1 2
MIRT023416 ZFYVE20 zinc finger, FYVE domain containing 20 1 1
MIRT023417 FAM8A1 family with sequence similarity 8, member A1 1 2
MIRT023418 NCOA6 nuclear receptor coactivator 6 1 1
MIRT023419 TRERF1 transcriptional regulating factor 1 1 1
MIRT023420 ZNF567 zinc finger protein 567 1 1
MIRT023421 DCAF12 DDB1 and CUL4 associated factor 12 1 1
MIRT023422 CLDN12 claudin 12 1 1
MIRT023423 PNN pinin, desmosome associated protein 1 1
MIRT023424 WDR89 WD repeat domain 89 1 1
MIRT023425 PHF13 PHD finger protein 13 1 3
MIRT023426 RRAGD Ras-related GTP binding D 1 1
MIRT023427 ZBTB38 zinc finger and BTB domain containing 38 1 1
MIRT023428 PDCD10 programmed cell death 10 1 2
MIRT023429 ZNF770 zinc finger protein 770 1 1
MIRT023430 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 2
MIRT023431 FRZB frizzled-related protein 1 1
MIRT023432 METTL21D methyltransferase like 21D 1 1
MIRT023433 ZDHHC17 zinc finger, DHHC-type containing 17 1 1
MIRT023434 CDCA7 cell division cycle associated 7 1 1
MIRT023435 HIC2 hypermethylated in cancer 2 1 4
MIRT023436 OTUD4 OTU domain containing 4 1 2
MIRT023437 GLCE glucuronic acid epimerase 1 2
MIRT023438 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT023439 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 3
MIRT023440 AZIN1 antizyme inhibitor 1 1 4
MIRT023441 GNA13 guanine nucleotide binding protein (G protein), alpha 13 1 2
MIRT023442 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 1
MIRT023443 CD2AP CD2-associated protein 1 2
MIRT023444 TNRC6C trinucleotide repeat containing 6C 1 1
MIRT023445 SOX4 SRY (sex determining region Y)-box 4 1 2
MIRT023446 EML4 echinoderm microtubule associated protein like 4 1 3
MIRT023447 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 1 1
MIRT023448 ATG12 autophagy related 12 4 2
MIRT023449 SYPL1 synaptophysin-like 1 1 1
MIRT023450 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 1 1
MIRT023451 PGM3 phosphoglucomutase 3 1 2
MIRT023452 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 2
MIRT023453 SH2B3 SH2B adaptor protein 3 1 1
MIRT023454 RFX7 regulatory factor X, 7 1 1
MIRT023455 KLF10 Kruppel-like factor 10 1 2
MIRT023456 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT023457 GNPDA1 glucosamine-6-phosphate deaminase 1 1 1
MIRT023458 TAOK1 TAO kinase 1 1 2
MIRT023459 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 1
MIRT023460 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT023461 MIER3 mesoderm induction early response 1, family member 3 1 2
MIRT023462 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase, type II, alpha 1 1
MIRT046108 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT046109 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT046110 KLF4 Kruppel-like factor 4 (gut) 1 1
MIRT046111 LRP8 low density lipoprotein receptor-related protein 8, apolipoprotein e receptor 1 1
MIRT046112 TSHZ3 teashirt zinc finger homeobox 3 1 1
MIRT046113 ATP5C1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 1 1
MIRT046114 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT046115 RUNX2 runt-related transcription factor 2 4 2
MIRT046116 NIPBL Nipped-B homolog (Drosophila) 1 1
MIRT046117 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT046118 WDR43 WD repeat domain 43 1 1
MIRT046119 STX17 syntaxin 17 1 1
MIRT046120 IKZF4 IKAROS family zinc finger 4 (Eos) 1 1
MIRT046121 CSF1 colony stimulating factor 1 (macrophage) 1 1
MIRT046122 POLRMT polymerase (RNA) mitochondrial (DNA directed) 1 1
MIRT046123 CHAT choline O-acetyltransferase 1 1
MIRT046124 CEP152 centrosomal protein 152kDa 1 1
MIRT046125 FERMT2 fermitin family member 2 1 1
MIRT046126 HEY1 hairy/enhancer-of-split related with YRPW motif 1 1 1
MIRT046127 RAB18 RAB18, member RAS oncogene family 1 1
MIRT046128 OLFML2B olfactomedin-like 2B 1 1
MIRT046129 RBBP7 retinoblastoma binding protein 7 1 1
MIRT046130 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT046131 MATR3 matrin 3 1 1
MIRT046132 RPS4X ribosomal protein S4, X-linked 1 1
MIRT046133 EYA3 eyes absent homolog 3 (Drosophila) 1 1
MIRT046134 APLN apelin 1 1
MIRT046135 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT046136 RAB22A RAB22A, member RAS oncogene family 1 1
MIRT046137 PARP1 poly (ADP-ribose) polymerase 1 1 1
MIRT046138 TMED5 transmembrane emp24 protein transport domain containing 5 1 1
MIRT046139 EIF2B1 eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa 1 1
MIRT046140 ACER3 alkaline ceramidase 3 1 1
MIRT046141 WDR37 WD repeat domain 37 1 1
MIRT046142 CYB5B cytochrome b5 type B (outer mitochondrial membrane) 1 1
MIRT046143 HMGN2 high mobility group nucleosomal binding domain 2 1 1
MIRT046144 ACTR10 actin-related protein 10 homolog (S. cerevisiae) 1 1
MIRT046145 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT046146 C1QBP complement component 1, q subcomponent binding protein 1 1
MIRT046147 PPP1R12B protein phosphatase 1, regulatory subunit 12B 1 1
MIRT046148 FAM134C family with sequence similarity 134, member C 1 1
MIRT046149 RNF34 ring finger protein 34, E3 ubiquitin protein ligase 1 1
MIRT046150 TRIM59 tripartite motif containing 59 1 1
MIRT046151 TMEM106B transmembrane protein 106B 1 1
MIRT046152 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT046153 RPS27A ribosomal protein S27a 1 1
MIRT046154 SNRNP200 small nuclear ribonucleoprotein 200kDa (U5) 1 1
MIRT046155 ZNF589 zinc finger protein 589 1 1
MIRT046156 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT046157 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT046158 ZNF646 zinc finger protein 646 1 1
MIRT046159 GNAZ guanine nucleotide binding protein (G protein), alpha z polypeptide 1 1
MIRT046160 ARF1 ADP-ribosylation factor 1 1 1
MIRT046161 RBM14 RNA binding motif protein 14 1 1
MIRT046162 SKIL SKI-like oncogene 1 1
MIRT046163 DNMT1 DNA (cytosine-5-)-methyltransferase 1 3 2
MIRT046164 PRMT7 protein arginine methyltransferase 7 1 1
MIRT046165 POU4F1 POU class 4 homeobox 1 1 1
MIRT046166 PCNT pericentrin 1 1
MIRT046167 ELOVL4 ELOVL fatty acid elongase 4 1 1
MIRT053341 ERG v-ets erythroblastosis virus E26 oncogene homolog (avian) 4 1
MIRT054119 BECN1 beclin 1, autophagy related 4 2
MIRT054139 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 4 2
MIRT054328 DLL4 delta-like 4 (Drosophila) 3 1
MIRT054582 SIX1 SIX homeobox 1 3 1
MIRT054615 BCL9 B-cell CLL/lymphoma 9 3 1
MIRT054706 NOTCH1 notch 1 3 1
MIRT057360 PCGF5 polycomb group ring finger 5 1 1
MIRT057485 KIF11 kinesin family member 11 1 2
MIRT057676 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT059175 SLC35C1 solute carrier family 35, member C1 1 1
MIRT067978 TFDP1 transcription factor Dp-1 1 3
MIRT068118 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT068388 S100PBP S100P binding protein 1 1
MIRT069735 FOXG1 forkhead box G1 1 2
MIRT074376 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT075441 PSMD7 proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 1 3
MIRT079946 RNF138 ring finger protein 138, E3 ubiquitin protein ligase 1 2
MIRT080959 LRRC8B leucine rich repeat containing 8 family, member B 1 1
MIRT081080 LDLR low density lipoprotein receptor 1 1
MIRT081715 ZNF507 zinc finger protein 507 1 2
MIRT084235 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT088447 LCLAT1 lysocardiolipin acyltransferase 1 1 1
MIRT088936 ASB3 ankyrin repeat and SOCS box containing 3 1 1
MIRT090505 SLC35G2 solute carrier family 35, member G2 1 1
MIRT091579 FBXO45 F-box protein 45 1 1
MIRT095098 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT096081 SFXN1 sideroflexin 1 1 1
MIRT098038 SOBP sine oculis binding protein homolog (Drosophila) 1 1
MIRT100767 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 1 2
MIRT103197 SP4 Sp4 transcription factor 1 4
MIRT104522 PEG10 paternally expressed 10 1 1
MIRT105033 FAM91A1 family with sequence similarity 91, member A1 1 1
MIRT106746 RAD23B RAD23 homolog B (S. cerevisiae) 1 1
MIRT110577 KIF5B kinesin family member 5B 1 3
MIRT115923 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 1
MIRT118144 ZNF264 zinc finger protein 264 1 1
MIRT128245 STRIP1 striatin interacting protein 1 1 1
MIRT131796 CEP350 centrosomal protein 350kDa 1 1
MIRT131864 IER5 immediate early response 5 1 1
MIRT134332 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT135677 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT136217 STX12 syntaxin 12 1 1
MIRT137019 WDFY2 WD repeat and FYVE domain containing 2 1 1
MIRT137124 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT138284 RNF220 ring finger protein 220 1 1
MIRT139250 JDP2 Jun dimerization protein 2 1 1
MIRT140638 PLEKHO2 pleckstrin homology domain containing, family O member 2 1 1
MIRT142590 IL21R interleukin 21 receptor 1 2
MIRT143351 PAPD5 PAP associated domain containing 5 1 1
MIRT144538 ZNRF1 zinc and ring finger 1, E3 ubiquitin protein ligase 1 1
MIRT145450 RNF135 ring finger protein 135 1 1
MIRT148353 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 1 1
MIRT149121 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT150763 MAST3 microtubule associated serine/threonine kinase 3 1 1
MIRT154952 RRM2 ribonucleotide reductase M2 1 2
MIRT155243 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 1
MIRT159116 NRBP1 nuclear receptor binding protein 1 1 1
MIRT159246 RASGRP3 RAS guanyl releasing protein 3 (calcium and DAG-regulated) 1 1
MIRT160850 PLXNA1 plexin A1 1 1
MIRT162930 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 1 1
MIRT164236 GAB1 GRB2-associated binding protein 1 1 1
MIRT165598 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT167510 PRDM1 PR domain containing 1, with ZNF domain 1 1
MIRT170153 KLHDC10 kelch domain containing 10 1 1
MIRT171354 PHTF2 putative homeodomain transcription factor 2 1 2
MIRT171551 DBF4 DBF4 homolog (S. cerevisiae) 1 1
MIRT173416 MTDH metadherin 1 1
MIRT176035 JADE3 PHD finger protein 16 1 1
MIRT177712 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT185102 LYPLAL1 lysophospholipase-like 1 1 1
MIRT188274 RAP1B RAP1B, member of RAS oncogene family 1 1
MIRT192228 MKRN3 makorin ring finger protein 3 1 1
MIRT194172 IREB2 iron-responsive element binding protein 2 1 1
MIRT197648 DHX40 DEAH (Asp-Glu-Ala-His) box polypeptide 40 1 1
MIRT206181 RAB10 RAB10, member RAS oncogene family 1 1
MIRT206889 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT210818 SETD5 SET domain containing 5 1 1
MIRT212862 N4BP2 NEDD4 binding protein 2 1 1
MIRT215132 MFAP3 microfibrillar-associated protein 3 1 1
MIRT252101 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 1 1
MIRT257171 TBPL1 TBP-like 1 1 1
MIRT258126 UBE3C ubiquitin protein ligase E3C 1 1
MIRT258178 CBX3 chromobox homolog 3 1 1
MIRT270741 TMED2 transmembrane emp24 domain trafficking protein 2 1 1
MIRT283403 CCNF cyclin F 1 1
MIRT289631 CBX2 chromobox homolog 2 1 1
MIRT292169 CDC7 cell division cycle 7 homolog (S. cerevisiae) 1 1
MIRT292816 MTF2 metal response element binding transcription factor 2 1 1
MIRT293786 SAE1 SUMO1 activating enzyme subunit 1 1 1
MIRT294577 ZNF460 zinc finger protein 460 1 2
MIRT302903 FOXN2 forkhead box N2 1 1
MIRT306844 FYTTD1 forty-two-three domain containing 1 1 1
MIRT322689 BAG4 BCL2-associated athanogene 4 1 1
MIRT368809 MZT1 mitotic spindle organizing protein 1 1 1
MIRT379729 ZXDB zinc finger, X-linked, duplicated B 1 1
MIRT387957 H6PD hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 1 1
MIRT437428 PDGFRB platelet-derived growth factor receptor, beta polypeptide 3 1
MIRT437493 TP53 tumor protein p53 3 1
MIRT438196 BCL2 B-cell CLL/lymphoma 2 1 1
MIRT444600 TGFA transforming growth factor, alpha 1 1
MIRT446450 CHST15 carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 1 1
MIRT448493 SEC61A2 Sec61 alpha 2 subunit (S. cerevisiae) 1 1
MIRT448510 ROCK2 Rho-associated, coiled-coil containing protein kinase 2 1 1
MIRT448653 NCOA3 nuclear receptor coactivator 3 1 1
MIRT449710 TSPYL1 TSPY-like 1 1 1
MIRT450763 PGGT1B protein geranylgeranyltransferase type I, beta subunit 1 1
MIRT452142 PPP2R1B protein phosphatase 2, regulatory subunit A, beta 1 1
MIRT463405 ZDHHC20 zinc finger, DHHC-type containing 20 1 1
MIRT464291 VASH1 vasohibin 1 1 1
MIRT467411 SOCS3 suppressor of cytokine signaling 3 1 1
MIRT467627 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 1
MIRT470406 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT471080 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta 1 2
MIRT472477 NAP1L1 nucleosome assembly protein 1-like 1 1 4
MIRT473656 MARCKSL1 MARCKS-like 1 1 1
MIRT473695 MAPK8 mitogen-activated protein kinase 8 1 2
MIRT474085 LMBR1L limb region 1 homolog (mouse)-like 1 2
MIRT474284 LARP1 La ribonucleoprotein domain family, member 1 1 3
MIRT474324 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT475700 HHIPL1 HHIP-like 1 1 1
MIRT476173 GOLGA8B golgin A8 family, member B 1 2
MIRT481466 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 2
MIRT482066 ALG9 asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT482126 AKIRIN1 akirin 1 1 2
MIRT485200 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 3
MIRT488725 ADPRHL1 ADP-ribosylhydrolase like 1 1 1
MIRT492611 POLR3E polymerase (RNA) III (DNA directed) polypeptide E (80kD) 1 1
MIRT497127 IFNE interferon, epsilon 1 1
MIRT498612 MTRNR2L10 MT-RNR2-like 10 1 3
MIRT502703 CSNK1G1 casein kinase 1, gamma 1 1 3
MIRT503026 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT504040 TOMM5 translocase of outer mitochondrial membrane 5 homolog (yeast) 1 1
MIRT507130 GIGYF1 GRB10 interacting GYF protein 1 1 3
MIRT514180 PGPEP1 pyroglutamyl-peptidase I 1 2
MIRT530621 CXCL11 chemokine (C-X-C motif) ligand 11 1 1
MIRT531357 FAM81B family with sequence similarity 81, member B 1 1
MIRT534307 SKIDA1 SKI/DACH domain containing 1 1 1
MIRT536979 HABP4 hyaluronan binding protein 4 1 2
MIRT544267 SIKE1 suppressor of IKBKE 1 1 1
MIRT544514 GTF2E2 general transcription factor IIE, polypeptide 2, beta 34kDa 1 1
MIRT547192 PBRM1 polybromo 1 1 1
MIRT548193 FOXA1 forkhead box A1 1 1
MIRT548432 ELOVL5 ELOVL fatty acid elongase 5 1 1
MIRT552926 VPS33A vacuolar protein sorting 33 homolog A (S. cerevisiae) 1 1
MIRT554285 SIX4 SIX homeobox 4 1 1
MIRT555307 PPP3CB protein phosphatase 3, catalytic subunit, beta isozyme 1 1
MIRT555616 PICALM phosphatidylinositol binding clathrin assembly protein 1 2
MIRT556575 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT557732 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT557784 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT558466 DCUN1D1 DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) 1 1
MIRT562490 CELSR3 cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) 1 1
MIRT562796 NDUFA12 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 1 1
MIRT563234 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT563268 ST3GAL5 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 1 1
MIRT565078 UHRF1BP1 UHRF1 binding protein 1 1 2
MIRT565831 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT566681 MYLIP myosin regulatory light chain interacting protein 1 1
MIRT566744 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 2
MIRT567609 FANCF Fanconi anemia, complementation group F 1 1
MIRT568345 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 2
MIRT572870 OPHN1 oligophrenin 1 1 1
MIRT612402 STRN striatin, calmodulin binding protein 1 1
MIRT623310 MARCH4 membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase 1 1
MIRT626126 PLSCR1 phospholipid scramblase 1 1 2
MIRT653918 SERPINC1 serpin peptidase inhibitor, clade C (antithrombin), member 1 1 1
MIRT653988 SEMA6A sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 1 1
MIRT656334 MED29 mediator complex subunit 29 1 1
MIRT669387 BAHD1 bromo adjacent homology domain containing 1 1 1
MIRT686768 STX16 syntaxin 16 1 1
MIRT687191 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha 1 1
MIRT688638 CREM cAMP responsive element modulator 1 1
MIRT704913 CCDC71L coiled-coil domain containing 71-like 1 1
MIRT705330 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT705592 APLP2 amyloid beta (A4) precursor-like protein 2 1 1
MIRT705911 ADAM9 ADAM metallopeptidase domain 9 1 1
MIRT716459 MRO maestro 1 1
MIRT717152 LRRC3C leucine rich repeat containing 3C 1 1
MIRT718296 MOGAT1 monoacylglycerol O-acyltransferase 1 1 1
MIRT718887 SLFN5 schlafen family member 5 1 1
MIRT719019 SHROOM3 shroom family member 3 1 1
MIRT725999 ZSCAN29 zinc finger and SCAN domain containing 29 1 1
MIRT726050 ZNF200 zinc finger protein 200 1 1
MIRT726061 ZMYND8 zinc finger, MYND-type containing 8 1 1
MIRT726071 ZFAND5 zinc finger, AN1-type domain 5 1 1
MIRT726076 ZCRB1 zinc finger CCHC-type and RNA binding motif 1 1 1
MIRT726122 VPS41 vacuolar protein sorting 41 homolog (S. cerevisiae) 1 1
MIRT726147 VAPA VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa 1 1
MIRT726161 USP37 ubiquitin specific peptidase 37 1 1
MIRT726182 UBXN4 UBX domain protein 4 1 1
MIRT726193 UBN1 ubinuclein 1 1 1
MIRT726205 TXNDC5 thioredoxin domain containing 5 (endoplasmic reticulum) 1 1
MIRT726210 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 1 1
MIRT726230 TRIM23 tripartite motif containing 23 1 1
MIRT726264 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 1
MIRT726380 TBC1D10B TBC1 domain family, member 10B 1 1
MIRT726393 TANK TRAF family member-associated NFKB activator 1 1
MIRT726399 TAF4B TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa 1 1
MIRT726431 STAU1 staufen, RNA binding protein, homolog 1 (Drosophila) 1 1
MIRT726470 SOX12 SRY (sex determining region Y)-box 12 1 1
MIRT726522 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 1 1
MIRT726532 SLC38A7 solute carrier family 38, member 7 1 1
MIRT726590 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT726596 SH3GL1 SH3-domain GRB2-like 1 1 1
MIRT726612 SRSF7 serine/arginine-rich splicing factor 7 1 1
MIRT726619 SETD3 SET domain containing 3 1 1
MIRT726654 SBF1 SET binding factor 1 1 1
MIRT726665 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT726693 RPA2 replication protein A2, 32kDa 1 1
MIRT726734 RNF122 ring finger protein 122 1 1
MIRT726768 REV3L REV3-like, polymerase (DNA directed), zeta, catalytic subunit 1 1
MIRT726843 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT726861 PREPL prolyl endopeptidase-like 1 1
MIRT726866 PPTC7 PTC7 protein phosphatase homolog (S. cerevisiae) 1 1
MIRT726889 PPP1R2 protein phosphatase 1, regulatory (inhibitor) subunit 2 1 1
MIRT726894 PPP1R12A protein phosphatase 1, regulatory subunit 12A 1 1
MIRT726918 PNMA1 paraneoplastic Ma antigen 1 1 1
MIRT726979 PER2 period homolog 2 (Drosophila) 1 1
MIRT726997 PCDH10 protocadherin 10 1 1
MIRT727011 PAWR PRKC, apoptosis, WT1, regulator 1 1
MIRT727093 NDEL1 nudE nuclear distribution E homolog (A. nidulans)-like 1 1 1
MIRT727124 MYBL2 v-myb myeloblastosis viral oncogene homolog (avian)-like 2 1 1
MIRT727168 MLXIP MLX interacting protein 1 1
MIRT727194 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727206 MIA3 melanoma inhibitory activity family, member 3 1 1
MIRT727247 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 1
MIRT727279 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT727304 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT727309 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT727314 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT727319 LCP1 lymphocyte cytosolic protein 1 (L-plastin) 1 1
MIRT727356 EPG5 ectopic P-granules autophagy protein 5 homolog (C. elegans) 1 1
MIRT727393 JOSD1 Josephin domain containing 1 1 1
MIRT727398 KDM3A lysine (K)-specific demethylase 3A 1 1
MIRT727409 JAK1 Janus kinase 1 1 1
MIRT727434 IQCB1 IQ motif containing B1 1 1
MIRT727439 IP6K3 inositol hexakisphosphate kinase 3 1 1
MIRT727454 IL1A interleukin 1, alpha 1 1
MIRT727465 IKZF2 IKAROS family zinc finger 2 (Helios) 1 1
MIRT727546 GOLGA1 golgin A1 1 1
MIRT727569 GXYLT1 glucoside xylosyltransferase 1 1 1
MIRT727589 GCLC glutamate-cysteine ligase, catalytic subunit 1 1
MIRT727594 GCSAM germinal center-associated, signaling and motility 1 1
MIRT727635 FUCA1 fucosidase, alpha-L- 1, tissue 1 1
MIRT727690 FANCL Fanconi anemia, complementation group L 1 1
MIRT727725 FAM104A family with sequence similarity 104, member A 1 1
MIRT727747 ERLIN1 ER lipid raft associated 1 1 1
MIRT727766 EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) 1 1
MIRT727775 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT727797 EED embryonic ectoderm development 1 1
MIRT727810 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT727831 DYNLT3 dynein, light chain, Tctex-type 3 1 1
MIRT727900 DCTN4 dynactin 4 (p62) 1 1
MIRT727932 CREG1 cellular repressor of E1A-stimulated genes 1 1 1
MIRT727956 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT727980 CLCC1 chloride channel CLIC-like 1 1 1
MIRT728013 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 1
MIRT728050 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT728064 C8orf76 chromosome 8 open reading frame 76 1 1
MIRT728069 C7orf60 chromosome 7 open reading frame 60 1 1
MIRT728078 C7orf43 chromosome 7 open reading frame 43 1 1
MIRT728162 KIAA0226L KIAA0226-like 1 1
MIRT728179 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT728189 BTBD1 BTB (POZ) domain containing 1 1 1
MIRT728211 CFDP1 craniofacial development protein 1 1 1
MIRT728232 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT728243 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT728268 ATM ataxia telangiectasia mutated 1 1
MIRT728345 ANKRA2 ankyrin repeat, family A (RFXANK-like), 2 1 1
MIRT728373 AFF4 AF4/FMR2 family, member 4 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*