Accession ID: MIRT024474 [miRNA, hsa-miR-215-5p :: PPAT, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-215LinkOut: [miRBase ]
Synonyms MIRN215, miRNA215, mir-215, MIR215
Description Homo sapiens miR-215 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-215-5p
Mature Sequence 27| AUGACCUAUGAAUUGACAGAC |47
Evidence Experimental
Experiments Cloned
Putative hsa-miR-215-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol PPAT LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ATASE, GPAT, PRAT
Description phosphoribosyl pyrophosphate amidotransferase
Transcript NM_0027    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on PPAT LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of PPAT
(miRNA target sites are highlighted)
>PPAT|NM_0027|3'UTR
   1 TAGCTGGTAGGGTTGGATGTGTGTAGTTTCAAGATAGAAAGTTGGTCAAGAAGTTATAGTGGTCACACCTCATCTATTTA
  81 CTGTTACTCAGTTGGTACAATGTAAAATGCCATGCTTATGTTTATAAGTTTTGAGATTTTTTTTTTTTCTGAAAAGGATA
 161 CCAAAGTGCGATAACTGAACATTTCCAATTGCATATAATACAACAATATGTGGTGTTCTTTTTTTTACACAAGCATTGGC
 241 TAGCCTTTTTAACCTGGTCAGAGAAGGCAGGTGGTCACTGACATTTCCCAAGTCCATGCTTTAAAGGGTTTGCAAGAAGT
 321 TAGGGTTAAGGAGAGGTGATGCCAACAAGACAGGTGAGTTAAATATACCATTTCACACAAAGTTTGAATAGAATACATTA
 401 TACCTCATAGGTGTCTAGCCTCTACAGTTCTGGCTGTAGTTATGACCTTGGCTTCCCTGTCTAACTGTAGACAAATCTTT
 481 AAAAAAAAATAATAATAATCTGGTGCCTCAGTTTCCCCACATGTGCAATGGGATACTTATTAAATAATTAATAAGAATGT
 561 GAATAAGTGTCATACTTTTGTGATTTGAGCCATCATTTCACTTCTGATTTTAAGACAACTCATGATTGTTAGCTTTCAGA
 641 AAGCTAATGATTGTTAACTTTTTGAAATTAGTTTACAATTAATTAAGATTTCATTATGATGGAAGGAGACATAATTGGCA
 721 GATCTTTGCCATCTCTCTTTGAGATGTCCTAAAAAGGGTTGTAAAAATCTGTGAAAAAGTTTTTCCTACATTTGACTAGA
 801 AAATGTGATCCATAGTATTTAGTGCCCTGATACTATAAGCTCAGCAAGTAACCTGGTACATTTGAAATAAAAACCAAATT
 881 TTTAGATTCAAACAATCCCTTTATCCTTAATTTAATTAATTATCATATGCTTTTTTTAATGAAGTGCTTGATCACTTGCA
 961 AACATATATACATGTAGATGTACATATACATGTACACATACACATAAATATTATTGCAATTAAGTGATCAAGTACAGACA
1041 CAATAGGGGCCAGTTTTGTTTAAGGATCAAAGAGACAACCACTTTGGGGAATTAGTATCAACTTACAATCCAAGTCCAAG
1121 TATCATCTTATAATCACTTTTTTCTACTATATTAAGATCTAATGAATTTGATTTCTTTTTTGAAGTTTTTTCTTGTAACA
1201 TCTGAGATTAGAAGTTTAAGATGACTTGACCCCAAACCTTTGTTTATGTAAGAATTTTTAAACATAAAAGTGTTTGTTTC
1281 TGTTATGTTACCATAATTTGATGTATATAGTGTCCAGATCCATTTAGAAATTTAATATTTATTAATAACTGAAACTGTTT
1361 GTCTTCCTTTGGTATATAGTCTCGCATATTATATTATAGCAGGCCAAGATAAAATTTTGACAGCTCTTTAAGCCCACATG
1441 CAGCAGTGGGTCAGATAACCCTGTGGCAGTGACACGGGCAAATTGGCATTTGAATAAAGCCCTGGGACCACCTCAACATG
1521 CGTAGCCTCTTGTCTTAAATGTACTCCCCATGGCAGCATGGAGGAGGCAAGACCTGTGGGTCAATTTTGAACTGGCCTTA
1601 CTTTGATTTTTAAAACAAGAGACTCAGGGAAAGTACTAAACCAAAATCTCTGATTTTACTTTGCGTTTTCTGTAGTTTTT
1681 GTTTTACTGAGATGCTTTTGTAAAGGAAAATAATACTGTGACAGTTTAGTAATTCTACAGATTCTTAATATTTCTCCATC
1761 ATGGCCTTTTACTTCACAATTTTCTGAAGTCTGAATTCAATTACAATTTTTTTTTACCAATTTAATCTCAAATGTTGTTT
1841 AACTGCTTTAAATTCATATACGTAGAGTATTATAAACTGCAGAGATGAAAAATGTGTTTTCACGGGATTTATATTGTGAA
1921 CTAAACTAAGCCTACTTTTTGTGACTTATTTGTGATGCCTTGTTGATAAATATGTGTAATAAGTATGTTTAAAAAAAAAA
2001 AAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cagaCAGUUAAG--UAUCCAGUa 5'
              | |||  |  :|:||||| 
Target 5' aggaGGCAAGACCTGTGGGTCAa 3'
1562 - 1584 131.00 -9.50
2
miRNA  3' cagACAGUUAAGU-AUCCAGUa 5'
             || ||:  || |:||||| 
Target 5' acaTG-CAG--CAGTGGGTCAg 3'
1436 - 1454 129.00 -10.60
3
miRNA  3' cagaCAG---UUAAGUAU--CCAGUa 5'
              |||   || |:|||  ||||| 
Target 5' gttgGTCAAGAAGTTATAGTGGTCAc 3'
41 - 66 121.00 -11.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-215-5p :: PPAT    [ Functional MTI ]
Validation Method Microarray
Article - Georges, S. A. Biery, M. C. Kim, S. Y. et al.
- Cancer Res, 2008
Cell cycle arrest in response to DNA damage is an important antitumorigenic mechanism. MicroRNAs (miRNAs) were recently shown to play key regulatory roles in cell cycle progression. For example, miR-34a is induced in response to p53 activation and mediates G(1) arrest by down-regulating multiple cell cycle-related transcripts. Here we show that genotoxic stress promotes the p53-dependent up-regulation of the homologous miRNAs miR-192 and miR-215. Like miR-34a, activation of miR-192/215 induces cell cycle arrest, suggesting that multiple miRNA families operate in the p53 network. Furthermore, we define a downstream gene expression signature for miR-192/215 expression, which includes a number of transcripts that regulate G(1) and G(2) checkpoints. Of these transcripts, 18 transcripts are direct targets of miR-192/215, and the observed cell cycle arrest likely results from a cooperative effect among the modulations of these genes by the miRNAs. Our results showing a role for miR-192/215 in cell proliferation combined with recent observations that these miRNAs are underexpressed in primary cancers support the idea that miR-192 and miR-215 function as tumor suppressors.
LinkOut: [PMID: 19074876]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
706 hsa-miR-215-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005583 WNK1 WNK lysine deficient protein kinase 1 4 1
MIRT006340 ACVR2B activin A receptor, type IIB 2 1
MIRT007364 CTNNBIP1 catenin, beta interacting protein 1 2 2
MIRT024255 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 1 1
MIRT024256 MEX3B mex-3 homolog B (C. elegans) 1 1
MIRT024257 CASP7 caspase 7, apoptosis-related cysteine peptidase 1 1
MIRT024258 RNF219 ring finger protein 219 1 1
MIRT024259 GSG2 germ cell associated 2 (haspin) 1 1
MIRT024260 TDP1 tyrosyl-DNA phosphodiesterase 1 1 1
MIRT024261 CMTM6 CKLF-like MARVEL transmembrane domain containing 6 1 1
MIRT024262 EAF1 ELL associated factor 1 1 1
MIRT024263 ATAD2 ATPase family, AAA domain containing 2 1 1
MIRT024264 ENC1 ectodermal-neural cortex 1 (with BTB-like domain) 1 1
MIRT024265 ARHGAP11A Rho GTPase activating protein 11A 1 1
MIRT024266 CPSF6 cleavage and polyadenylation specific factor 6, 68kDa 1 1
MIRT024267 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT024268 ANAPC10 anaphase promoting complex subunit 10 1 1
MIRT024269 RACGAP1P Rac GTPase activating protein 1 pseudogene 1 1
MIRT024270 ARL4C ADP-ribosylation factor-like 4C 1 1
MIRT024271 EGR1 early growth response 1 1 1
MIRT024272 FAM222A chromosome 12 open reading frame 34 1 1
MIRT024273 DTL denticleless homolog (Drosophila) 2 2
MIRT024274 RAD54B RAD54 homolog B (S. cerevisiae) 1 1
MIRT024275 GPANK1 HLA-B associated transcript 4 1 1
MIRT024276 MCM10 minichromosome maintenance complex component 10 1 1
MIRT024277 PIGX phosphatidylinositol glycan anchor biosynthesis, class X 1 1
MIRT024278 TICAM2 toll-like receptor adaptor molecule 2 1 1
MIRT024279 STAMBPL1 STAM binding protein-like 1 1 1
MIRT024280 C1orf112 chromosome 1 open reading frame 112 1 1
MIRT024281 CENPA centromere protein A 1 1
MIRT024282 IQCC IQ motif containing C 1 1
MIRT024283 PHF10 PHD finger protein 10 1 1
MIRT024284 MAPK9 mitogen-activated protein kinase 9 1 1
MIRT024285 THOP1 thimet oligopeptidase 1 1 1
MIRT024286 LAMTOR5 hepatitis B virus x interacting protein 1 1
MIRT024287 KIF15 kinesin family member 15 1 1
MIRT024288 C18orf54 chromosome 18 open reading frame 54 1 1
MIRT024289 ANAPC15 chromosome 11 open reading frame 51 1 1
MIRT024290 PLAU plasminogen activator, urokinase 1 1
MIRT024291 ZNF114 zinc finger protein 114 1 1
MIRT024292 FZD1 frizzled homolog 1 (Drosophila) 1 1
MIRT024293 HESX1 HESX homeobox 1 1 1
MIRT024294 THBD thrombomodulin 1 1
MIRT024295 DIS3L DIS3 mitotic control homolog (S. cerevisiae)-like 1 1
MIRT024296 SLC16A7 solute carrier family 16, member 7 (monocarboxylic acid transporter 2) 1 1
MIRT024297 AKAP7 A kinase (PRKA) anchor protein 7 1 1
MIRT024298 TMEM30A transmembrane protein 30A 1 1
MIRT024299 TBL1X transducin (beta)-like 1X-linked 1 1
MIRT024300 SPAG9 sperm associated antigen 9 1 1
MIRT024301 GPSM2 G-protein signaling modulator 2 (AGS3-like, C. elegans) 1 1
MIRT024302 SEPT10 septin 10 1 1
MIRT024303 GAS2L3 growth arrest-specific 2 like 3 1 1
MIRT024304 METTL9 methyltransferase like 9 1 1
MIRT024305 ZNHIT3 zinc finger, HIT type 3 1 1
MIRT024306 TMED10 transmembrane emp24-like trafficking protein 10 (yeast) 1 1
MIRT024307 FAIM Fas apoptotic inhibitory molecule 1 1
MIRT024308 GPR126 G protein-coupled receptor 126 1 1
MIRT024309 USP12 ubiquitin specific peptidase 12 1 1
MIRT024310 TRIM23 tripartite motif-containing 23 1 1
MIRT024311 FBXO4 F-box protein 4 1 1
MIRT024312 MCM3 minichromosome maintenance complex component 3 1 1
MIRT024313 IQGAP1 IQ motif containing GTPase activating protein 1 1 1
MIRT024314 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 1 1
MIRT024315 MRPL13 mitochondrial ribosomal protein L13 1 1
MIRT024316 GULP1 GULP, engulfment adaptor PTB domain containing 1 1 1
MIRT024317 SGCB sarcoglycan, beta (43kDa dystrophin-associated glycoprotein) 1 1
MIRT024318 MAP6D1 MAP6 domain containing 1 1 1
MIRT024319 CXorf57 chromosome X open reading frame 57 1 1
MIRT024320 LMNB1 lamin B1 1 1
MIRT024321 SOAT1 sterol O-acyltransferase 1 1 1
MIRT024322 PHF6 PHD finger protein 6 1 1
MIRT024323 RHOBTB3 Rho-related BTB domain containing 3 1 1
MIRT024324 CNEP1R1 transmembrane protein 188 1 1
MIRT024325 DEPDC1 DEP domain containing 1 1 1
MIRT024326 FERMT1 fermitin family homolog 1 (Drosophila) 1 1
MIRT024327 ALCAM activated leukocyte cell adhesion molecule 1 1
MIRT024328 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT024329 NCAPH non-SMC condensin I complex, subunit H 1 1
MIRT024330 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 1
MIRT024331 HAUS3 HAUS augmin-like complex, subunit 3 1 1
MIRT024332 SGOL2 shugoshin-like 2 (S. pombe) 1 1
MIRT024333 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT024334 NFKBIZ nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta 1 1
MIRT024335 ARHGAP29 Rho GTPase activating protein 29 1 1
MIRT024336 DNAJC19 DnaJ (Hsp40) homolog, subfamily C, member 19 1 1
MIRT024337 SLC39A8 solute carrier family 39 (zinc transporter), member 8 1 1
MIRT024338 RNASE4 ribonuclease, RNase A family, 4 1 1
MIRT024339 GALNT12 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12) 1 1
MIRT024340 PTBP2 polypyrimidine tract binding protein 2 1 1
MIRT024341 RB1 retinoblastoma 1 1 1
MIRT024342 CTCF CCCTC-binding factor (zinc finger protein) 1 1
MIRT024343 SS18 synovial sarcoma translocation, chromosome 18 1 1
MIRT024344 OSBPL6 oxysterol binding protein-like 6 1 1
MIRT024345 STX7 syntaxin 7 1 1
MIRT024346 CENPK centromere protein K 1 1
MIRT024347 BRCA2 breast cancer 2, early onset 1 1
MIRT024348 LMNB2 lamin B2 1 1
MIRT024349 DHFRL1 dihydrofolate reductase-like 1 1 1
MIRT024350 CEP128 chromosome 14 open reading frame 145 1 1
MIRT024351 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT024352 WDR67 WD repeat domain 67 1 1
MIRT024353 UVRAG UV radiation resistance associated gene 1 1
MIRT024354 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT024355 HYLS1 hydrolethalus syndrome 1 1 1
MIRT024356 TRIM68 tripartite motif-containing 68 1 1
MIRT024357 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 1 1
MIRT024358 RAB2A RAB2A, member RAS oncogene family 1 1
MIRT024359 CUL5 cullin 5 1 1
MIRT024360 RBP7 retinol binding protein 7, cellular 1 1
MIRT024361 MOAP1 modulator of apoptosis 1 1 1
MIRT024362 NCBP1 nuclear cap binding protein subunit 1, 80kDa 1 1
MIRT024363 ASPH aspartate beta-hydroxylase 1 1
MIRT024364 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 1
MIRT024365 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 1 1
MIRT024366 LRP8 low density lipoprotein receptor-related protein 8, apolipoprotein e receptor 1 1
MIRT024367 CREBZF CREB/ATF bZIP transcription factor 1 1
MIRT024368 BTC betacellulin 1 1
MIRT024369 MIS18BP1 chromosome 14 open reading frame 106 1 1
MIRT024370 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 1 1
MIRT024371 C8orf46 chromosome 8 open reading frame 46 1 1
MIRT024372 TMEM2 transmembrane protein 2 1 1
MIRT024373 TRIM59 tripartite motif-containing 59 1 1
MIRT024374 RET ret proto-oncogene 1 1
MIRT024375 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT024376 UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT024377 MT1F metallothionein 1F 1 1
MIRT024378 FBN1 fibrillin 1 1 1
MIRT024379 MFI2 antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 1 1
MIRT024380 KCNS3 potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 1 1
MIRT024381 ZNF215 zinc finger protein 215 1 1
MIRT024382 C1orf198 chromosome 1 open reading frame 198 1 1
MIRT024383 MED22 mediator complex subunit 22 1 1
MIRT024384 HADH hydroxyacyl-CoA dehydrogenase 1 1
MIRT024385 TOP1 topoisomerase (DNA) I 1 1
MIRT024386 SKA1 spindle and kinetochore associated complex subunit 1 1 1
MIRT024387 KIF24 kinesin family member 24 1 1
MIRT024388 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT024389 PRPS2 phosphoribosyl pyrophosphate synthetase 2 1 1
MIRT024390 SAYSD1 chromosome 6 open reading frame 64 1 1
MIRT024391 SEMA4D sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D 1 1
MIRT024392 SERTAD4 SERTA domain containing 4 1 1
MIRT024393 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT024394 TMEM164 transmembrane protein 164 1 1
MIRT024395 FBXW2 F-box and WD repeat domain containing 2 1 1
MIRT024396 WWC3 WWC family member 3 1 1
MIRT024397 KHDRBS3 KH domain containing, RNA binding, signal transduction associated 3 1 1
MIRT024398 C5orf30 chromosome 5 open reading frame 30 1 1
MIRT024399 C4orf32 chromosome 4 open reading frame 32 1 1
MIRT024400 MCM9 minichromosome maintenance complex component 9 1 1
MIRT024401 TCHP trichoplein, keratin filament binding 1 1
MIRT024402 DNAJB5 DnaJ (Hsp40) homolog, subfamily B, member 5 1 1
MIRT024403 CDC14A CDC14 cell division cycle 14 homolog A (S. cerevisiae) 1 1
MIRT024404 RNFT1 ring finger protein, transmembrane 1 1 1
MIRT024405 IL1R1 interleukin 1 receptor, type I 1 1
MIRT024406 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT024407 CORO2B coronin, actin binding protein, 2B 1 1
MIRT024408 EPDR1 ependymin related protein 1 (zebrafish) 1 1
MIRT024409 RAD1 RAD1 homolog (S. pombe) 1 1
MIRT024410 TPM4 tropomyosin 4 1 1
MIRT024411 SIX4 SIX homeobox 4 1 1
MIRT024412 GABPB1 GA binding protein transcription factor, beta subunit 1 1 1
MIRT024413 NREP chromosome 5 open reading frame 13 1 1
MIRT024414 PPARG peroxisome proliferator-activated receptor gamma 1 1
MIRT024415 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT024416 EMC7 chromosome 15 open reading frame 24 1 1
MIRT024417 CCZ1 chromosome 7 open reading frame 28A 1 1
MIRT024418 ZNF701 zinc finger protein 701 1 1
MIRT024419 CCZ1B chromosome 7 open reading frame 28B 1 1
MIRT024420 EXTL2 exostoses (multiple)-like 2 1 1
MIRT024421 FEN1 flap structure-specific endonuclease 1 1 1
MIRT024422 SLC46A3 solute carrier family 46, member 3 1 1
MIRT024423 PIM1 pim-1 oncogene 1 1
MIRT024424 PRNP prion protein 1 1
MIRT024425 MAN2A2 mannosidase, alpha, class 2A, member 2 1 1
MIRT024426 C17orf58 chromosome 17 open reading frame 58 1 1
MIRT024427 CENPI centromere protein I 1 1
MIRT024428 FZD7 frizzled homolog 7 (Drosophila) 1 1
MIRT024429 SLC26A2 solute carrier family 26 (sulfate transporter), member 2 1 1
MIRT024430 PRDM4 PR domain containing 4 1 1
MIRT024431 PIP4K2B phosphatidylinositol-5-phosphate 4-kinase, type II, beta 1 1
MIRT024432 GPC4 glypican 4 1 1
MIRT024433 ATAD1 ATPase family, AAA domain containing 1 1 1
MIRT024434 IL6ST interleukin 6 signal transducer (gp130, oncostatin M receptor) 1 1
MIRT024435 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT024436 CCDC15 coiled-coil domain containing 15 1 1
MIRT024437 ZDHHC23 zinc finger, DHHC-type containing 23 1 1
MIRT024438 GATAD1 GATA zinc finger domain containing 1 1 1
MIRT024439 VASH2 vasohibin 2 1 1
MIRT024440 CCNE1 cyclin E1 1 1
MIRT024441 RFC4 replication factor C (activator 1) 4, 37kDa 1 1
MIRT024442 KCTD12 potassium channel tetramerisation domain containing 12 1 1
MIRT024443 HJURP Holliday junction recognition protein 1 1
MIRT024444 OPA1 optic atrophy 1 (autosomal dominant) 1 1
MIRT024445 TRPV1 transient receptor potential cation channel, subfamily V, member 1 1 1
MIRT024446 CKLF chemokine-like factor 1 1
MIRT024447 KLHL23 kelch-like 23 (Drosophila) 1 1
MIRT024448 SMARCB1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 1 1
MIRT024449 MYB v-myb myeloblastosis viral oncogene homolog (avian) 1 1
MIRT024450 CDK14 cyclin-dependent kinase 14 1 1
MIRT024451 SRD5A1 steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1) 1 1
MIRT024452 ACADSB acyl-CoA dehydrogenase, short/branched chain 1 1
MIRT024453 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT024454 UNG uracil-DNA glycosylase 1 1
MIRT024455 EMC1 KIAA0090 1 1
MIRT024456 SLC16A14 solute carrier family 16, member 14 (monocarboxylic acid transporter 14) 1 1
MIRT024457 TTPA tocopherol (alpha) transfer protein 1 1
MIRT024458 INPP5F inositol polyphosphate-5-phosphatase F 1 1
MIRT024459 NPHP3 nephronophthisis 3 (adolescent) 1 1
MIRT024460 APOLD1 apolipoprotein L domain containing 1 1 1
MIRT024461 EFCAB11 chromosome 14 open reading frame 143 1 1
MIRT024462 SEC24D SEC24 family, member D (S. cerevisiae) 1 1
MIRT024463 PSRC1 proline/serine-rich coiled-coil 1 1 1
MIRT024464 NPTXR neuronal pentraxin receptor 1 1
MIRT024465 GINM1 chromosome 6 open reading frame 72 1 1
MIRT024466 GAB2 GRB2-associated binding protein 2 1 1
MIRT024467 ALG10 asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe) 1 1
MIRT024468 NAB1 NGFI-A binding protein 1 (EGR1 binding protein 1) 1 1
MIRT024469 ZMYND11 zinc finger, MYND domain containing 11 1 1
MIRT024470 HBEGF heparin-binding EGF-like growth factor 1 1
MIRT024471 RMI1 RMI1, RecQ mediated genome instability 1, homolog (S. cerevisiae) 1 1
MIRT024472 ANKRD6 ankyrin repeat domain 6 1 1
MIRT024473 C1QTNF3 C1q and tumor necrosis factor related protein 3 1 1
MIRT024474 PPAT phosphoribosyl pyrophosphate amidotransferase 1 1
MIRT024475 IL17RB interleukin 17 receptor B 1 1
MIRT024476 ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 1 1
MIRT024477 KIF14 kinesin family member 14 1 1
MIRT024478 TNFSF12 tumor necrosis factor (ligand) superfamily, member 12 1 1
MIRT024479 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT024480 MXI1 MAX interactor 1 1 1
MIRT024481 MIB1 mindbomb homolog 1 (Drosophila) 1 1
MIRT024482 SMC2 structural maintenance of chromosomes 2 1 1
MIRT024483 USP54 ubiquitin specific peptidase 54 1 1
MIRT024484 AHSA2 AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) 1 1
MIRT024485 ELOVL1 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 1 1
MIRT024486 CASC5 cancer susceptibility candidate 5 1 1
MIRT024487 PCSK9 proprotein convertase subtilisin/kexin type 9 1 1
MIRT024488 C1D C1D nuclear receptor corepressor 1 1
MIRT024489 TMPO thymopoietin 1 1
MIRT024490 CENPE centromere protein E, 312kDa 1 1
MIRT024491 MMP20 matrix metallopeptidase 20 1 1
MIRT024492 MRPL50 mitochondrial ribosomal protein L50 1 1
MIRT024493 ERCC3 excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing) 1 1
MIRT024494 BCL2 B-cell CLL/lymphoma 2 1 1
MIRT024495 SYNGR1 synaptogyrin 1 1 1
MIRT024496 KIF23 kinesin family member 23 1 1
MIRT024497 ZBTB14 zinc finger protein 161 homolog (mouse) 1 1
MIRT024498 ST3GAL6 ST3 beta-galactoside alpha-2,3-sialyltransferase 6 1 1
MIRT024499 EML1 echinoderm microtubule associated protein like 1 1 1
MIRT024500 MTDH metadherin 1 1
MIRT024501 POU2F1 POU class 2 homeobox 1 1 1
MIRT024502 TUBGCP3 tubulin, gamma complex associated protein 3 1 1
MIRT024503 COPS7A COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) 1 1
MIRT024504 PLOD1 procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1 1 1
MIRT024505 GPR19 G protein-coupled receptor 19 1 1
MIRT024506 B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) 1 1
MIRT024507 FAM178A family with sequence similarity 178, member A 1 1
MIRT024508 NKRF NFKB repressing factor 1 1
MIRT024509 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 1 1
MIRT024510 ZBTB18 zinc finger protein 238 1 1
MIRT024511 FAM83D family with sequence similarity 83, member D 1 1
MIRT024512 STAM signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 1 1
MIRT024513 CCDC150 coiled-coil domain containing 150 1 1
MIRT024514 ARFGEF1 ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited) 1 1
MIRT024515 CKAP4 cytoskeleton-associated protein 4 1 1
MIRT024516 PGM3 phosphoglucomutase 3 1 1
MIRT024517 DICER1 dicer 1, ribonuclease type III 1 1
MIRT024518 CDKN3 cyclin-dependent kinase inhibitor 3 1 1
MIRT024519 BRIP1 BRCA1 interacting protein C-terminal helicase 1 1 1
MIRT024520 EME1 essential meiotic endonuclease 1 homolog 1 (S. pombe) 1 1
MIRT024521 CENPF centromere protein F, 350/400ka (mitosin) 1 1
MIRT024522 RAB6C RAB6C, member RAS oncogene family 1 1
MIRT024523 BRCA1 breast cancer 1, early onset 1 1
MIRT024524 FBXO25 F-box protein 25 1 1
MIRT024525 NSF N-ethylmaleimide-sensitive factor 1 1
MIRT024526 ZSWIM3 zinc finger, SWIM-type containing 3 1 1
MIRT024527 UBE2D2 ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast) 1 1
MIRT024528 TRPC1 transient receptor potential cation channel, subfamily C, member 1 1 1
MIRT024529 CCDC176 chromosome 14 open reading frame 45 1 1
MIRT024530 CDKN2D cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) 1 1
MIRT024531 PIGM phosphatidylinositol glycan anchor biosynthesis, class M 1 1
MIRT024532 SOWAHC ankyrin repeat domain 57 1 1
MIRT024533 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT024534 TOR3A torsin family 3, member A 1 1
MIRT024535 MDC1 mediator of DNA-damage checkpoint 1 1 1
MIRT024536 THEM6 chromosome 8 open reading frame 55 1 1
MIRT024537 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative function) 1 1
MIRT024538 OTUB2 OTU domain, ubiquitin aldehyde binding 2 1 1
MIRT024539 COBLL1 COBL-like 1 1 1
MIRT024540 UPP1 uridine phosphorylase 1 1 1
MIRT024541 C10orf35 chromosome 10 open reading frame 35 1 1
MIRT024542 NEDD1 neural precursor cell expressed, developmentally down-regulated 1 1 1
MIRT024543 RECQL RecQ protein-like (DNA helicase Q1-like) 1 1
MIRT024544 CCNO cyclin O 1 1
MIRT024545 TMEM169 transmembrane protein 169 1 1
MIRT024546 XIAP X-linked inhibitor of apoptosis 1 1
MIRT024547 C2orf44 chromosome 2 open reading frame 44 1 1
MIRT024548 ZNF184 zinc finger protein 184 1 1
MIRT024549 TMEM106A transmembrane protein 106A 1 1
MIRT024550 NMU neuromedin U 1 1
MIRT024551 NUDT15 nudix (nucleoside diphosphate linked moiety X)-type motif 15 1 1
MIRT024552 ARHGEF26 Src homology 3 domain-containing guanine nucleotide exchange factor 1 1
MIRT024553 DEGS1 degenerative spermatocyte homolog 1, lipid desaturase (Drosophila) 1 1
MIRT024554 TRAIP TRAF interacting protein 1 1
MIRT024555 RPAP2 RNA polymerase II associated protein 2 1 1
MIRT024556 DSN1 DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT024557 TEX30 chromosome 13 open reading frame 27 1 1
MIRT024558 CNTNAP3 contactin associated protein-like 3 1 1
MIRT024559 NT5M 5',3'-nucleotidase, mitochondrial 1 1
MIRT024560 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 1 1
MIRT024561 PRADC1 chromosome 2 open reading frame 7 1 1
MIRT024562 C9orf163 chromosome 9 open reading frame 163 1 1
MIRT024563 NLK nemo-like kinase 1 1
MIRT024564 TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b 1 1
MIRT024565 PABPC4 poly(A) binding protein, cytoplasmic 4 (inducible form) 1 1
MIRT024566 NCOA3 nuclear receptor coactivator 3 1 1
MIRT024567 IL7 interleukin 7 1 1
MIRT024568 KAT2B K(lysine) acetyltransferase 2B 1 1
MIRT024569 DLG5 discs, large homolog 5 (Drosophila) 1 1
MIRT024570 ASRGL1 asparaginase like 1 1 1
MIRT024571 DEAF1 deformed epidermal autoregulatory factor 1 (Drosophila) 1 1
MIRT024572 PAPD7 PAP associated domain containing 7 1 1
MIRT024573 PITPNB phosphatidylinositol transfer protein, beta 1 1
MIRT024574 PTPRE protein tyrosine phosphatase, receptor type, E 1 1
MIRT024575 LRIG1 leucine-rich repeats and immunoglobulin-like domains 1 1 1
MIRT024576 WWC2 WW and C2 domain containing 2 1 1
MIRT024577 APC adenomatous polyposis coli 1 1
MIRT024578 FAM126B family with sequence similarity 126, member B 1 1
MIRT024579 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 1
MIRT024580 UBE2W ubiquitin-conjugating enzyme E2W (putative) 1 1
MIRT024581 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 1
MIRT024582 HINT3 histidine triad nucleotide binding protein 3 1 1
MIRT024583 SMC4 structural maintenance of chromosomes 4 1 1
MIRT024584 ZNF346 zinc finger protein 346 1 1
MIRT024585 HIBADH 3-hydroxyisobutyrate dehydrogenase 1 1
MIRT024586 CCDC121 coiled-coil domain containing 121 1 1
MIRT024587 SNX10 sorting nexin 10 1 1
MIRT024588 LIPA lipase A, lysosomal acid, cholesterol esterase 1 1
MIRT024589 MCAM melanoma cell adhesion molecule 1 1
MIRT024590 RAP1GAP RAP1 GTPase activating protein 1 1
MIRT024591 PTS 6-pyruvoyltetrahydropterin synthase 1 1
MIRT024592 PRKD3 protein kinase D3 1 1
MIRT024593 FAM189A2 family with sequence similarity 189, member A2 1 1
MIRT024594 REEP1 receptor accessory protein 1 1 1
MIRT024595 CUZD1 CUB and zona pellucida-like domains 1 1 1
MIRT024596 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT024597 UCK1 uridine-cytidine kinase 1 1 1
MIRT024598 UGT8 UDP glycosyltransferase 8 1 1
MIRT024599 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT024600 CD164 CD164 molecule, sialomucin 1 1
MIRT024601 ZNF267 zinc finger protein 267 1 1
MIRT024602 USP1 ubiquitin specific peptidase 1 1 1
MIRT024603 BIVM basic, immunoglobulin-like variable motif containing 1 1
MIRT024604 PARN poly(A)-specific ribonuclease (deadenylation nuclease) 1 1
MIRT024605 PRSS23 protease, serine, 23 1 1
MIRT024606 NUF2 NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT024607 C10orf137 chromosome 10 open reading frame 137 1 1
MIRT024608 PCOLCE2 procollagen C-endopeptidase enhancer 2 1 1
MIRT024609 BUB1B budding uninhibited by benzimidazoles 1 homolog beta (yeast) 1 1
MIRT024610 PRICKLE1 prickle homolog 1 (Drosophila) 1 1
MIRT024611 ZIC5 Zic family member 5 (odd-paired homolog, Drosophila) 1 1
MIRT024612 NOD2 nucleotide-binding oligomerization domain containing 2 1 1
MIRT024613 DIMT1 DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) 1 1
MIRT024614 AP1S2 adaptor-related protein complex 1, sigma 2 subunit 1 1
MIRT024615 ZNF200 zinc finger protein 200 1 1
MIRT024616 FUBP1 far upstream element (FUSE) binding protein 1 1 1
MIRT024617 ANG angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT024618 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT024619 TRIP13 thyroid hormone receptor interactor 13 1 1
MIRT024620 CGNL1 cingulin-like 1 1 1
MIRT024621 SAP30 Sin3A-associated protein, 30kDa 1 1
MIRT024622 LEAP2 liver expressed antimicrobial peptide 2 1 1
MIRT024623 MAD2L1 MAD2 mitotic arrest deficient-like 1 (yeast) 1 1
MIRT024624 ALDH5A1 aldehyde dehydrogenase 5 family, member A1 1 1
MIRT024625 LOC81691 exonuclease NEF-sp 1 1
MIRT024626 RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) 1 1
MIRT024627 FBXO5 F-box protein 5 1 1
MIRT024628 HMMR hyaluronan-mediated motility receptor (RHAMM) 1 1
MIRT024629 CEP19 chromosome 3 open reading frame 34 1 1
MIRT024630 IL1RAP interleukin 1 receptor accessory protein 1 1
MIRT024631 KBTBD11 kelch repeat and BTB (POZ) domain containing 11 1 1
MIRT024632 FAM171B family with sequence similarity 171, member B 1 1
MIRT024633 CLK1 CDC-like kinase 1 1 1
MIRT024634 ATF1 activating transcription factor 1 1 1
MIRT024635 CCL3L3 chemokine (C-C motif) ligand 3-like 3 1 1
MIRT024636 HES6 hairy and enhancer of split 6 (Drosophila) 1 1
MIRT024637 WDR47 WD repeat domain 47 1 1
MIRT024638 TMEM180 transmembrane protein 180 1 1
MIRT024639 FZD4 frizzled homolog 4 (Drosophila) 1 1
MIRT024640 EAF2 ELL associated factor 2 1 1
MIRT024641 GEN1 Gen homolog 1, endonuclease (Drosophila) 1 1
MIRT024642 NBN nibrin 1 1
MIRT024643 CDC20 cell division cycle 20 homolog (S. cerevisiae) 1 1
MIRT024644 FOXA1 forkhead box A1 1 1
MIRT024645 CHML choroideremia-like (Rab escort protein 2) 1 1
MIRT024646 CYP24A1 cytochrome P450, family 24, subfamily A, polypeptide 1 1 1
MIRT024647 KLHL8 kelch-like 8 (Drosophila) 1 1
MIRT024648 BBS7 Bardet-Biedl syndrome 7 1 1
MIRT024649 ELL2 elongation factor, RNA polymerase II, 2 1 1
MIRT024650 DBT dihydrolipoamide branched chain transacylase E2 1 1
MIRT024651 HNF1B HNF1 homeobox B 1 1
MIRT024652 RUFY3 RUN and FYVE domain containing 3 1 1
MIRT024653 CCNY cyclin Y 1 1
MIRT024654 LIN9 lin-9 homolog (C. elegans) 1 1
MIRT024655 RAB11FIP2 RAB11 family interacting protein 2 (class I) 1 1
MIRT024656 ZFP1 zinc finger protein 1 homolog (mouse) 1 1
MIRT024657 DYRK1A dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A 1 1
MIRT024658 HOXA13 homeobox A13 1 1
MIRT024659 ECT2 epithelial cell transforming sequence 2 oncogene 1 1
MIRT024660 RFWD3 ring finger and WD repeat domain 3 1 1
MIRT024661 CSGALNACT2 chondroitin sulfate N-acetylgalactosaminyltransferase 2 1 1
MIRT024662 EFNB2 ephrin-B2 1 1
MIRT024663 TMEM246 chromosome 9 open reading frame 125 1 1
MIRT024664 INIP chromosome 9 open reading frame 80 1 1
MIRT024665 DST dystonin 1 1
MIRT024666 ZMAT3 zinc finger, matrin type 3 1 1
MIRT024667 XK X-linked Kx blood group (McLeod syndrome) 1 1
MIRT024668 DEK DEK oncogene 1 1
MIRT024669 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT024670 ZNF45 zinc finger protein 45 1 1
MIRT024671 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT024672 WNT3 wingless-type MMTV integration site family, member 3 1 1
MIRT024673 HSPBAP1 HSPB (heat shock 27kDa) associated protein 1 1 1
MIRT024674 PSMC3IP PSMC3 interacting protein 1 1
MIRT024675 ERMP1 endoplasmic reticulum metallopeptidase 1 1 1
MIRT024676 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 1 1
MIRT024677 FBXO36 F-box protein 36 1 1
MIRT024678 DDX50 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 1 1
MIRT024679 CAMK4 calcium/calmodulin-dependent protein kinase IV 1 1
MIRT024680 SLC39A9 solute carrier family 39 (zinc transporter), member 9 1 1
MIRT024681 GPR180 G protein-coupled receptor 180 1 1
MIRT024682 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT024683 UBE2D1 ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) 1 1
MIRT024684 ATG10 ATG10 autophagy related 10 homolog (S. cerevisiae) 1 1
MIRT024685 RAB1A RAB1A, member RAS oncogene family 1 1
MIRT024686 ASPM asp (abnormal spindle) homolog, microcephaly associated (Drosophila) 1 1
MIRT024687 IRX4 iroquois homeobox 4 1 1
MIRT024688 MIPOL1 mirror-image polydactyly 1 1 1
MIRT024689 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 1
MIRT024690 TROAP trophinin associated protein (tastin) 1 1
MIRT024691 LRRCC1 leucine rich repeat and coiled-coil domain containing 1 1 1
MIRT024692 DBF4B DBF4 homolog B (S. cerevisiae) 1 1
MIRT024693 RSRC1 arginine/serine-rich coiled-coil 1 1 1
MIRT024694 CHM choroideremia (Rab escort protein 1) 1 1
MIRT024695 MRPL43 mitochondrial ribosomal protein L43 1 1
MIRT024696 USP14 ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) 1 1
MIRT024697 LSM14B LSM14B, SCD6 homolog B (S. cerevisiae) 1 1
MIRT024698 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT024699 ZNF449 zinc finger protein 449 1 1
MIRT024700 CA8 carbonic anhydrase VIII 1 1
MIRT024701 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT024702 NOB1 NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) 1 1
MIRT024703 CCDC47 coiled-coil domain containing 47 1 1
MIRT024704 ZNF248 zinc finger protein 248 1 1
MIRT024705 PPP1CA protein phosphatase 1, catalytic subunit, alpha isozyme 1 1
MIRT024706 LYRM7 Lyrm7 homolog (mouse) 1 1
MIRT024707 PSMD6 proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 1 1
MIRT024708 SPRY4 sprouty homolog 4 (Drosophila) 1 1
MIRT024709 RAB3B RAB3B, member RAS oncogene family 1 1
MIRT024710 C1orf86 chromosome 1 open reading frame 86 1 1
MIRT024711 SCMH1 sex comb on midleg homolog 1 (Drosophila) 1 1
MIRT024712 DCP1A DCP1 decapping enzyme homolog A (S. cerevisiae) 1 1
MIRT024713 KLF10 Kruppel-like factor 10 1 1
MIRT024714 PMF1 polyamine-modulated factor 1 1 1
MIRT024715 OSBPL10 oxysterol binding protein-like 10 1 1
MIRT024716 SCRN3 secernin 3 1 1
MIRT024717 B4GALT6 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 1 1
MIRT024718 KIF20A kinesin family member 20A 1 1
MIRT024719 RIC8B resistance to inhibitors of cholinesterase 8 homolog B (C. elegans) 1 1
MIRT024720 SNX13 sorting nexin 13 1 1
MIRT024721 ICK intestinal cell (MAK-like) kinase 1 1
MIRT024722 ZNF385B zinc finger protein 385B 1 1
MIRT024723 ATP5L ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G 1 1
MIRT024724 SLC39A1 solute carrier family 39 (zinc transporter), member 1 1 1
MIRT024725 TAF9B TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa 1 1
MIRT024726 KDM4D lysine (K)-specific demethylase 4D 1 1
MIRT024727 TBC1D22B TBC1 domain family, member 22B 1 1
MIRT024728 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT024729 KIFC1 kinesin family member C1 1 1
MIRT024730 HSPA2 heat shock 70kDa protein 2 1 1
MIRT024731 NMI N-myc (and STAT) interactor 1 1
MIRT024732 FGF2 fibroblast growth factor 2 (basic) 1 1
MIRT024733 MPZL1 myelin protein zero-like 1 1 1
MIRT024734 IRAK4 interleukin-1 receptor-associated kinase 4 1 1
MIRT024735 ZFP30 zinc finger protein 30 homolog (mouse) 1 1
MIRT024736 ANKRD32 ankyrin repeat domain 32 1 1
MIRT024737 TDG thymine-DNA glycosylase 1 1
MIRT024738 PLK4 polo-like kinase 4 (Drosophila) 1 1
MIRT024739 KCNMB4 potassium large conductance calcium-activated channel, subfamily M, beta member 4 1 1
MIRT024740 TJP2 tight junction protein 2 (zona occludens 2) 1 1
MIRT024741 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT024742 GNRH1 gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) 1 1
MIRT024743 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 1
MIRT024744 GPR37 G protein-coupled receptor 37 (endothelin receptor type B-like) 1 1
MIRT024745 ROPN1L ropporin 1-like 1 1
MIRT024746 SLC16A6 solute carrier family 16, member 6 (monocarboxylic acid transporter 7) 1 1
MIRT024747 BCOR BCL6 corepressor 1 1
MIRT024748 C12orf65 chromosome 12 open reading frame 65 1 1
MIRT024749 KIF5C kinesin family member 5C 1 1
MIRT024750 SLC25A51 mitochondrial carrier triple repeat 1 1 1
MIRT024751 CKAP2L cytoskeleton associated protein 2-like 1 1
MIRT024752 TIFA TRAF-interacting protein with forkhead-associated domain 1 1
MIRT024753 ZNF273 zinc finger protein 273 1 1
MIRT024754 PARM1 prostate androgen-regulated mucin-like protein 1 1 1
MIRT024755 CDC7 cell division cycle 7 homolog (S. cerevisiae) 1 1
MIRT024756 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT024757 UACA uveal autoantigen with coiled-coil domains and ankyrin repeats 1 1
MIRT024758 UBASH3B ubiquitin associated and SH3 domain containing B 1 1
MIRT024759 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT024760 SGPP1 sphingosine-1-phosphate phosphatase 1 1 1
MIRT024761 TMEM200B transmembrane protein 200B 1 1
MIRT024762 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 1 1
MIRT024763 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT024764 ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 1 1
MIRT024765 LARP1B La ribonucleoprotein domain family, member 1B 1 1
MIRT024766 PAWR PRKC, apoptosis, WT1, regulator 1 1
MIRT024767 PLEKHF2 pleckstrin homology domain containing, family F (with FYVE domain) member 2 1 1
MIRT024768 HOXB9 homeobox B9 1 1
MIRT024769 ZNF652 zinc finger protein 652 1 1
MIRT024770 HAS3 hyaluronan synthase 3 1 1
MIRT024771 BORA chromosome 13 open reading frame 34 1 1
MIRT024772 PPP1R12A protein phosphatase 1, regulatory (inhibitor) subunit 12A 1 1
MIRT024773 RAB27A RAB27A, member RAS oncogene family 1 1
MIRT024774 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT024775 EEF1A2 eukaryotic translation elongation factor 1 alpha 2 1 1
MIRT024776 KIF5B kinesin family member 5B 1 1
MIRT024777 TMEM66 transmembrane protein 66 1 1
MIRT024778 CCDC174 chromosome 3 open reading frame 19 1 1
MIRT024779 RAD21 RAD21 homolog (S. pombe) 1 1
MIRT024780 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT024781 MSN moesin 1 1
MIRT024782 CLK4 CDC-like kinase 4 1 1
MIRT024783 SH3BP4 SH3-domain binding protein 4 1 1
MIRT024784 PPP1R26 KIAA0649 1 1
MIRT024785 ATG4A ATG4 autophagy related 4 homolog A (S. cerevisiae) 1 1
MIRT024786 TFCP2L1 transcription factor CP2-like 1 1 1
MIRT024787 FOXD1 forkhead box D1 1 1
MIRT024788 FADS1 fatty acid desaturase 1 1 1
MIRT024789 ZNF226 zinc finger protein 226 1 1
MIRT024790 NOL12 nucleolar protein 12 1 1
MIRT024791 SFR1 chromosome 10 open reading frame 78 1 1
MIRT024792 DLGAP5 discs, large (Drosophila) homolog-associated protein 5 1 1
MIRT024793 CHPT1 choline phosphotransferase 1 1 1
MIRT024794 SLC35F3 solute carrier family 35, member F3 1 1
MIRT024795 ORC1 origin recognition complex, subunit 1-like (yeast) 1 1
MIRT024796 CHSY3 chondroitin sulfate synthase 3 1 1
MIRT024797 MTERFD1 MTERF domain containing 1 1 1
MIRT024798 ZNF519 zinc finger protein 519 1 1
MIRT024799 USP18 ubiquitin specific peptidase 18 1 1
MIRT024800 SERAC1 serine active site containing 1 1 1
MIRT024801 ARHGEF40 protein SOLO 1 1
MIRT024802 RADIL Ras association and DIL domains 1 1
MIRT024803 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT024804 NCEH1 neutral cholesterol ester hydrolase 1 1 1
MIRT024805 GATM glycine amidinotransferase (L-arginine:glycine amidinotransferase) 1 1
MIRT024806 FAM20B family with sequence similarity 20, member B 1 1
MIRT024807 TMEFF1 transmembrane protein with EGF-like and two follistatin-like domains 1 1 1
MIRT024808 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT024809 GFOD1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT024810 TMTC2 transmembrane and tetratricopeptide repeat containing 2 1 1
MIRT024811 PIF1 PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae) 1 1
MIRT024812 AP3M2 adaptor-related protein complex 3, mu 2 subunit 1 1
MIRT024813 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 1
MIRT024814 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT024815 ELOVL5 ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) 1 1
MIRT024816 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT024817 COCH coagulation factor C homolog, cochlin (Limulus polyphemus) 1 1
MIRT024818 PRPF38A PRP38 pre-mRNA processing factor 38 (yeast) domain containing A 1 1
MIRT024819 PDLIM3 PDZ and LIM domain 3 1 1
MIRT024820 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT024821 KIF18A kinesin family member 18A 1 1
MIRT024822 HOXA10 homeobox A10 1 1
MIRT024823 LMAN1 lectin, mannose-binding, 1 1 1
MIRT024824 OSBPL8 oxysterol binding protein-like 8 1 1
MIRT024825 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT024826 PPP2R3B protein phosphatase 2, regulatory subunit B', beta 1 1
MIRT024827 PKP4 plakophilin 4 1 1
MIRT024828 CEP55 centrosomal protein 55kDa 1 1
MIRT024829 SLC48A1 solute carrier family 48 (heme transporter), member 1 1 1
MIRT024830 TOPBP1 topoisomerase (DNA) II binding protein 1 1 1
MIRT024831 NEIL3 nei endonuclease VIII-like 3 (E. coli) 1 1
MIRT024832 STIL SCL/TAL1 interrupting locus 1 1
MIRT024833 CLVS1 clavesin 1 1 1
MIRT024834 ZNF443 zinc finger protein 443 1 1
MIRT024835 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT024836 PLS3 plastin 3 1 1
MIRT024837 TCF7 transcription factor 7 (T-cell specific, HMG-box) 1 1
MIRT024838 ATAD5 ATPase family, AAA domain containing 5 1 1
MIRT024839 RTKN2 rhotekin 2 1 1
MIRT024840 SH2B3 SH2B adaptor protein 3 1 1
MIRT024841 CDCA4 cell division cycle associated 4 1 1
MIRT024842 FAXC chromosome 6 open reading frame 168 1 1
MIRT024843 ZNF85 zinc finger protein 85 1 1
MIRT024844 HIATL1 hippocampus abundant transcript-like 1 1 1
MIRT024845 C8orf47 chromosome 8 open reading frame 47 1 1
MIRT024846 ZNF611 zinc finger protein 611 1 1
MIRT024847 MANF mesencephalic astrocyte-derived neurotrophic factor 1 1
MIRT024848 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT024849 IDI1 isopentenyl-diphosphate delta isomerase 1 1 1
MIRT024850 PLCE1 phospholipase C, epsilon 1 1 1
MIRT024851 PERP PERP, TP53 apoptosis effector 1 1
MIRT024852 MKL2 MKL/myocardin-like 2 1 1
MIRT024853 TOR1B torsin family 1, member B (torsin B) 1 1
MIRT024854 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT024855 ZNF230 zinc finger protein 230 1 1
MIRT024856 SLC1A4 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 1 1
MIRT024857 PHTF2 putative homeodomain transcription factor 2 1 1
MIRT024858 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 1
MIRT024859 MEIS2 Meis homeobox 2 1 1
MIRT024860 LGMN legumain 1 1
MIRT024861 SLC35G1 transmembrane protein 20 1 1
MIRT024862 CLN6 ceroid-lipofuscinosis, neuronal 6, late infantile, variant 1 1
MIRT024863 NUFIP1 nuclear fragile X mental retardation protein interacting protein 1 1 1
MIRT024864 MTMR12 myotubularin related protein 12 1 1
MIRT024865 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT024866 PHTF1 putative homeodomain transcription factor 1 1 1
MIRT024867 TICRR chromosome 15 open reading frame 42 1 1
MIRT024868 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme 1 1
MIRT024869 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT024870 CD83 CD83 molecule 1 1
MIRT024871 CLSPN claspin homolog (Xenopus laevis) 1 1
MIRT024872 ITGAV integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) 1 1
MIRT024873 CIB2 calcium and integrin binding family member 2 1 1
MIRT024874 EIF2AK3 eukaryotic translation initiation factor 2-alpha kinase 3 1 1
MIRT024875 ERCC6L excision repair cross-complementing rodent repair deficiency, complementation group 6-like 1 1
MIRT024876 RNASEL ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) 1 1
MIRT024877 VPS13C vacuolar protein sorting 13 homolog C (S. cerevisiae) 1 1
MIRT024878 COQ3 coenzyme Q3 homolog, methyltransferase (S. cerevisiae) 1 1
MIRT024879 MCM6 minichromosome maintenance complex component 6 1 1
MIRT024880 STK3 serine/threonine kinase 3 (STE20 homolog, yeast) 1 1
MIRT024881 TCEB3 transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A) 1 1
MIRT024882 G2E3 G2/M-phase specific E3 ubiquitin ligase 1 1
MIRT024883 NKX3-1 NK3 homeobox 1 1 1
MIRT024884 IMPA1 inositol(myo)-1(or 4)-monophosphatase 1 1 1
MIRT024885 ZDHHC2 zinc finger, DHHC-type containing 2 1 1
MIRT024886 TTF2 transcription termination factor, RNA polymerase II 1 1
MIRT024887 CTH cystathionase (cystathionine gamma-lyase) 1 1
MIRT024888 CFL2 cofilin 2 (muscle) 1 1
MIRT024889 EPS8 epidermal growth factor receptor pathway substrate 8 1 1
MIRT024890 CCDC14 coiled-coil domain containing 14 1 1
MIRT024891 GCH1 GTP cyclohydrolase 1 1 1
MIRT024892 UBL3 ubiquitin-like 3 1 1
MIRT024893 TMTC4 transmembrane and tetratricopeptide repeat containing 4 1 1
MIRT024894 AGL amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase 1 1
MIRT024895 TTK TTK protein kinase 1 1
MIRT024896 NUCB2 nucleobindin 2 1 1
MIRT024897 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa 1 1
MIRT024898 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT024899 BCL2L13 BCL2-like 13 (apoptosis facilitator) 1 1
MIRT024900 TRIB3 tribbles homolog 3 (Drosophila) 1 1
MIRT024901 LARS leucyl-tRNA synthetase 1 1
MIRT024902 RIMKLA ribosomal modification protein rimK-like family member A 1 1
MIRT024903 CREBL2 cAMP responsive element binding protein-like 2 1 1
MIRT024904 EPM2A epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) 1 1
MIRT024905 RNF6 ring finger protein (C3H2C3 type) 6 1 1
MIRT024906 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 1 1
MIRT024907 ARL2BP ADP-ribosylation factor-like 2 binding protein 1 1
MIRT024908 LHFP lipoma HMGIC fusion partner 1 1
MIRT024909 SAMHD1 SAM domain and HD domain 1 1 1
MIRT024910 NOXO1 NADPH oxidase organizer 1 1 1
MIRT024911 ACSF3 acyl-CoA synthetase family member 3 1 1
MIRT024912 SLC35B4 solute carrier family 35, member B4 1 1
MIRT024913 PCGF5 polycomb group ring finger 5 1 1
MIRT024914 SLCO3A1 solute carrier organic anion transporter family, member 3A1 1 1
MIRT024915 PODXL podocalyxin-like 1 1
MIRT024916 CHST12 carbohydrate (chondroitin 4) sulfotransferase 12 1 1
MIRT024917 OGFRL1 opioid growth factor receptor-like 1 1 1
MIRT024918 IL15 interleukin 15 1 1
MIRT024919 CLSTN1 calsyntenin 1 1 1
MIRT024920 MNS1 meiosis-specific nuclear structural 1 1 1
MIRT024921 BLM Bloom syndrome, RecQ helicase-like 1 1
MIRT024922 ZNF165 zinc finger protein 165 1 1
MIRT024923 MAP1LC3B microtubule-associated protein 1 light chain 3 beta 1 1
MIRT024924 RAB23 RAB23, member RAS oncogene family 1 1
MIRT024925 ANLN anillin, actin binding protein 1 1
MIRT024926 PASK PAS domain containing serine/threonine kinase 1 1
MIRT024927 LRRFIP2 leucine rich repeat (in FLII) interacting protein 2 1 1
MIRT024928 TYMS thymidylate synthetase 1 1
MIRT024929 CADPS2 Ca++-dependent secretion activator 2 1 1
MIRT024930 TOR1AIP1 torsin A interacting protein 1 1 1
MIRT024931 RDM1 RAD52 motif 1 1 1
MIRT024932 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 1 1
MIRT024933 KCTD15 potassium channel tetramerisation domain containing 15 1 1
MIRT024934 SEC23B Sec23 homolog B (S. cerevisiae) 1 1
MIRT024935 TMEM200A transmembrane protein 200A 1 1
MIRT024936 NRG4 neuregulin 4 1 1
MIRT024937 KIF20B kinesin family member 20B 1 1
MIRT024938 FAM126A family with sequence similarity 126, member A 1 1
MIRT024939 TCFL5 transcription factor-like 5 (basic helix-loop-helix) 1 1
MIRT024940 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 1
MIRT024941 SLC25A40 solute carrier family 25, member 40 1 1
MIRT024942 CCSAP chromosome 1 open reading frame 96 1 1
MIRT024943 E2F8 E2F transcription factor 8 1 1
MIRT024944 RNF26 ring finger protein 26 1 1
MIRT024945 PAK6 p21 protein (Cdc42/Rac)-activated kinase 6 1 1
MIRT024946 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT024947 ID1 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein 1 1
MIRT024948 INSIG1 insulin induced gene 1 1 1
MIRT024949 MTSS1 metastasis suppressor 1 1 1
MIRT024950 DHFR dihydrofolate reductase 1 1
MIRT024951 BARD1 BRCA1 associated RING domain 1 1 1
MIRT024952 CRLF3 cytokine receptor-like factor 3 1 1
MIRT024953 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) 1 1
MIRT024954 FOS FBJ murine osteosarcoma viral oncogene homolog 1 1
MIRT024955 CCDC111 coiled-coil domain containing 111 1 1
MIRT024956 POLA2 polymerase (DNA directed), alpha 2 (70kD subunit) 1 1
MIRT024957 MIS12 MIS12, MIND kinetochore complex component, homolog (S. pombe) 1 1