Accession ID: MIRT025094 [miRNA, hsa-miR-181a-5p :: PTGS2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-181a-2LinkOut: [miRBase ]
Synonyms MIRN181A, MIRN181A2, MIR181A2, MIR181A2HG
Description Homo sapiens miR-181a-2 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-181a-5p
Mature Sequence 39| AACAUUCAACGCUGUCGGUGAGU |61
Evidence Experimental
Experiments Cloned
Putative hsa-miR-181a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol PTGS2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms COX-2, COX2, GRIPGHS, PGG/HS, PGHS-2, PHS-2, hCox-2
Description prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Transcript NM_000963    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on PTGS2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of PTGS2
(miRNA target sites are highlighted)
>PTGS2|NM_000963|3'UTR
   1 AAGTCTAATGATCATATTTATTTATTTATATGAACCATGTCTATTAATTTAATTATTTAATAATATTTATATTAAACTCC
  81 TTATGTTACTTAACATCTTCTGTAACAGAAGTCAGTACTCCTGTTGCGGAGAAAGGAGTCATACTTGTGAAGACTTTTAT
 161 GTCACTACTCTAAAGATTTTGCTGTTGCTGTTAAGTTTGGAAAACAGTTTTTATTCTGTTTTATAAACCAGAGAGAAATG
 241 AGTTTTGACGTCTTTTTACTTGAATTTCAACTTATATTATAAGAACGAAAGTAAAGATGTTTGAATACTTAAACACTGTC
 321 ACAAGATGGCAAAATGCTGAAAGTTTTTACACTGTCGATGTTTCCAATGCATCTTCCATGATGCATTAGAAGTAACTAAT
 401 GTTTGAAATTTTAAAGTACTTTTGGTTATTTTTCTGTCATCAAACAAAAACAGGTATCAGTGCATTATTAAATGAATATT
 481 TAAATTAGACATTACCAGTAATTTCATGTCTACTTTTTAAAATCAGCAATGAAACAATAATTTGAAATTTCTAAATTCAT
 561 AGGGTAGAATCACCTGTAAAAGCTTGTTTGATTTCTTAAAGTTATTAAACTTGTACATATACCAAAAAGAAGCTGTCTTG
 641 GATTTAAATCTGTAAAATCAGTAGAAATTTTACTACAATTGCTTGTTAAAATATTTTATAAGTGATGTTCCTTTTTCACC
 721 AAGAGTATAAACCTTTTTAGTGTGACTGTTAAAACTTCCTTTTAAATCAAAATGCCAAATTTATTAAGGTGGTGGAGCCA
 801 CTGCAGTGTTATCTTAAAATAAGAATATTTTGTTGAGATATTCCAGAATTTGTTTATATGGCTGGTAACATGTAAAATCT
 881 ATATCAGCAAAAGGGTCTACCTTTAAAATAAGCAATAACAAAGAAGAAAACCAAATTATTGTTCAAATTTAGGTTTAAAC
 961 TTTTGAAGCAAACTTTTTTTTATCCTTGTGCACTGCAGGCCTGGTACTCAGATTTTGCTATGAGGTTAATGAAGTACCAA
1041 GCTGTGCTTGAATAATGATATGTTTTCTCAGATTTTCTGTTGTACAGTTTAATTTAGCAGTCCATATCACATTGCAAAAG
1121 TAGCAATGACCTCATAAAATACCTCTTCAAAATGCTTAAATTCATTTCACACATTAATTTTATCTCAGTCTTGAAGCCAA
1201 TTCAGTAGGTGCATTGGAATCAAGCCTGGCTACCTGCATGCTGTTCCTTTTCTTTTCTTCTTTTAGCCATTTTGCTAAGA
1281 GACACAGTCTTCTCATCACTTCGTTTCTCCTATTTTGTTTTACTAGTTTTAAGATCAGAGTTCACTTTCTTTGGACTCTG
1361 CCTATATTTTCTTACCTGAACTTTTGCAAGTTTTCAGGTAAACCTCAGCTCAGGACTGCTATTTAGCTCCTCTTAAGAAG
1441 ATTAAAAGAGAAAAAAAAAGGCCCTTTTAAAAATAGTATACACTTATTTTAAGTGAAAAGCAGAGAATTTTATTTATAGC
1521 TAATTTTAGCTATCTGTAACCAAGATGGATGCAAAGAGGCTAGTGCCTCAGAGAGAACTGTACGGGGTTTGTGACTGGAA
1601 AAAGTTACGTTCCCATTCTAATTAATGCCCTTTCTTATTTAAAAACAAAACCAAATGATATCTAAGTAGTTCTCAGCAAT
1681 AATAATAATGACGATAATACTTCTTTTCCACATCTCATTGTCACTGACATTTAATGGTACTGTATATTACTTAATTTATT
1761 GAAGATTATTATTTATGTCTTATTAGGACACTATGGTTATAAACTGTGTTTAAGCCTACAATCATTGATTTTTTTTTGTT
1841 ATGTCACAATCAGTATATCTTCTTTGGGGTTACCTCTCTGAATATTATGTAAACAATCCAAAGAAATGATTGTATTAAGA
1921 TTTGTGAATAAATTTTTAGAAATCTGATTGGCATATTGAGATATTTAAGGTTGAATGTTTGTCCTTAGGATAGGCCTATG
2001 TGCTAGCCCACAAAGAATATTGTCTCATTAGCCTGAATGTGCCATAAGACTGACCTTTTAAAATGTTTTGAGGGATCTGT
2081 GGATGCTTCGTTAATTTGTTCAGCCACAATTTATTGAGAAAATATTCTGTGTCAAGCACTGTGGGTTTTAATATTTTTAA
2161 ATCAAACGCTGATTACAGATAATAGTATTTATATAAATAATTGAAAAAAATTTTCTTTTGGGAAGAGGGAGAAAATGAAA
2241 TAAATATCATTAAAGATAACTCAGGAGAATCTTCTTTACAATTTTACGTTTAGAATGTTTAAGGTTAAGAAAGAAATAGT
2321 CAATATGCTTGTATAAAACACTGTTCACTGTTTTTTTTAAAAAAAAAACTTGATTTGTTATTAACATTGATCTGCTGACA
2401 AAACCTGGGAATTTGGGTTGTGTATGCGAATGTTTCAGTGCCTCAGACAAATGTGTATTTAACTTATGTAAAAGATAAGT
2481 CTGGAAATAAATGTCTGTTTATTTTTGTACTATTTAAAAATTGACAGATCTTTTCTGAAGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugaGUGGCUGUCGCAACUUACAa 5'
             :|:: | || ||||||||| 
Target 5' agaTATTTA-AG-GTTGAATGTt 3'
1959 - 1979 154.00 -11.70
2
miRNA  3' ugAGUGGCUGUCGCAACUUACAa 5'
            |||:   :|||  ||||||| 
Target 5' tcTCAT---TAGC-CTGAATGTg 3'
2023 - 2041 149.00 -12.60
3
miRNA  3' ugAGUG-GCUGUCG-----CAACUUACAa 5'
            ||||  ||::||     | |||| || 
Target 5' tgTCACAAGATGGCAAAATGCTGAAAGTt 3'
317 - 345 125.00 -9.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181a-5p :: PTGS2    [ Functional MTI ]
Validation Method Microarray
Article - Grimson, A. Farh, K. K. Johnston, W. K. et al.
- Mol Cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
529 hsa-miR-181a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000242 BDNF brain-derived neurotrophic factor 1 1
MIRT000243 NLK nemo-like kinase 2 1
MIRT000244 GATA6 GATA binding protein 6 3 2
MIRT000245 CDX2 caudal type homeobox 2 2 1
MIRT000698 PLAG1 pleiomorphic adenoma gene 1 4 1
MIRT002870 HOXA11 homeobox A11 1 1
MIRT003501 BCL2 B-cell CLL/lymphoma 2 4 8
MIRT003630 PROX1 prospero homeobox 1 4 1
MIRT004327 KAT2B K(lysine) acetyltransferase 2B 3 1
MIRT004554 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 5 2
MIRT005544 ZNF763 zinc finger protein 763 4 1
MIRT005575 DDIT4 DNA-damage-inducible transcript 4 4 2
MIRT005576 ATM ataxia telangiectasia mutated 5 5
MIRT005577 HIPK2 homeodomain interacting protein kinase 2 3 1
MIRT005767 BCL2L11 BCL2-like 11 (apoptosis facilitator) 3 2
MIRT005880 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 3 1
MIRT006166 RNF2 ring finger protein 2 4 1
MIRT006194 RALA v-ral simian leukemia viral oncogene homolog A (ras related) 4 2
MIRT006213 SIRT1 sirtuin 1 2 2
MIRT006395 PRAP1 proline-rich acidic protein 1 1 1
MIRT006481 DUSP6 dual specificity phosphatase 6 2 1
MIRT006482 PTPN11 protein tyrosine phosphatase, non-receptor type 11 2 1
MIRT006483 DUSP5 dual specificity phosphatase 5 3 2
MIRT006484 PTPN22 protein tyrosine phosphatase, non-receptor type 22 (lymphoid) 2 1
MIRT006851 FOS FBJ murine osteosarcoma viral oncogene homolog 1 1
MIRT006871 MTMR3 myotubularin related protein 3 1 1
MIRT006939 KLF6 Kruppel-like factor 6 3 2
MIRT006949 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT006950 XIAP X-linked inhibitor of apoptosis 1 1
MIRT007058 GPR78 G protein-coupled receptor 78 1 1
MIRT025038 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 1 1
MIRT025039 LRRC17 leucine rich repeat containing 17 1 1
MIRT025040 CHRFAM7A CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion 1 1
MIRT025041 CD46 CD46 molecule, complement regulatory protein 1 1
MIRT025042 RASSF6 Ras association (RalGDS/AF-6) domain family member 6 1 1
MIRT025043 FXYD6 FXYD domain containing ion transport regulator 6 1 1
MIRT025044 KCTD3 potassium channel tetramerisation domain containing 3 1 1
MIRT025045 TSHR thyroid stimulating hormone receptor 1 1
MIRT025046 ZNF558 zinc finger protein 558 1 1
MIRT025047 C8A complement component 8, alpha polypeptide 1 1
MIRT025048 ARL6IP6 ADP-ribosylation-like factor 6 interacting protein 6 1 1
MIRT025049 ZNF426 zinc finger protein 426 1 1
MIRT025050 ESR1 estrogen receptor 1 1 1
MIRT025051 ATF7IP2 activating transcription factor 7 interacting protein 2 1 1
MIRT025052 PRR4 proline rich 4 (lacrimal) 1 1
MIRT025053 TCF21 transcription factor 21 1 1
MIRT025054 PHOX2A paired-like homeobox 2a 1 1
MIRT025055 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT025056 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT025057 GSTM2 glutathione S-transferase mu 2 (muscle) 1 1
MIRT025058 FSIP1 fibrous sheath interacting protein 1 1 1
MIRT025059 KBTBD3 kelch repeat and BTB (POZ) domain containing 3 1 1
MIRT025060 PTPRZ1 protein tyrosine phosphatase, receptor-type, Z polypeptide 1 1 1
MIRT025061 WNT3A wingless-type MMTV integration site family, member 3A 1 1
MIRT025062 TUSC1 tumor suppressor candidate 1 1 1
MIRT025063 LRRN3 leucine rich repeat neuronal 3 1 1
MIRT025064 TMEM45A transmembrane protein 45A 1 1
MIRT025065 ARF6 ADP-ribosylation factor 6 2 2
MIRT025066 C1orf109 chromosome 1 open reading frame 109 1 1
MIRT025067 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT025068 PLXDC2 plexin domain containing 2 1 1
MIRT025069 NMRK2 nicotinamide riboside kinase 2 1 1
MIRT025070 WNT2 wingless-type MMTV integration site family member 2 1 1
MIRT025071 ATG10 autophagy related 10 1 1
MIRT025072 PRDX3 peroxiredoxin 3 1 1
MIRT025073 ZNF652 zinc finger protein 652 1 1
MIRT025074 RTEL1-TNFRSF6B RTEL1-TNFRSF6B readthrough (non-protein coding) 1 1
MIRT025075 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 1 1
MIRT025076 PCDHB8 protocadherin beta 8 1 1
MIRT025077 ENAH enabled homolog (Drosophila) 1 1
MIRT025078 ZNF25 zinc finger protein 25 1 1
MIRT025079 TAF6L TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT025080 S100A1 S100 calcium binding protein A1 1 1
MIRT025081 PLA2G4C phospholipase A2, group IVC (cytosolic, calcium-independent) 1 1
MIRT025082 NOL4 nucleolar protein 4 1 1
MIRT025083 SIX6 SIX homeobox 6 1 1
MIRT025084 FKBP10 FK506 binding protein 10, 65 kDa 1 1
MIRT025085 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT025086 OR11A1 olfactory receptor, family 11, subfamily A, member 1 1 1
MIRT025087 INCENP inner centromere protein antigens 135/155kDa 2 2
MIRT025088 LPGAT1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT025089 CLUAP1 clusterin associated protein 1 1 1
MIRT025090 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 1
MIRT025091 CCDC6 coiled-coil domain containing 6 1 1
MIRT025092 BAG2 BCL2-associated athanogene 2 1 1
MIRT025093 GPR83 G protein-coupled receptor 83 1 1
MIRT025094 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1 1
MIRT025095 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT025096 RLF rearranged L-myc fusion 2 2
MIRT025097 FBXO28 F-box protein 28 1 1
MIRT025098 ZNF350 zinc finger protein 350 1 1
MIRT025099 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT025100 RNF34 ring finger protein 34, E3 ubiquitin protein ligase 1 1
MIRT025101 LCLAT1 lysocardiolipin acyltransferase 1 1 2
MIRT025102 KIAA1462 KIAA1462 1 1
MIRT025103 ZNF35 zinc finger protein 35 1 1
MIRT025104 PITPNB phosphatidylinositol transfer protein, beta 1 1
MIRT025105 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 3
MIRT025106 H3F3B H3 histone, family 3B (H3.3B) 1 1
MIRT025107 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT025108 LGALSL lectin, galactoside-binding-like 1 1
MIRT025109 TGIF2 TGFB-induced factor homeobox 2 1 1
MIRT025110 MOB1A MOB kinase activator 1A 1 1
MIRT025111 SLC35B4 solute carrier family 35, member B4 1 1
MIRT025112 FAM160A2 family with sequence similarity 160, member A2 1 2
MIRT025113 NUPL1 nucleoporin like 1 1 1
MIRT025114 GPRIN3 GPRIN family member 3 1 1
MIRT025115 H1F0 H1 histone family, member 0 1 1
MIRT025116 ARHGAP12 Rho GTPase activating protein 12 1 1
MIRT025117 SPRY2 sprouty homolog 2 (Drosophila) 1 1
MIRT025118 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT025119 TMED4 transmembrane emp24 protein transport domain containing 4 1 1
MIRT025120 MAP2K1 mitogen-activated protein kinase kinase 1 5 2
MIRT025121 PUM1 pumilio homolog 1 (Drosophila) 1 1
MIRT025122 TRIM2 tripartite motif containing 2 1 1
MIRT025123 FBXO33 F-box protein 33 1 1
MIRT025124 NRP1 neuropilin 1 2 2
MIRT025125 FAM47B family with sequence similarity 47, member B 1 1
MIRT025126 CCNG1 cyclin G1 2 2
MIRT025127 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT025128 OTUD1 OTU domain containing 1 2 2
MIRT025129 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT025130 WNT16 wingless-type MMTV integration site family, member 16 1 1
MIRT025131 CST5 cystatin D 1 1
MIRT025132 SH3BGRL SH3 domain binding glutamic acid-rich protein like 1 1
MIRT025133 GPR137B G protein-coupled receptor 137B 1 1
MIRT025134 OFCC1 orofacial cleft 1 candidate 1 1 1
MIRT025135 IQCG IQ motif containing G 2 2
MIRT025136 NKX3-2 NK3 homeobox 2 1 1
MIRT025137 OTX2 orthodenticle homeobox 2 1 1
MIRT025138 ROPN1L rhophilin associated tail protein 1-like 1 1
MIRT025139 TMEM14A transmembrane protein 14A 1 1
MIRT025140 TAF2 TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa 1 1
MIRT025141 IDS iduronate 2-sulfatase 1 1
MIRT025142 FRA10AC1 fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1 1 1
MIRT025143 COL27A1 collagen, type XXVII, alpha 1 1 1
MIRT025144 EPHA5 EPH receptor A5 1 1
MIRT025145 DCST1 DC-STAMP domain containing 1 1 1
MIRT025146 ZNF562 zinc finger protein 562 1 1
MIRT025147 EYA4 eyes absent homolog 4 (Drosophila) 1 1
MIRT025148 CHL1 cell adhesion molecule with homology to L1CAM (close homolog of L1) 1 1
MIRT025149 TAAR6 trace amine associated receptor 6 1 1
MIRT025150 SLCO2A1 solute carrier organic anion transporter family, member 2A1 1 1
MIRT025151 TMEM257 chromosome X open reading frame 1 1 1
MIRT025152 HMGB2 high mobility group box 2 1 1
MIRT025153 HERC3 HECT and RLD domain containing E3 ubiquitin protein ligase 3 1 1
MIRT025154 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT025155 SRPK2 SRSF protein kinase 2 1 1
MIRT025156 DNAJC7 DnaJ (Hsp40) homolog, subfamily C, member 7 1 1
MIRT025157 ANKRD1 ankyrin repeat domain 1 (cardiac muscle) 1 1
MIRT025158 CFI complement factor I 1 1
MIRT025159 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT025160 HEY2 hairy/enhancer-of-split related with YRPW motif 2 1 1
MIRT025161 MTMR12 myotubularin related protein 12 1 1
MIRT025162 ACOT12 acyl-CoA thioesterase 12 1 1
MIRT025163 KIAA0101 KIAA0101 1 1
MIRT025164 USP28 ubiquitin specific peptidase 28 1 1
MIRT025165 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 1 1
MIRT025166 BPGM 2,3-bisphosphoglycerate mutase 1 1
MIRT025167 DSCR8 Down syndrome critical region gene 8 1 1
MIRT025168 UGT3A1 UDP glycosyltransferase 3 family, polypeptide A1 1 1
MIRT025169 HSD17B3 hydroxysteroid (17-beta) dehydrogenase 3 1 1
MIRT025170 GADD45G growth arrest and DNA-damage-inducible, gamma 1 1
MIRT025171 FBXO34 F-box protein 34 1 1
MIRT025172 C1QTNF9 C1q and tumor necrosis factor related protein 9 1 1
MIRT025173 KLRC4 killer cell lectin-like receptor subfamily C, member 4 1 1
MIRT025174 MOB3B MOB kinase activator 3B 1 1
MIRT025175 FKBP7 FK506 binding protein 7 1 1
MIRT025176 TBX4 T-box 4 1 1
MIRT025177 TMPRSS11A transmembrane protease, serine 11A 1 1
MIRT025178 SNAI2 snail homolog 2 (Drosophila) 1 1
MIRT025179 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 1
MIRT025180 NUDT12 nudix (nucleoside diphosphate linked moiety X)-type motif 12 1 1
MIRT025181 COPS2 COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) 1 1
MIRT025182 ZNF12 zinc finger protein 12 1 1
MIRT025183 PRLR prolactin receptor 1 1
MIRT025184 PLCL2 phospholipase C-like 2 1 1
MIRT025185 ZNF594 zinc finger protein 594 1 1
MIRT025186 METAP1 methionyl aminopeptidase 1 1 1
MIRT025187 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT025188 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 3
MIRT025189 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT025190 SLC37A3 solute carrier family 37 (glycerol-3-phosphate transporter), member 3 1 1
MIRT025191 FBXO11 F-box protein 11 1 2
MIRT025192 ZNF445 zinc finger protein 445 1 1
MIRT025193 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT025194 ATP8A1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 1 1
MIRT025195 TMEM64 transmembrane protein 64 1 1
MIRT025196 MOB1B MOB kinase activator 1B 1 1
MIRT025197 GNAI3 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 1 1
MIRT025198 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT025199 SRSF7 serine/arginine-rich splicing factor 7 1 1
MIRT025200 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 4 5
MIRT025201 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 4 2
MIRT025202 LBR lamin B receptor 1 2
MIRT025203 GIGYF1 GRB10 interacting GYF protein 1 1 4
MIRT025204 KLHL42 kelch domain containing 5 1 1
MIRT025205 TMEM132B transmembrane protein 132B 1 1
MIRT025206 AFTPH aftiphilin 1 1
MIRT025207 ZNF148 zinc finger protein 148 1 1
MIRT025208 NOTCH2 notch 2 2 2
MIRT025209 NFYB nuclear transcription factor Y, beta 1 1
MIRT035538 NOTCH1 notch 1 2 1
MIRT047302 SIK2 salt-inducible kinase 2 1 1
MIRT047303 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT047304 FAM222B family with sequence similarity 222, member B 1 1
MIRT047305 RPS8 ribosomal protein S8 1 1
MIRT047306 STAG2 stromal antigen 2 1 1
MIRT047307 SMG1 smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT047308 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT047309 ZEB2 zinc finger E-box binding homeobox 2 1 1
MIRT047310 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT047311 RPL14 ribosomal protein L14 1 1
MIRT047312 KCTD2 potassium channel tetramerisation domain containing 2 1 1
MIRT047313 UBA2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT047314 DDX27 DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 1 1
MIRT047315 FAT1 FAT tumor suppressor homolog 1 (Drosophila) 1 1
MIRT047316 HDAC6 histone deacetylase 6 1 1
MIRT047317 TMEM192 transmembrane protein 192 1 1
MIRT047318 LAMA3 laminin, alpha 3 1 1
MIRT047319 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT047320 ND2 MTND2 1 1
MIRT047321 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT047322 OCA2 oculocutaneous albinism II 1 1
MIRT047323 AP1M1 adaptor-related protein complex 1, mu 1 subunit 1 1
MIRT047324 UCHL1 ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) 1 1
MIRT047325 PGD phosphogluconate dehydrogenase 1 1
MIRT047326 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 2
MIRT047327 AKAP12 A kinase (PRKA) anchor protein 12 1 1
MIRT047328 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT047329 GANAB glucosidase, alpha; neutral AB 1 1
MIRT047330 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT047331 H2AFY H2A histone family, member Y 1 1
MIRT047332 TEAD4 TEA domain family member 4 1 1
MIRT047333 KLHL15 kelch-like 15 (Drosophila) 1 2
MIRT047334 PRRC2B proline-rich coiled-coil 2B 1 1
MIRT047335 BRCA1 breast cancer 1, early onset 1 1
MIRT047336 SOGA2 SOGA family member 2 1 1
MIRT047337 KIAA0100 KIAA0100 1 1
MIRT047338 PPP1R9A protein phosphatase 1, regulatory subunit 9A 1 1
MIRT047339 MGAT5 mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase 1 1
MIRT047340 TNIP1 TNFAIP3 interacting protein 1 1 1
MIRT052976 PBX3 pre-B-cell leukemia homeobox 3 3 1
MIRT052992 TIMP1 TIMP metallopeptidase inhibitor 1 3 1
MIRT052993 PGR progesterone receptor 3 1
MIRT053039 COL16A1 collagen, type XVI, alpha 1 3 1
MIRT053196 PPP3CA protein phosphatase 3, catalytic subunit, alpha isozyme 1 1
MIRT053197 ATG5 autophagy related 5 2 1
MIRT053201 CD4 CD4 molecule 2 1
MIRT053662 TGFBRAP1 transforming growth factor, beta receptor associated protein 1 4 2
MIRT053663 TGFBR1 transforming growth factor, beta receptor 1 4 2
MIRT053664 TNFRSF11B tumor necrosis factor receptor superfamily, member 11b 1 1
MIRT053665 PCDHAC1 protocadherin alpha subfamily C, 1 1 1
MIRT053666 PCDHAC2 protocadherin alpha subfamily C, 2 1 1
MIRT053667 PCDHA1 protocadherin alpha 1 1 1
MIRT053668 PCDHA10 protocadherin alpha 10 1 1
MIRT053669 PCDHA11 protocadherin alpha 11 1 1
MIRT053670 PCDHA12 protocadherin alpha 12 1 1
MIRT053671 PCDHA13 protocadherin alpha 13 1 1
MIRT053672 PCDHA2 protocadherin alpha 2 1 1
MIRT053673 PCDHA3 protocadherin alpha 3 1 1
MIRT053674 PCDHA4 protocadherin alpha 4 1 1
MIRT053675 PCDHA5 protocadherin alpha 5 1 1
MIRT053676 PCDHA6 protocadherin alpha 6 1 1
MIRT053677 PCDHA7 protocadherin alpha 7 1 1
MIRT053678 PCDHA8 protocadherin alpha 8 1 1
MIRT053679 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 1 1
MIRT053680 BMP3 bone morphogenetic protein 3 1 1
MIRT053681 SOX5 SRY (sex determining region Y)-box 5 1 1
MIRT053682 MAP3K3 mitogen-activated protein kinase kinase kinase 3 2 2
MIRT053683 TAB3 TGF-beta activated kinase 1/MAP3K7 binding protein 3 1 1
MIRT053684 PDAP1 PDGFA associated protein 1 1 1
MIRT053685 MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1-like 1 1
MIRT053686 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 2 2
MIRT053687 SMAD2 SMAD family member 2 1 1
MIRT053688 MADD MAP-kinase activating death domain 1 1
MIRT053689 CDH13 cadherin 13, H-cadherin (heart) 1 1
MIRT053690 ACAN aggrecan 1 1
MIRT053691 MAP3K10 mitogen-activated protein kinase kinase kinase 10 1 1
MIRT053692 PCDHB6 protocadherin beta 6 1 1
MIRT053693 MAP4K4 mitogen-activated protein kinase kinase kinase kinase 4 1 1
MIRT053694 MMP14 matrix metallopeptidase 14 (membrane-inserted) 1 1
MIRT054422 E2F5 E2F transcription factor 5, p130-binding 3 1
MIRT054562 RAP1B RAP1B, member of RAS oncogene family 3 1
MIRT067357 C12ORF29 chromosome 12 open reading frame 29 2 1
MIRT068600 NHLRC3 NHL repeat containing 3 1 1
MIRT071713 CCNK cyclin K 1 2
MIRT074780 PAPD5 PAP associated domain containing 5 1 1
MIRT081041 CARM1 coactivator-associated arginine methyltransferase 1 1 1
MIRT081140 LDLR low density lipoprotein receptor 1 1
MIRT086584 C2ORF69 chromosome 2 open reading frame 69 1 1
MIRT088064 SEPT2 septin 2 1 2
MIRT097056 TNPO1 transportin 1 1 1
MIRT106868 PTBP3 polypyrimidine tract binding protein 3 1 1
MIRT128339 CUL5 cullin 5 1 1
MIRT131427 PRRC2C proline-rich coiled-coil 2C 1 1
MIRT133211 PEBP1 phosphatidylethanolamine binding protein 1 1 1
MIRT134656 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT137301 IPO5 importin 5 1 1
MIRT137700 RCOR1 REST corepressor 1 1 1
MIRT138427 KIF2C kinesin family member 2C 1 2
MIRT143445 CHD9 chromodomain helicase DNA binding protein 9 1 2
MIRT149117 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT149977 ZNF136 zinc finger protein 136 1 1
MIRT152745 KIF3B kinesin family member 3B 1 1
MIRT153572 TTPAL tocopherol (alpha) transfer protein-like 1 1
MIRT153852 NCOA3 nuclear receptor coactivator 3 1 1
MIRT161695 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT163342 PRKCD protein kinase C, delta 5 3
MIRT172788 SLC25A37 solute carrier family 25 (mitochondrial iron transporter), member 37 1 1
MIRT172871 CHCHD7 coiled-coil-helix-coiled-coil-helix domain containing 7 1 1
MIRT175455 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT182137 ADRBK1 adrenergic, beta, receptor kinase 1 1 1
MIRT183809 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 1
MIRT184927 ZNF268 zinc finger protein 268 1 1
MIRT194174 ZFAND6 zinc finger, AN1-type domain 6 1 3
MIRT199130 LMAN1 lectin, mannose-binding, 1 1 1
MIRT199773 MRPL34 mitochondrial ribosomal protein L34 1 1
MIRT202709 PDIA6 protein disulfide isomerase family A, member 6 1 1
MIRT210750 CHMP2B charged multivesicular body protein 2B 1 1
MIRT231560 DRAM1 DNA-damage regulated autophagy modulator 1 1 1
MIRT234620 KIAA0195 KIAA0195 1 1
MIRT234945 ZNF440 zinc finger protein 440 1 2
MIRT234951 ZNF439 zinc finger protein 439 1 1
MIRT237875 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 2
MIRT247903 KIAA1551 KIAA1551 1 1
MIRT252248 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT253450 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT256742 HIGD2A HIG1 hypoxia inducible domain family, member 2A 1 1
MIRT257371 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT273444 DAZAP2 DAZ associated protein 2 1 1
MIRT279875 ZFP36L1 zinc finger protein 36, C3H type-like 1 1 1
MIRT305128 SLC35G2 solute carrier family 35, member G2 1 1
MIRT314550 MTX3 metaxin 3 1 1
MIRT437399 ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 4 1
MIRT437649 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437650 SASH1 SAM and SH3 domain containing 1 2 1
MIRT437651 PHLDA1 pleckstrin homology-like domain, family A, member 1 2 1
MIRT437652 MOSPD1 motile sperm domain containing 1 2 1
MIRT437653 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 1
MIRT437654 UBL3 ubiquitin-like 3 2 1
MIRT437655 PHACTR4 phosphatase and actin regulator 4 2 1
MIRT437656 EREG epiregulin 2 1
MIRT437924 TERT telomerase reverse transcriptase 2 1
MIRT437942 RGS5 regulator of G-protein signaling 5 3 1
MIRT437969 IFNG interferon, gamma 3 1
MIRT438216 AHR aryl hydrocarbon receptor 2 1
MIRT438217 STAT3 signal transducer and activator of transcription 3 (acute-phase response factor) 2 1
MIRT438437 WIF1 WNT inhibitory factor 1 4 1
MIRT438509 TWIST1 twist homolog 1 (Drosophila) 1 1
MIRT438857 MAPK1 mitogen-activated protein kinase 1 4 1
MIRT445123 DCAF4 DDB1 and CUL4 associated factor 4 1 1
MIRT447015 RSF1 remodeling and spacing factor 1 1 1
MIRT451642 FAM96A family with sequence similarity 96, member A 1 1
MIRT467860 SLC25A25 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 1 1
MIRT470383 PPP2R5E protein phosphatase 2, regulatory subunit B', epsilon isoform 1 1
MIRT477002 FAM73B family with sequence similarity 73, member B 1 1
MIRT479955 CBX4 chromobox homolog 4 1 3
MIRT480026 CAPRIN2 caprin family member 2 1 2
MIRT498152 FKBP1C FK506 binding protein 1C 1 2
MIRT498526 ZNF83 zinc finger protein 83 1 4
MIRT499144 HSPA1B heat shock 70kDa protein 1B 1 4
MIRT499474 ZNF669 zinc finger protein 669 1 4
MIRT500270 ZNF788 zinc finger family member 788 1 3
MIRT500279 ZNF781 zinc finger protein 781 1 3
MIRT500299 ZNF667 zinc finger protein 667 1 4
MIRT500335 ZNF487P zinc finger protein 487, pseudogene 1 3
MIRT502621 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 1 3
MIRT507379 EPS8 epidermal growth factor receptor pathway substrate 8 1 2
MIRT513011 MAN1A2 mannosidase, alpha, class 1A, member 2 1 1
MIRT513569 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT519607 ZNF791 zinc finger protein 791 1 3
MIRT519846 ZFP69B zinc finger protein 643 1 2
MIRT520651 NPM3 nucleophosmin/nucleoplasmin 3 1 3
MIRT523128 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 2
MIRT526145 GJB7 gap junction protein, beta 7, 25kDa 1 1
MIRT528359 ZDHHC15 zinc finger, DHHC-type containing 15 1 1
MIRT529134 XPNPEP3 X-prolyl aminopeptidase (aminopeptidase P) 3, putative 1 1
MIRT532856 ZNF699 zinc finger protein 699 1 1
MIRT535284 PHOX2B paired-like homeobox 2b 1 1
MIRT535319 PHC3 polyhomeotic homolog 3 (Drosophila) 1 2
MIRT536908 HEPHL1 hephaestin-like 1 1 1
MIRT539055 ATP8B1 ATPase, aminophospholipid transporter, class I, type 8B, member 1 1 1
MIRT542777 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT543609 ZNF844 zinc finger protein 844 1 2
MIRT543636 ZNF780B zinc finger protein 780B 1 1
MIRT543952 NCOA7 nuclear receptor coactivator 7 1 1
MIRT544390 ZNF266 zinc finger protein 266 1 1
MIRT544463 KRBOX4 zinc finger family member 673 1 1
MIRT545438 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT546317 TMCC1 transmembrane and coiled-coil domain family 1 1 2
MIRT548177 FOXL1 forkhead box L1 1 2
MIRT551119 ZNF107 zinc finger protein 107 1 1
MIRT554022 SPIRE1 spire homolog 1 (Drosophila) 1 1
MIRT554674 RNF6 ring finger protein (C3H2C3 type) 6 1 2
MIRT555162 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT557276 HMGA2 high mobility group AT-hook 2 1 1
MIRT558550 CSNK1A1 casein kinase 1, alpha 1 1 1
MIRT559453 ARSJ arylsulfatase family, member J 1 1
MIRT559797 ZNF415 zinc finger protein 415 1 1
MIRT560747 ZNF616 zinc finger protein 616 1 1
MIRT560844 SUV39H2 suppressor of variegation 3-9 homolog 2 (Drosophila) 1 1
MIRT562334 FAM3C family with sequence similarity 3, member C 1 1
MIRT562767 ZNF846 zinc finger protein 846 1 1
MIRT564741 ZNF23 zinc finger protein 23 1 1
MIRT565163 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT567388 GTPBP3 GTP binding protein 3 (mitochondrial) 1 1
MIRT568682 IRAK1BP1 interleukin-1 receptor-associated kinase 1 binding protein 1 1 1
MIRT575088 Ddit4 DNA-damage-inducible transcript 4 1 1
MIRT575950 Unc5b unc-5 homolog B (C. elegans) 1 1
MIRT611626 SLC35G3 solute carrier family 35, member G3 1 1
MIRT613091 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 1 2
MIRT614684 UNC5B unc-5 homolog B (C. elegans) 1 2
MIRT620870 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT622409 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT624717 AP5M1 adaptor-related protein complex 5, mu 1 subunit 1 2
MIRT631079 ZNF829 zinc finger protein 829 1 1
MIRT633493 WDR72 WD repeat domain 72 1 1
MIRT635716 HFM1 HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae) 1 1
MIRT637039 SPTLC3 serine palmitoyltransferase, long chain base subunit 3 1 1
MIRT639503 SCN8A sodium channel, voltage gated, type VIII, alpha subunit 1 1
MIRT641325 ATXN7 ataxin 7 1 1
MIRT646844 TLDC1 KIAA1609 1 1
MIRT649738 RBM25 RNA binding motif protein 25 1 1
MIRT651418 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT660606 AP3M2 adaptor-related protein complex 3, mu 2 subunit 1 1
MIRT669768 ZNF556 zinc finger protein 556 1 1
MIRT683299 ZNF253 zinc finger protein 253 1 1
MIRT698129 TOPBP1 topoisomerase (DNA) II binding protein 1 1 1
MIRT698676 TEF thyrotrophic embryonic factor 1 1
MIRT702063 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT705938 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT707909 RSBN1L round spermatid basic protein 1-like 1 1
MIRT708830 KLHL24 kelch-like 24 (Drosophila) 1 1
MIRT708958 PDK3 pyruvate dehydrogenase kinase, isozyme 3 1 1
MIRT711041 RNF187 ring finger protein 187 1 1
MIRT711103 ZNF597 zinc finger protein 597 1 1
MIRT712563 CENPO centromere protein O 1 1
MIRT713217 FAM13A family with sequence similarity 13, member A 1 1
MIRT714106 RLIM ring finger protein, LIM domain interacting 1 1
MIRT715363 VCAM1 vascular cell adhesion molecule 1 1 1
MIRT716288 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT720070 ZNF449 zinc finger protein 449 1 1
MIRT722502 PNKD paroxysmal nonkinesigenic dyskinesia 1 1
MIRT725542 EN2 engrailed homeobox 2 1 1
MIRT726025 ZNF664 zinc finger protein 664 1 1
MIRT726057 ZNF121 zinc finger protein 121 1 1
MIRT726088 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT726178 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT726218 TUBB tubulin, beta class I 1 1
MIRT726225 TSG101 tumor susceptibility gene 101 1 1
MIRT726256 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT726274 TMF1 TATA element modulatory factor 1 1 1
MIRT726294 TMEM30A transmembrane protein 30A 1 1
MIRT726333 TFRC transferrin receptor (p90, CD71) 1 1
MIRT726352 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT726364 TBC1D7 TBC1 domain family, member 7 1 1
MIRT726375 TBC1D13 TBC1 domain family, member 13 1 1
MIRT726418 STX2 syntaxin 2 1 1
MIRT726436 STAG1 stromal antigen 1 1 1
MIRT726441 SSX2IP synovial sarcoma, X breakpoint 2 interacting protein 1 1
MIRT726459 SRGN serglycin 1 1
MIRT726474 SORT1 sortilin 1 1 1
MIRT726490 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 1
MIRT726518 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT726539 SLC38A2 solute carrier family 38, member 2 1 1
MIRT726557 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 1 1
MIRT726566 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT726571 SIPA1L1 signal-induced proliferation-associated 1 like 1 1 1
MIRT726581 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT726709 RP2 retinitis pigmentosa 2 (X-linked recessive) 1 1
MIRT726743 RHOG ras homolog family member G 1 1
MIRT726747 RGS16 regulator of G-protein signaling 16 1 1
MIRT726793 RAN RAN, member RAS oncogene family 1 1
MIRT726822 RAB2B RAB2B, member RAS oncogene family 1 1
MIRT726829 PURB purine-rich element binding protein B 1 1
MIRT726971 PGAP1 post-GPI attachment to proteins 1 1 1
MIRT726984 PER2 period homolog 2 (Drosophila) 1 1
MIRT727004 PBRM1 polybromo 1 1 1
MIRT727043 OSBPL3 oxysterol binding protein-like 3 1 1
MIRT727078 NMT2 N-myristoyltransferase 2 1 1
MIRT727081 FAM192A family with sequence similarity 192, member A 1 1
MIRT727086 NIN ninein (GSK3B interacting protein) 1 1
MIRT727100 NCAPG non-SMC condensin I complex, subunit G 1 1
MIRT727112 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT727132 MTUS1 microtubule associated tumor suppressor 1 1 1
MIRT727160 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT727181 KMT2E myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) 1 1
MIRT727287 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT727291 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT727332 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 1
MIRT727374 EFCAB14 KIAA0494 1 1
MIRT727382 KIAA0196 KIAA0196 1 1
MIRT727404 KDM5A lysine (K)-specific demethylase 5A 1 1
MIRT727450 INO80D INO80 complex subunit D 1 1
MIRT727459 IL1A interleukin 1, alpha 1 1
MIRT727494 HIST1H3D histone cluster 1, H3d 1 1
MIRT727507 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT727537 GOT1 glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) 1 1
MIRT727542 GOLGA8B golgin A8 family, member B 1 1
MIRT727551 GOLGA1 golgin A1 1 1
MIRT727558 GNS glucosamine (N-acetyl)-6-sulfatase 1 1
MIRT727578 GK5 glycerol kinase 5 (putative) 1 1
MIRT727625 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT727644 FSD1L fibronectin type III and SPRY domain containing 1-like 1 1
MIRT727705 FAM58A family with sequence similarity 58, member A 1 1
MIRT727757 EPS15 epidermal growth factor receptor pathway substrate 15 1 1
MIRT727802 EED embryonic ectoderm development 1 1
MIRT727835 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT727892 DDX52 DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 1 1
MIRT727945 CPOX coproporphyrinogen oxidase 1 1
MIRT727964 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT727984 CLCC1 chloride channel CLIC-like 1 1 1
MIRT728032 CCL22 chemokine (C-C motif) ligand 22 1 1
MIRT728039 CCDC88C coiled-coil domain containing 88C 1 1
MIRT728138 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 1
MIRT728158 GSKIP GSK3B interacting protein 1 1
MIRT728166 C11orf30 chromosome 11 open reading frame 30 1 1
MIRT728200 BLOC1S2 biogenesis of lysosomal organelles complex-1, subunit 2 1 1
MIRT728224 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT728256 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
MIRT728278 ATG2B autophagy related 2B 1 1
MIRT728296 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT728301 ARRDC3 arrestin domain containing 3 1 1
MIRT728304 ARRB2 arrestin, beta 2 1 1
MIRT728326 APOL6 apolipoprotein L, 6 1 1
MIRT728361 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT728380 AFF4 AF4/FMR2 family, member 4 1 1
MIRT728392 ACYP1 acylphosphatase 1, erythrocyte (common) type 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*