Accession ID: MIRT026714 [miRNA, hsa-miR-192-5p :: RET, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-192LinkOut: [miRBase ]
Synonyms MIRN192, miR-192, miRNA192, MIR192
Description Homo sapiens miR-192 stem-loop
Comment Lagos-Quintana et al. validated the presence of an 18 nt excised sequence by cloning . Subsequent assemblies suggest the presence of only one gene located on chromosome 11.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-192-5p
Mature Sequence 24| CUGACCUAUGAAUUGACAGCC |44
Evidence Experimental
Experiments Cloned
Putative hsa-miR-192-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol RET LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDHF12, CDHR16, HSCR1, MEN2A, MEN2B, MTC1, PTC, RET-ELE1, RET51
Description ret proto-oncogene
Transcript NM_0209    LinkOut: [ RefSeq ]
Other Transcripts NM_0206   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on RET LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of RET
(miRNA target sites are highlighted)
>RET|NM_0209|3'UTR
   1 TAACATTTCTTTGTGAAAGGTAATGGACTCACAAGGGGAAGAAACATGCTGAGAATGGAAAGTCTACCGGCCCTTTCTTT
  81 GTGAACGTCACATTGGCCGAGCCGTGTTCAGTTCCCAGGTGGCAGACTCGTTTTTGGTAGTTTGTTTTAACTTCCAAGGT
 161 GGTTTTACTTCTGATAGCCGGTGATTTTCCCTCCTAGCAGACATGCCACACCGGGTAAGAGCTCTGAGTCTTAGTGGTTA
 241 AGCATTCCTTTCTCTTCAGTGCCCAGCAGCACCCAGTGTTGGTCTGTGTCCATCAGTGACCACCAACATTCTGTGTTCAC
 321 ATGTGTGGGTCCAACACTTACTACCTGGTGTATGAAATTGGACCTGAACTGTTGGATTTTTCTAGTTGCCGCCAAACAAG
 401 GCAAAAAAATTTAAACATGAAGCACACACACAAAAAAGGCAGTAGGAAAAATGCTGGCCCTGATGACCTGTCCTTATTCA
 481 GAATGAGAGACTGCGGGGGGGGCCTGGGGGTAGTGTCAATGCCCCTCCAGGGCTGGAGGGGAAGAGGGGCCCCGAGGATG
 561 GGCCTGGGCTCAGCATTCGAGATCTTGAGAATGATTTTTTTTTAATCATGCAACCTTTCCTTAGGAAGACATTTGGTTTT
 641 CATCATGATTAAGATGATTCCTAGATTTAGCACAATGGAGAGATTCCATGCCATCTTTACTATGTGGATGGTGGTATCAG
 721 GGAAGAGGGCTCACAAGACACATTTGTCCCCCGGGCCCACCACATCATCCTCACGTGTTCGGTACTGAGCAGCCACTACC
 801 CCTGATGAGAACAGTATGAAGAAAGGGGGCTGTTGGAGTCCCAGAATTGCTGACAGCAGAGGCTTTGCTGCTGTGAATCC
 881 CACCTGCCACCAGCCTGCAGCACACCCCACAGCCAAGTAGAGGCGAAAGCAGTGGCTCATCCTACCTGTTAGGAGCAGGT
 961 AGGGCTTGTACTCACTTTAATTTGAATCTTATCAACTTACTCATAAAGGGACAGGCTAGCTAGCTGTGTTAGAAGTAGCA
1041 ATGACAATGACCAAGGACTGCTACACCTCTGATTACAATTCTGATGTGAAAAAGATGGTGTTTGGCTCTTATAGAGCCTG
1121 TGTGAAAGGCCCATGGATCAGCTCTTCCTGTGTTTGTAATTTAATGCTGCTACAAGATGTTTCTGTTTCTTAGATTCTGA
1201 CCATGACTCATAAGCTTCTTGTCATTCTTCATTGCTTGTTTGTGGTCACAGATGCACAACACTCCTCCAGTCTTGTGGGG
1281 GCAGCTTTTGGGAAGTCTCAGCAGCTCTTCTGGCTGTGTTGTCAGCACTGTAACTTCGCAGAAAAGAGTCGGATTACCAA
1361 AACACTGCCTGCTCTTCAGACTTAAAGCACTGATAGGACTTAAAATAGTCTCATTCAAATACTGTATTTTATATAGGCAT
1441 TTCACAAAAACAGCAAAATTGTGGCATTTTGTGAGGCCAAGGCTTGGATGCGTGTGTAATAGAGCCTTGTGGTGTGTGCG
1521 CACACACCCAGAGGGAGAGTTTGAAAAATGCTTATTGGACACGTAACCTGGCTCTAATTTGGGCTGTTTTTCAGATACAC
1601 TGTGATAAGTTCTTTTACAAATATCTATAGACATGGTAAACTTTTGGTTTTCAGATATGCTTAATGATAGTCTTACTAAA
1681 TGCAGAAATAAGAATAAACTTTCTCAAATTATTAAAAATGCCTACACAGTAAGTGTGAATTGCTGCAACAGGTTTGTTCT
1761 CAGGAGGGTAAGAACTCCAGGTCTAAACAGCTGACCCAGTGATGGGGAATTTATCCTTGACCAATTTATCCTTGACCAAT
1841 AACCTAATTGTCTATTCCTGAGTTATAAAAGTCCCCATCCTTATTAGCTCTACTGGAATTTTCATACACGTAAATGCAGA
1921 AGTTACTAAGTATTAAGTATTACTGAGTATTAAGTAGTAATCTGTCAGTTATTAAAATTTGTAAAATCTATTTATGAAAG
2001 GTCATTAAACCAGATCATGTTCCTTTTTTTGTAATCAAGGTGACTAAGAAAATCAGTTGTGTAAATAAAATCATGTATCA
2081 TAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ccgacAGUUAAG---UAUCCAGUc 5'
               || |||:   | |||||| 
Target 5' taaaaTCTATTTATGAAAGGTCAt 3'
1982 - 2005 124.00 -8.60
2
miRNA  3' ccGAC---AGU-UAAGUAUCCAGuc 5'
            |||   ||| || ::|:||||  
Target 5' ttCTGTGTTCACATGTGTGGGTCca 3'
309 - 333 123.00 -10.00
3
miRNA  3' ccGACAGUUAAGUAUCCAGUc 5'
            :|||| |||| |: ||:| 
Target 5' aaTTGTCTATTCCTGAGTTAt 3'
1846 - 1866 111.00 -8.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-192-5p :: RET    [ Functional MTI ]
Validation Method Microarray
Article - Georges, S. A. Biery, M. C. Kim, S. Y. et al.
- Cancer Res, 2008
Cell cycle arrest in response to DNA damage is an important antitumorigenic mechanism. MicroRNAs (miRNAs) were recently shown to play key regulatory roles in cell cycle progression. For example, miR-34a is induced in response to p53 activation and mediates G(1) arrest by down-regulating multiple cell cycle-related transcripts. Here we show that genotoxic stress promotes the p53-dependent up-regulation of the homologous miRNAs miR-192 and miR-215. Like miR-34a, activation of miR-192/215 induces cell cycle arrest, suggesting that multiple miRNA families operate in the p53 network. Furthermore, we define a downstream gene expression signature for miR-192/215 expression, which includes a number of transcripts that regulate G(1) and G(2) checkpoints. Of these transcripts, 18 transcripts are direct targets of miR-192/215, and the observed cell cycle arrest likely results from a cooperative effect among the modulations of these genes by the miRNAs. Our results showing a role for miR-192/215 in cell proliferation combined with recent observations that these miRNAs are underexpressed in primary cancers support the idea that miR-192 and miR-215 function as tumor suppressors.
LinkOut: [PMID: 19074876]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
942 hsa-miR-192-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004124 CLIC1 chloride intracellular channel 1 2 1
MIRT004125 PANX1 pannexin 1 2 2
MIRT004126 SPARC secreted protein, acidic, cysteine-rich (osteonectin) 2 1
MIRT004127 ODC1 ornithine decarboxylase 1 2 1
MIRT004128 DDOST dolichyl-diphosphooligosaccharide--protein glycosyltransferase 2 1
MIRT004129 ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 2 1
MIRT004130 EGR1 early growth response 1 2 2
MIRT004131 TFG TRK-fused gene 2 1
MIRT004132 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 2 2
MIRT004133 WDR44 WD repeat domain 44 2 1
MIRT004134 E2F5 E2F transcription factor 5, p130-binding 2 1
MIRT004135 LOXL2 lysyl oxidase-like 2 2 1
MIRT004136 KIDINS220 kinase D-interacting substrate, 220kDa 2 1
MIRT004137 XPA xeroderma pigmentosum, complementation group A 2 1
MIRT004138 BARD1 BRCA1 associated RING domain 1 2 2
MIRT004139 RBL2 retinoblastoma-like 2 (p130) 2 1
MIRT004140 RAB2A RAB2A, member RAS oncogene family 2 2
MIRT004141 CUL3 cullin 3 2 1
MIRT004142 MAP3K1 mitogen-activated protein kinase kinase kinase 1 2 1
MIRT004143 PERP PERP, TP53 apoptosis effector 2 2
MIRT004145 PIK3R4 phosphoinositide-3-kinase, regulatory subunit 4 2 1
MIRT004147 MFSD10 major facilitator superfamily domain containing 10 2 1
MIRT004148 C1D C1D nuclear receptor corepressor 2 2
MIRT004149 SEMA4D sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D 1 2
MIRT004150 RABGAP1 RAB GTPase activating protein 1 2 1
MIRT004151 ABCA8 ATP-binding cassette, sub-family A (ABC1), member 8 2 1
MIRT004152 ATP10D ATPase, class V, type 10D 2 1
MIRT004153 MSN moesin 2 2
MIRT004154 ERLIN2 ER lipid raft associated 2 2 1
MIRT004155 ABCC3 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 2 1
MIRT004156 GRIA1 glutamate receptor, ionotropic, AMPA 1 2 1
MIRT004157 ATXN7 ataxin 7 2 1
MIRT004158 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 2 1
MIRT004159 RRM1 ribonucleotide reductase M1 2 1
MIRT004160 ENTPD3 ectonucleoside triphosphate diphosphohydrolase 3 2 1
MIRT004161 B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) 2 2
MIRT004162 BRD3 bromodomain containing 3 2 1
MIRT004163 ALCAM activated leukocyte cell adhesion molecule 2 2
MIRT004164 STX7 syntaxin 7 2 2
MIRT004165 CD164 CD164 molecule, sialomucin 2 2
MIRT004166 PTP4A3 protein tyrosine phosphatase type IVA, member 3 2 1
MIRT004167 CADM1 cell adhesion molecule 1 2 1
MIRT004168 SETD4 SET domain containing 4 2 1
MIRT004169 PDE2A phosphodiesterase 2A, cGMP-stimulated 2 1
MIRT004170 AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 2 1
MIRT004171 ENOSF1 enolase superfamily member 1 2 1
MIRT004172 RANBP3 RAN binding protein 3 2 1
MIRT004173 GOLGA6A golgin A6 family, member A 2 1
MIRT004844 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT004845 CDC7 cell division cycle 7 homolog (S. cerevisiae) 5 1
MIRT004846 CUL5 cullin 5 5 1
MIRT004847 DLG5 discs, large homolog 5 (Drosophila) 4 1
MIRT004848 DTL denticleless homolog (Drosophila) 4 1
MIRT004849 ERCC3 excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing) 5 2
MIRT004850 HOXA10 homeobox A10 2 1
MIRT004851 HRH1 histamine receptor H1 4 1
MIRT004852 LMNB2 lamin B2 5 1
MIRT004853 MAD2L1 MAD2 mitotic arrest deficient-like 1 (yeast) 5 1
MIRT004854 MCM10 minichromosome maintenance complex component 10 4 1
MIRT004855 MIS12 MIS12, MIND kinetochore complex component, homolog (S. pombe) 4 1
MIRT004856 KIF20B kinesin family member 20B 4 1
MIRT004857 PIM1 pim-1 oncogene 5 2
MIRT004858 PRPF38A PRP38 pre-mRNA processing factor 38 (yeast) domain containing A 4 1
MIRT004859 RACGAP1 Rac GTPase activating protein 1 4 1
MIRT004860 SEPT10 septin 10 4 1
MIRT004861 SMARCB1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 4 1
MIRT004862 TRAPPC2P1 trafficking protein particle complex 2 pseudogene 1 2 1
MIRT005064 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 2 1
MIRT005582 WNK1 WNK lysine deficient protein kinase 1 4 1
MIRT006339 ACVR2B activin A receptor, type IIB 3 2
MIRT006435 RB1 retinoblastoma 1 4 2
MIRT006456 ERCC4 excision repair cross-complementing rodent repair deficiency, complementation group 4 4 2
MIRT007176 ATP1B1 ATPase, Na+/K+ transporting, beta 1 polypeptide 1 1
MIRT026102 ZFP30 zinc finger protein 30 homolog (mouse) 1 1
MIRT026103 NOB1 NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) 1 1
MIRT026104 C1QTNF3 C1q and tumor necrosis factor related protein 3 1 1
MIRT026105 SLC39A1 solute carrier family 39 (zinc transporter), member 1 1 1
MIRT026106 THOP1 thimet oligopeptidase 1 1 1
MIRT026107 ZNF641 zinc finger protein 641 1 1
MIRT026108 TMEM200A transmembrane protein 200A 1 1
MIRT026109 MED22 mediator complex subunit 22 1 1
MIRT026110 MMP20 matrix metallopeptidase 20 1 1
MIRT026111 BGLAP bone gamma-carboxyglutamate (gla) protein 1 1
MIRT026112 PTS 6-pyruvoyltetrahydropterin synthase 1 1
MIRT026113 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT026114 SLC46A3 solute carrier family 46, member 3 1 1
MIRT026115 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT026116 GPR137C G protein-coupled receptor 137C 1 1
MIRT026117 FANCI Fanconi anemia, complementation group I 1 1
MIRT026118 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 1
MIRT026119 CCZ1 chromosome 7 open reading frame 28A 1 1
MIRT026120 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 1 1
MIRT026121 BCORL1 BCL6 corepressor-like 1 1 1
MIRT026122 TCHP trichoplein, keratin filament binding 1 1
MIRT026123 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT026124 HOXA13 homeobox A13 1 1
MIRT026125 USP34 ubiquitin specific peptidase 34 1 1
MIRT026126 CA8 carbonic anhydrase VIII 1 1
MIRT026127 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT026128 SCMH1 sex comb on midleg homolog 1 (Drosophila) 1 1
MIRT026129 HCN4 hyperpolarization activated cyclic nucleotide-gated potassium channel 4 1 1
MIRT026130 DGCR11 DiGeorge syndrome critical region gene 11 1 1
MIRT026131 XIAP X-linked inhibitor of apoptosis 1 1
MIRT026132 SYNCRIP synaptotagmin binding, cytoplasmic RNA interacting protein 1 1
MIRT026133 TMC3 transmembrane channel-like 3 1 1
MIRT026134 CAB39L calcium binding protein 39-like 1 1
MIRT026135 FAM110C family with sequence similarity 110, member C 1 1
MIRT026136 PLS3 plastin 3 1 1
MIRT026137 TOR3A torsin family 3, member A 1 1
MIRT026138 CLK4 CDC-like kinase 4 1 1
MIRT026139 FERMT1 fermitin family homolog 1 (Drosophila) 1 1
MIRT026140 BBS7 Bardet-Biedl syndrome 7 1 1
MIRT026141 GINM1 chromosome 6 open reading frame 72 1 1
MIRT026142 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme 1 1
MIRT026143 SEC24D SEC24 family, member D (S. cerevisiae) 1 1
MIRT026144 KIF24 kinesin family member 24 1 1
MIRT026145 TOR1AIP1 torsin A interacting protein 1 1 1
MIRT026146 NIN ninein (GSK3B interacting protein) 1 1
MIRT026147 AP3M2 adaptor-related protein complex 3, mu 2 subunit 1 1
MIRT026148 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT026149 MTDH metadherin 1 1
MIRT026150 KIF5B kinesin family member 5B 1 1
MIRT026151 MCM3 minichromosome maintenance complex component 3 2 2
MIRT026152 UPP1 uridine phosphorylase 1 1 1
MIRT026153 NEDD1 neural precursor cell expressed, developmentally down-regulated 1 1 1
MIRT026154 RNF6 ring finger protein (C3H2C3 type) 6 1 1
MIRT026155 MOAP1 modulator of apoptosis 1 1 1
MIRT026156 ATG10 ATG10 autophagy related 10 homolog (S. cerevisiae) 1 1
MIRT026157 SGOL2 shugoshin-like 2 (S. pombe) 1 1
MIRT026158 ZNF449 zinc finger protein 449 1 1
MIRT026159 THBD thrombomodulin 1 1
MIRT026160 SCRN3 secernin 3 1 1
MIRT026161 PRDM4 PR domain containing 4 1 1
MIRT026162 RSBN1 round spermatid basic protein 1 1 1
MIRT026163 ZNF652 zinc finger protein 652 1 1
MIRT026164 TMEM194A transmembrane protein 194A 1 1
MIRT026165 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT026166 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT026167 FAM171B family with sequence similarity 171, member B 1 1
MIRT026168 IRAK4 interleukin-1 receptor-associated kinase 4 1 1
MIRT026169 PLK4 polo-like kinase 4 (Drosophila) 1 1
MIRT026170 DEAF1 deformed epidermal autoregulatory factor 1 (Drosophila) 1 1
MIRT026171 CDKN2D cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) 1 1
MIRT026172 RAB27A RAB27A, member RAS oncogene family 1 1
MIRT026173 MFI2 antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 1 1
MIRT026174 EMB embigin homolog (mouse) 1 1
MIRT026175 ERCC6L excision repair cross-complementing rodent repair deficiency, complementation group 6-like 1 1
MIRT026176 USP18 ubiquitin specific peptidase 18 1 1
MIRT026177 HMMR hyaluronan-mediated motility receptor (RHAMM) 1 1
MIRT026178 FGFR1OP FGFR1 oncogene partner 1 1
MIRT026179 RNF26 ring finger protein 26 1 1
MIRT026180 LEAP2 liver expressed antimicrobial peptide 2 1 1
MIRT026181 UGT8 UDP glycosyltransferase 8 1 1
MIRT026182 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 1
MIRT026183 SGCB sarcoglycan, beta (43kDa dystrophin-associated glycoprotein) 1 1
MIRT026184 NEIL3 nei endonuclease VIII-like 3 (E. coli) 1 1
MIRT026185 KIF5C kinesin family member 5C 1 1
MIRT026186 PSMD6 proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 1 1
MIRT026187 ZNF248 zinc finger protein 248 1 1
MIRT026188 TRAIP TRAF interacting protein 1 1
MIRT026189 GALNT12 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12) 1 1
MIRT026190 DUSP16 dual specificity phosphatase 16 1 1
MIRT026191 ZNF165 zinc finger protein 165 1 1
MIRT026192 OTUB2 OTU domain, ubiquitin aldehyde binding 2 1 1
MIRT026193 MSRB3 methionine sulfoxide reductase B3 1 1
MIRT026194 CMTM6 CKLF-like MARVEL transmembrane domain containing 6 1 1
MIRT026195 KIAA1841 KIAA1841 1 1
MIRT026196 RAD21 RAD21 homolog (S. pombe) 1 1
MIRT026197 CCDC176 chromosome 14 open reading frame 45 1 1
MIRT026198 AGL amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase 1 1
MIRT026199 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT026200 TOP1 topoisomerase (DNA) I 1 1
MIRT026201 LSM14B LSM14B, SCD6 homolog B (S. cerevisiae) 1 1
MIRT026202 PLOD1 procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1 1 1
MIRT026203 COQ3 coenzyme Q3 homolog, methyltransferase (S. cerevisiae) 1 1
MIRT026204 GULP1 GULP, engulfment adaptor PTB domain containing 1 1 1
MIRT026205 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT026206 PODXL podocalyxin-like 1 1
MIRT026207 TCF7 transcription factor 7 (T-cell specific, HMG-box) 1 1
MIRT026208 SGPP1 sphingosine-1-phosphate phosphatase 1 1 1
MIRT026209 UACA uveal autoantigen with coiled-coil domains and ankyrin repeats 1 1
MIRT026210 SYNGR1 synaptogyrin 1 1 1
MIRT026211 GATAD1 GATA zinc finger domain containing 1 1 1
MIRT026212 GRHL1 grainyhead-like 1 (Drosophila) 1 1
MIRT026213 OSBPL8 oxysterol binding protein-like 8 1 1
MIRT026214 NKRF NFKB repressing factor 1 1
MIRT026215 TMEM136 transmembrane protein 136 1 1
MIRT026216 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT026217 EMC1 KIAA0090 1 1
MIRT026218 CCDC174 chromosome 3 open reading frame 19 1 1
MIRT026219 SLC35B4 solute carrier family 35, member B4 1 1
MIRT026220 PLAU plasminogen activator, urokinase 1 1
MIRT026221 RFWD3 ring finger and WD repeat domain 3 1 1
MIRT026222 CLSTN1 calsyntenin 1 1 1
MIRT026223 GPR126 G protein-coupled receptor 126 1 1
MIRT026224 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT026225 RNF141 ring finger protein 141 1 1
MIRT026226 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT026227 DYRK1A dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A 1 1
MIRT026228 LHFPL4 lipoma HMGIC fusion partner-like 4 1 1
MIRT026229 SIX4 SIX homeobox 4 2 2
MIRT026230 KAT2B K(lysine) acetyltransferase 2B 1 1
MIRT026231 PPP2R3B protein phosphatase 2, regulatory subunit B', beta 1 1
MIRT026232 SMC2 structural maintenance of chromosomes 2 1 1
MIRT026233 TMEM164 transmembrane protein 164 1 1
MIRT026234 RNFT1 ring finger protein, transmembrane 1 1 1
MIRT026235 CCNE1 cyclin E1 1 1
MIRT026236 CENPE centromere protein E, 312kDa 1 1
MIRT026237 CHDH choline dehydrogenase 1 1
MIRT026238 COCH coagulation factor C homolog, cochlin (Limulus polyphemus) 1 1
MIRT026239 FBXO31 F-box protein 31 1 1
MIRT026240 GPSM2 G-protein signaling modulator 2 (AGS3-like, C. elegans) 1 1
MIRT026241 FAXC chromosome 6 open reading frame 168 1 1
MIRT026242 ANAPC15 chromosome 11 open reading frame 51 1 1
MIRT026243 UBE2D2 ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast) 1 1
MIRT026244 EAF2 ELL associated factor 2 1 1
MIRT026245 PLEKHG2 pleckstrin homology domain containing, family G (with RhoGef domain) member 2 1 1
MIRT026246 FUBP1 far upstream element (FUSE) binding protein 1 1 1
MIRT026247 NUF2 NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT026248 PAPD7 PAP associated domain containing 7 1 1
MIRT026249 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative function) 1 1
MIRT026250 NSF N-ethylmaleimide-sensitive factor 1 1
MIRT026251 FAM222A chromosome 12 open reading frame 34 1 1
MIRT026252 C9orf163 chromosome 9 open reading frame 163 1 1
MIRT026253 EPS8 epidermal growth factor receptor pathway substrate 8 1 1
MIRT026254 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT026255 GAB2 GRB2-associated binding protein 2 1 1
MIRT026256 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 1
MIRT026257 PXDN peroxidasin homolog (Drosophila) 1 1
MIRT026258 GNRH1 gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) 1 1
MIRT026259 ATP5L ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G 1 1
MIRT026260 ZBTB14 zinc finger protein 161 homolog (mouse) 1 1
MIRT026261 CLSPN claspin homolog (Xenopus laevis) 1 1
MIRT026262 CNEP1R1 transmembrane protein 188 1 1
MIRT026263 MCAM melanoma cell adhesion molecule 1 1
MIRT026264 GSG2 germ cell associated 2 (haspin) 1 1
MIRT026265 ZBTB18 zinc finger protein 238 1 1
MIRT026266 REEP1 receptor accessory protein 1 1 1
MIRT026267 TOP1P2 topoisomerase (DNA) I pseudogene 2 1 1
MIRT026268 OSBPL6 oxysterol binding protein-like 6 1 1
MIRT026269 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble) 1 1
MIRT026270 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 1 1
MIRT026271 BCOR BCL6 corepressor 1 1
MIRT026272 FAM63B family with sequence similarity 63, member B 1 1
MIRT026273 OPA1 optic atrophy 1 (autosomal dominant) 1 1
MIRT026274 AFAP1L1 actin filament associated protein 1-like 1 1 1
MIRT026275 RNASE4 ribonuclease, RNase A family, 4 1 1
MIRT026276 RASSF8 Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 1 1
MIRT026277 CEP55 centrosomal protein 55kDa 1 1
MIRT026278 ZIC5 Zic family member 5 (odd-paired homolog, Drosophila) 1 1
MIRT026279 PHF17 PHD finger protein 17 1 1
MIRT026280 FAM132B family with sequence similarity 132, member B 1 1
MIRT026281 MBNL3 muscleblind-like 3 (Drosophila) 1 1
MIRT026282 PCDH7 protocadherin 7 1 1
MIRT026283 IL6ST interleukin 6 signal transducer (gp130, oncostatin M receptor) 1 1
MIRT026284 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT026285 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT026286 SLC1A4 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 1 1
MIRT026287 ACSL1 acyl-CoA synthetase long-chain family member 1 1 1
MIRT026288 PLCE1 phospholipase C, epsilon 1 1 1
MIRT026289 SLC16A7 solute carrier family 16, member 7 (monocarboxylic acid transporter 2) 1 1
MIRT026290 COBLL1 COBL-like 1 1 1
MIRT026291 TDP1 tyrosyl-DNA phosphodiesterase 1 1 1
MIRT026292 LHFP lipoma HMGIC fusion partner 1 1
MIRT026293 KCTD15 potassium channel tetramerisation domain containing 15 1 1
MIRT026294 ZNF704 zinc finger protein 704 1 1
MIRT026295 NCBP1 nuclear cap binding protein subunit 1, 80kDa 1 1
MIRT026296 FKBP15 FK506 binding protein 15, 133kDa 1 1
MIRT026297 PSRC1 proline/serine-rich coiled-coil 1 1 1
MIRT026298 SNX13 sorting nexin 13 1 1
MIRT026299 UBE2W ubiquitin-conjugating enzyme E2W (putative) 1 1
MIRT026300 MRPL50 mitochondrial ribosomal protein L50 1 1
MIRT026301 ASRGL1 asparaginase like 1 1 1
MIRT026302 DIMT1 DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) 1 1
MIRT026303 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT026304 GAREML family with sequence similarity 59, member B 1 1
MIRT026305 TMEM30A transmembrane protein 30A 1 1
MIRT026306 RAB3B RAB3B, member RAS oncogene family 1 1
MIRT026307 GABPB2 GA binding protein transcription factor, beta subunit 2 1 1
MIRT026308 PRKD3 protein kinase D3 1 1
MIRT026309 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 1 1
MIRT026310 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT026311 FAM136A family with sequence similarity 136, member A 1 1
MIRT026312 CTCF CCCTC-binding factor (zinc finger protein) 1 1
MIRT026313 NCBP2 nuclear cap binding protein subunit 2, 20kDa 1 1
MIRT026314 TTPA tocopherol (alpha) transfer protein 1 1
MIRT026315 PAWR PRKC, apoptosis, WT1, regulator 1 1
MIRT026316 SKA1 spindle and kinetochore associated complex subunit 1 1 1
MIRT026317 TICAM2 toll-like receptor adaptor molecule 2 1 1
MIRT026318 KDELC2 KDEL (Lys-Asp-Glu-Leu) containing 2 1 1
MIRT026319 CDC20 cell division cycle 20 homolog (S. cerevisiae) 1 1
MIRT026320 BUB1B budding uninhibited by benzimidazoles 1 homolog beta (yeast) 1 1
MIRT026321 BTC betacellulin 1 1
MIRT026322 FAIM Fas apoptotic inhibitory molecule 1 1
MIRT026323 FZD1 frizzled homolog 1 (Drosophila) 1 1
MIRT026324 TOPBP1 topoisomerase (DNA) II binding protein 1 1 1
MIRT026325 CASC5 cancer susceptibility candidate 5 1 1
MIRT026326 HINT3 histidine triad nucleotide binding protein 3 1 1
MIRT026327 SLC16A6 solute carrier family 16, member 6 (monocarboxylic acid transporter 7) 1 1
MIRT026328 ZFP1 zinc finger protein 1 homolog (mouse) 1 1
MIRT026329 CCL3L1 chemokine (C-C motif) ligand 3-like 1 1 1
MIRT026330 CCDC15 coiled-coil domain containing 15 1 1
MIRT026331 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 1
MIRT026332 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT026333 PSMC3IP PSMC3 interacting protein 1 1
MIRT026334 SFR1 chromosome 10 open reading frame 78 1 1
MIRT026335 KHDRBS3 KH domain containing, RNA binding, signal transduction associated 3 1 1
MIRT026336 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT026337 AHSA2 AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) 1 1
MIRT026338 NCAPH non-SMC condensin I complex, subunit H 1 1
MIRT026339 NFIB nuclear factor I/B 1 1
MIRT026340 CHML choroideremia-like (Rab escort protein 2) 1 1
MIRT026341 RSBN1L round spermatid basic protein 1-like 1 1
MIRT026342 OSBPL10 oxysterol binding protein-like 10 1 1
MIRT026343 EHBP1L1 EH domain binding protein 1-like 1 1 1
MIRT026344 C18orf54 chromosome 18 open reading frame 54 1 1
MIRT026345 CKAP4 cytoskeleton-associated protein 4 1 1
MIRT026346 EPM2AIP1 EPM2A (laforin) interacting protein 1 1 1
MIRT026347 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 1
MIRT026348 POLQ polymerase (DNA directed), theta 1 1
MIRT026349 CNTNAP3 contactin associated protein-like 3 1 1
MIRT026350 BIVM basic, immunoglobulin-like variable motif containing 1 1
MIRT026351 TNFSF13 tumor necrosis factor (ligand) superfamily, member 13 1 1
MIRT026352 SAMD3 sterile alpha motif domain containing 3 1 1
MIRT026353 UBE2D1 ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) 1 1
MIRT026354 TOR1B torsin family 1, member B (torsin B) 1 1
MIRT026355 CLN6 ceroid-lipofuscinosis, neuronal 6, late infantile, variant 1 1
MIRT026356 FBXW2 F-box and WD repeat domain containing 2 1 1
MIRT026357 ZNF230 zinc finger protein 230 1 1
MIRT026358 CCNY cyclin Y 1 1
MIRT026359 ARHGAP29 Rho GTPase activating protein 29 1 1
MIRT026360 CLVS1 clavesin 1 1 1
MIRT026361 OGFRL1 opioid growth factor receptor-like 1 1 1
MIRT026362 BTF3L4 basic transcription factor 3-like 4 1 1
MIRT026363 CERS6 LAG1 homolog, ceramide synthase 6 1 1
MIRT026364 FAM199X family with sequence similarity 199, X-linked 1 1
MIRT026365 ICK intestinal cell (MAK-like) kinase 1 1
MIRT026366 NKX3-1 NK3 homeobox 1 1 1
MIRT026367 HIBADH 3-hydroxyisobutyrate dehydrogenase 1 1
MIRT026368 PPARG peroxisome proliferator-activated receptor gamma 1 1
MIRT026369 PITPNB phosphatidylinositol transfer protein, beta 1 1
MIRT026370 LARS leucyl-tRNA synthetase 1 1
MIRT026371 ZNF780A zinc finger protein 780A 1 1
MIRT026372 TMEM2 transmembrane protein 2 1 1
MIRT026373 MCM9 minichromosome maintenance complex component 9 1 1
MIRT026374 KCNMB4 potassium large conductance calcium-activated channel, subfamily M, beta member 4 1 1
MIRT026375 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT026376 LMAN1 lectin, mannose-binding, 1 1 1
MIRT026377 DHFRL1 dihydrofolate reductase-like 1 1 1
MIRT026378 LYRM7 Lyrm7 homolog (mouse) 1 1
MIRT026379 RAD1 RAD1 homolog (S. pombe) 1 1
MIRT026380 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) 1 1
MIRT026381 USP14 ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) 1 1
MIRT026382 UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT026383 EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa 1 1
MIRT026384 WDR67 WD repeat domain 67 1 1
MIRT026385 LGMN legumain 1 1
MIRT026386 PARN poly(A)-specific ribonuclease (deadenylation nuclease) 1 1
MIRT026387 NHSL1 NHS-like 1 1 1
MIRT026388 RIMKLA ribosomal modification protein rimK-like family member A 1 1
MIRT026389 ZNF215 zinc finger protein 215 1 1
MIRT026390 TCAM1P testicular cell adhesion molecule 1 homolog (mouse), pseudogene 1 1
MIRT026391 C17orf58 chromosome 17 open reading frame 58 1 1
MIRT026392 CLK1 CDC-like kinase 1 1 1
MIRT026393 TTK TTK protein kinase 1 1
MIRT026394 ELOVL5 ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) 1 1
MIRT026395 CREBZF CREB/ATF bZIP transcription factor 1 1
MIRT026396 CFL2 cofilin 2 (muscle) 1 1
MIRT026397 ID1 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein 1 1
MIRT026398 LRRC8C leucine rich repeat containing 8 family, member C 1 1
MIRT026399 NT5M 5',3'-nucleotidase, mitochondrial 1 1
MIRT026400 MTSS1 metastasis suppressor 1 1 1
MIRT026401 RCBTB2 regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2 1 1
MIRT026402 TMEM246 chromosome 9 open reading frame 125 1 1
MIRT026403 PHC2 polyhomeotic homolog 2 (Drosophila) 1 1
MIRT026404 NPNT nephronectin 1 1
MIRT026405 AKAP7 A kinase (PRKA) anchor protein 7 1 1
MIRT026406 GLCCI1 glucocorticoid induced transcript 1 1 1
MIRT026407 ZSWIM3 zinc finger, SWIM-type containing 3 1 1
MIRT026408 ARHGEF26 Src homology 3 domain-containing guanine nucleotide exchange factor 1 1
MIRT026409 ZNF184 zinc finger protein 184 1 1
MIRT026410 TMPO thymopoietin 1 1
MIRT026411 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT026412 ACTR1B ARP1 actin-related protein 1 homolog B, centractin beta (yeast) 1 1
MIRT026413 EOGT chromosome 3 open reading frame 64 1 1
MIRT026414 CDK14 cyclin-dependent kinase 14 1 1
MIRT026415 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT026416 C12orf65 chromosome 12 open reading frame 65 1 1
MIRT026417 SPRY4 sprouty homolog 4 (Drosophila) 1 1
MIRT026418 KBTBD11 kelch repeat and BTB (POZ) domain containing 11 1 1
MIRT026419 DIS3L DIS3 mitotic control homolog (S. cerevisiae)-like 1 1
MIRT026420 C1orf53 chromosome 1 open reading frame 53 1 1
MIRT026421 C6orf62 chromosome 6 open reading frame 62 1 1
MIRT026422 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT026423 KLHL23 kelch-like 23 (Drosophila) 1 1
MIRT026424 ICAM3 intercellular adhesion molecule 3 1 1
MIRT026425 ZNF823 zinc finger protein 823 1 1
MIRT026426 IFRD1 interferon-related developmental regulator 1 1 1
MIRT026427 CORO2B coronin, actin binding protein, 2B 1 1
MIRT026428 RNF219 ring finger protein 219 1 1
MIRT026429 SERTAD4 SERTA domain containing 4 1 1
MIRT026430 HES6 hairy and enhancer of split 6 (Drosophila) 1 1
MIRT026431 TMEM169 transmembrane protein 169 1 1
MIRT026432 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 1 1
MIRT026433 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT026434 MRPL43 mitochondrial ribosomal protein L43 1 1
MIRT026435 C2orf49 chromosome 2 open reading frame 49 1 1
MIRT026436 METTL9 methyltransferase like 9 1 1
MIRT026437 FBXO36 F-box protein 36 1 1
MIRT026438 TFCP2L1 transcription factor CP2-like 1 1 1
MIRT026439 CTPS2 CTP synthase II 1 1
MIRT026440 SLC39A9 solute carrier family 39 (zinc transporter), member 9 1 1
MIRT026441 HIATL1 hippocampus abundant transcript-like 1 1 1
MIRT026442 PRNP prion protein 1 1
MIRT026443 ATF1 activating transcription factor 1 1 1
MIRT026444 FHDC1 FH2 domain containing 1 1 1
MIRT026445 SLC26A2 solute carrier family 26 (sulfate transporter), member 2 1 1
MIRT026446 FGF2 fibroblast growth factor 2 (basic) 1 1
MIRT026447 STK3 serine/threonine kinase 3 (STE20 homolog, yeast) 1 1
MIRT026448 ACVR2A activin A receptor, type IIA 1 1
MIRT026449 RNPC3 RNA-binding region (RNP1, RRM) containing 3 1 1
MIRT026450 TRAF3IP3 TRAF3 interacting protein 3 1 1
MIRT026451 PIP4K2B phosphatidylinositol-5-phosphate 4-kinase, type II, beta 1 1
MIRT026452 NIPAL1 NIPA-like domain containing 1 1 1
MIRT026453 PAK6 p21 protein (Cdc42/Rac)-activated kinase 6 1 1
MIRT026454 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 1
MIRT026455 ZNF263 zinc finger protein 263 1 1
MIRT026456 WDR76 WD repeat domain 76 1 1
MIRT026457 BICD1 bicaudal D homolog 1 (Drosophila) 1 1
MIRT026458 BTNL9 butyrophilin-like 9 1 1
MIRT026459 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT026460 ASPM asp (abnormal spindle) homolog, microcephaly associated (Drosophila) 1 1
MIRT026461 MXI1 MAX interactor 1 1 1
MIRT026462 WWC3 WWC family member 3 1 1
MIRT026463 LRRC58 leucine rich repeat containing 58 1 1
MIRT026464 C1orf198 chromosome 1 open reading frame 198 1 1
MIRT026465 ZNF443 zinc finger protein 443 1 1
MIRT026466 MT1X metallothionein 1X 1 1
MIRT026467 RP9P retinitis pigmentosa 9 pseudogene 1 1
MIRT026468 HJURP Holliday junction recognition protein 1 1
MIRT026469 EFCAB11 chromosome 14 open reading frame 143 1 1
MIRT026470 KPNA5 karyopherin alpha 5 (importin alpha 6) 1 1
MIRT026471 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 1
MIRT026472 HERC2 hect domain and RLD 2 1 1
MIRT026473 CYP24A1 cytochrome P450, family 24, subfamily A, polypeptide 1 1 1
MIRT026474 CA13 carbonic anhydrase XIII 1 1
MIRT026475 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT026476 CCDC18 coiled-coil domain containing 18 1 1
MIRT026477 TEX30 chromosome 13 open reading frame 27 1 1
MIRT026478 UQCRC2 ubiquinol-cytochrome c reductase core protein II 1 1
MIRT026479 RFC4 replication factor C (activator 1) 4, 37kDa 1 1
MIRT026480 CENPF centromere protein F, 350/400ka (mitosin) 1 1
MIRT026481 FAM83D family with sequence similarity 83, member D 1 1
MIRT026482 MANF mesencephalic astrocyte-derived neurotrophic factor 1 1
MIRT026483 PASK PAS domain containing serine/threonine kinase 1 1
MIRT026484 ZNF701 zinc finger protein 701 1 1
MIRT026485 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT026486 PPM1A protein phosphatase, Mg2+/Mn2+ dependent, 1A 1 1
MIRT026487 DEPDC1 DEP domain containing 1 1 1
MIRT026488 RPGRIP1L RPGRIP1-like 1 1
MIRT026489 C21orf91 chromosome 21 open reading frame 91 1 1
MIRT026490 ST3GAL6 ST3 beta-galactoside alpha-2,3-sialyltransferase 6 1 1
MIRT026491 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 1
MIRT026492 MNS1 meiosis-specific nuclear structural 1 1 1
MIRT026493 DEGS1 degenerative spermatocyte homolog 1, lipid desaturase (Drosophila) 1 1
MIRT026494 SPAG9 sperm associated antigen 9 1 1
MIRT026495 DSN1 DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT026496 STIL SCL/TAL1 interrupting locus 1 1
MIRT026497 TMED10 transmembrane emp24-like trafficking protein 10 (yeast) 1 1
MIRT026498 IL17RB interleukin 17 receptor B 1 1
MIRT026499 ZNF525 zinc finger protein 525 1 1
MIRT026500 CCDC150 coiled-coil domain containing 150 1 1
MIRT026501 ARNTL2 aryl hydrocarbon receptor nuclear translocator-like 2 1 1
MIRT026502 ZC3H12C zinc finger CCCH-type containing 12C 1 1
MIRT026503 HCN3 hyperpolarization activated cyclic nucleotide-gated potassium channel 3 1 1
MIRT026504 ECT2 epithelial cell transforming sequence 2 oncogene 1 1
MIRT026505 RBP7 retinol binding protein 7, cellular 1 1
MIRT026506 FAM20B family with sequence similarity 20, member B 1 1
MIRT026507 LRP8 low density lipoprotein receptor-related protein 8, apolipoprotein e receptor 1 1
MIRT026508 SEC23B Sec23 homolog B (S. cerevisiae) 1 1
MIRT026509 FOXA1 forkhead box A1 1 1
MIRT026510 CCDC47 coiled-coil domain containing 47 1 1
MIRT026511 BMP2K BMP2 inducible kinase 1 1
MIRT026512 EPM2A epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) 1 1
MIRT026513 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 1 1
MIRT026514 FBXO3 F-box protein 3 1 1
MIRT026515 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 1
MIRT026516 HOXB9 homeobox B9 1 1
MIRT026517 NEK1 NIMA (never in mitosis gene a)-related kinase 1 1 1
MIRT026518 C2orf44 chromosome 2 open reading frame 44 1 1
MIRT026519 TBC1D22B TBC1 domain family, member 22B 1 1
MIRT026520 TRIP13 thyroid hormone receptor interactor 13 1 1
MIRT026521 RAB6C RAB6C, member RAS oncogene family 1 1
MIRT026522 ZMYM1 zinc finger, MYM-type 1 1 1
MIRT026523 FAM126A family with sequence similarity 126, member A 1 1
MIRT026524 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 1 1
MIRT026525 CKAP2L cytoskeleton associated protein 2-like 1 1
MIRT026526 SLC25A30 solute carrier family 25, member 30 1 1
MIRT026527 IDI1 isopentenyl-diphosphate delta isomerase 1 1 1
MIRT026528 LMLN leishmanolysin-like (metallopeptidase M8 family) 1 1
MIRT026529 PRICKLE1 prickle homolog 1 (Drosophila) 1 1
MIRT026530 LIPA lipase A, lysosomal acid, cholesterol esterase 1 1
MIRT026531 NLK nemo-like kinase 1 1
MIRT026532 IL15 interleukin 15 1 1
MIRT026533 TICRR chromosome 15 open reading frame 42 1 1
MIRT026534 BRCA1 breast cancer 1, early onset 1 1
MIRT026535 RSRC1 arginine/serine-rich coiled-coil 1 1 1
MIRT026536 SH3BP4 SH3-domain binding protein 4 1 1
MIRT026537 PRPS2 phosphoribosyl pyrophosphate synthetase 2 1 1
MIRT026538 CENPK centromere protein K 1 1
MIRT026539 TRIM59 tripartite motif-containing 59 1 1
MIRT026540 CSGALNACT2 chondroitin sulfate N-acetylgalactosaminyltransferase 2 1 1
MIRT026541 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT026542 SP4 Sp4 transcription factor 1 1
MIRT026543 RAB11FIP2 RAB11 family interacting protein 2 (class I) 1 1
MIRT026544 GPR37 G protein-coupled receptor 37 (endothelin receptor type B-like) 1 1
MIRT026545 CENPA centromere protein A 1 1
MIRT026546 RAP1GAP RAP1 GTPase activating protein 1 1
MIRT026547 SMC4 structural maintenance of chromosomes 4 1 1
MIRT026548 APOLD1 apolipoprotein L domain containing 1 1 1
MIRT026549 VGLL3 vestigial like 3 (Drosophila) 1 1
MIRT026550 MAPK9 mitogen-activated protein kinase 9 1 1
MIRT026551 KCNS3 potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 1 1
MIRT026552 STAMBPL1 STAM binding protein-like 1 1 1
MIRT026553 LARP1B La ribonucleoprotein domain family, member 1B 1 1
MIRT026554 CENPI centromere protein I 1 1
MIRT026555 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT026556 TMEFF1 transmembrane protein with EGF-like and two follistatin-like domains 1 1 1
MIRT026557 FBN1 fibrillin 1 1 1
MIRT026558 TMTC4 transmembrane and tetratricopeptide repeat containing 4 1 1
MIRT026559 GPC4 glypican 4 1 1
MIRT026560 ALG10B asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast) 1 1
MIRT026561 RDM1 RAD52 motif 1 1 1
MIRT026562 ANAPC10 anaphase promoting complex subunit 10 1 1
MIRT026563 GPR19 G protein-coupled receptor 19 1 1
MIRT026564 ZNHIT3 zinc finger, HIT type 3 1 1
MIRT026565 SBDSP1 Shwachman-Bodian-Diamond syndrome pseudogene 1 1 1
MIRT026566 N4BP2 NEDD4 binding protein 2 1 1
MIRT026567 FANCM Fanconi anemia, complementation group M 1 1
MIRT026568 ATRNL1 attractin-like 1 1 1
MIRT026569 LYPD6 LY6/PLAUR domain containing 6 1 1
MIRT026570 AP1S2 adaptor-related protein complex 1, sigma 2 subunit 1 1
MIRT026571 PPP1R12A protein phosphatase 1, regulatory (inhibitor) subunit 12A 1 1
MIRT026572 LAMTOR5 hepatitis B virus x interacting protein 1 1
MIRT026573 ZFYVE28 zinc finger, FYVE domain containing 28 1 1
MIRT026574 FZD4 frizzled homolog 4 (Drosophila) 1 1
MIRT026575 MRPL13 mitochondrial ribosomal protein L13 1 1
MIRT026576 TPM4 tropomyosin 4 1 1
MIRT026577 STK17B serine/threonine kinase 17b 1 1
MIRT026578 TMEM17 transmembrane protein 17 1 1
MIRT026579 CYP4V2 cytochrome P450, family 4, subfamily V, polypeptide 2 1 1
MIRT026580 HAS3 hyaluronan synthase 3 1 1
MIRT026581 ERMP1 endoplasmic reticulum metallopeptidase 1 1 1
MIRT026582 SGMS2 sphingomyelin synthase 2 1 1
MIRT026583 SLC16A14 solute carrier family 16, member 14 (monocarboxylic acid transporter 14) 1 1
MIRT026584 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT026585 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 1 1
MIRT026586 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT026587 ITGAV integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) 1 1
MIRT026588 KIAA1143 KIAA1143 1 1
MIRT026589 ZDHHC2 zinc finger, DHHC-type containing 2 1 1
MIRT026590 NCEH1 neutral cholesterol ester hydrolase 1 1 1
MIRT026591 PCGF5 polycomb group ring finger 5 1 1
MIRT026592 PHTF2 putative homeodomain transcription factor 2 1 1
MIRT026593 SLC35F3 solute carrier family 35, member F3 1 1
MIRT026594 KLHL42 kelch domain containing 5 1 1
MIRT026595 PTPRE protein tyrosine phosphatase, receptor type, E 1 1
MIRT026596 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT026597 RPAP2 RNA polymerase II associated protein 2 1 1
MIRT026598 ELOVL1 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 1 1
MIRT026599 DDX54 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 1 1
MIRT026600 PKP4 plakophilin 4 1 1
MIRT026601 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa 1 1
MIRT026602 INIP chromosome 9 open reading frame 80 1 1
MIRT026603 PHF10 PHD finger protein 10 1 1
MIRT026604 ANKRD32 ankyrin repeat domain 32 1 1
MIRT026605 C1orf112 chromosome 1 open reading frame 112 1 1
MIRT026606 DEK DEK oncogene 1 1
MIRT026607 ATG4A ATG4 autophagy related 4 homolog A (S. cerevisiae) 1 1
MIRT026608 ALG10 asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe) 1 1
MIRT026609 DBF4B DBF4 homolog B (S. cerevisiae) 1 1
MIRT026610 ANG angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT026611 FADS1 fatty acid desaturase 1 1 1
MIRT026612 DST dystonin 1 1
MIRT026613 SPIN4 spindlin family, member 4 1 1
MIRT026614 MTERFD1 MTERF domain containing 1 1 1
MIRT026615 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 1 1
MIRT026616 ANLN anillin, actin binding protein 1 1
MIRT026617 LRRFIP2 leucine rich repeat (in FLII) interacting protein 2 1 1
MIRT026618 PHTF1 putative homeodomain transcription factor 1 1 1
MIRT026619 MT1F metallothionein 1F 1 1
MIRT026620 UNG uracil-DNA glycosylase 1 1
MIRT026621 USP12 ubiquitin specific peptidase 12 1 1
MIRT026622 INSIG1 insulin induced gene 1 1 1
MIRT026623 PPP1R26 KIAA0649 1 1
MIRT026624 PRADC1 chromosome 2 open reading frame 7 1 1
MIRT026625 GCH1 GTP cyclohydrolase 1 1 1
MIRT026626 GLTSCR1L KIAA0240 1 1
MIRT026627 ALDH5A1 aldehyde dehydrogenase 5 family, member A1 1 1
MIRT026628 PHF6 PHD finger protein 6 1 1
MIRT026629 IMPA1 inositol(myo)-1(or 4)-monophosphatase 1 1 1
MIRT026630 DHFR dihydrofolate reductase 1 1
MIRT026631 CEP19 chromosome 3 open reading frame 34 1 1
MIRT026632 ANO6 anoctamin 6 1 1
MIRT026633 NMI N-myc (and STAT) interactor 1 1
MIRT026634 C10orf35 chromosome 10 open reading frame 35 1 1
MIRT026635 C4orf32 chromosome 4 open reading frame 32 1 1
MIRT026636 RPAP3 RNA polymerase II associated protein 3 1 1
MIRT026637 MIS18BP1 chromosome 14 open reading frame 106 1 1
MIRT026638 TRPV1 transient receptor potential cation channel, subfamily V, member 1 1 1
MIRT026639 CCSAP chromosome 1 open reading frame 96 1 1
MIRT026640 POLA2 polymerase (DNA directed), alpha 2 (70kD subunit) 1 1
MIRT026641 LOC81691 exonuclease NEF-sp 1 1
MIRT026642 PAPD5 PAP associated domain containing 5 1 1
MIRT026643 TMEM66 transmembrane protein 66 1 1
MIRT026644 TMEM106A transmembrane protein 106A 1 1
MIRT026645 ARL4C ADP-ribosylation factor-like 4C 1 1
MIRT026646 USP45 ubiquitin specific peptidase 45 1 1
MIRT026647 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT026648 SLC25A40 solute carrier family 25, member 40 1 1
MIRT026649 HS3ST3B1 heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1 1 1
MIRT026650 ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 1 1
MIRT026651 NCOA3 nuclear receptor coactivator 3 1 1
MIRT026652 KLF10 Kruppel-like factor 10 1 1
MIRT026653 FNBP1 formin binding protein 1 1 1
MIRT026654 IQCC IQ motif containing C 1 1
MIRT026655 NAB1 NGFI-A binding protein 1 (EGR1 binding protein 1) 1 1
MIRT026656 DENND1A DENN/MADD domain containing 1A 1 1
MIRT026657 MTMR12 myotubularin related protein 12 1 1
MIRT026658 USP54 ubiquitin specific peptidase 54 1 1
MIRT026659 NUDT15 nudix (nucleoside diphosphate linked moiety X)-type motif 15 1 1
MIRT026660 SS18 synovial sarcoma translocation, chromosome 18 1 1
MIRT026661 TDG thymine-DNA glycosylase 1 1
MIRT026662 EMC7 chromosome 15 open reading frame 24 1 1
MIRT026663 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 1 1
MIRT026664 NREP chromosome 5 open reading frame 13 1 1
MIRT026665 SEC63 SEC63 homolog (S. cerevisiae) 1 1
MIRT026666 CHM choroideremia (Rab escort protein 1) 1 1
MIRT026667 SLCO3A1 solute carrier organic anion transporter family, member 3A1 1 1
MIRT026668 HAUS3 HAUS augmin-like complex, subunit 3 1 1
MIRT026669 ZXDC ZXD family zinc finger C 1 1
MIRT026670 CCDC121 coiled-coil domain containing 121 1 1
MIRT026671 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT026672 LIN9 lin-9 homolog (C. elegans) 1 1
MIRT026673 SLC25A51 mitochondrial carrier triple repeat 1 1 1
MIRT026674 CPSF6 cleavage and polyadenylation specific factor 6, 68kDa 1 1
MIRT026675 TIFA TRAF-interacting protein with forkhead-associated domain 1 1
MIRT026676 EME1 essential meiotic endonuclease 1 homolog 1 (S. pombe) 1 1
MIRT026677 PARM1 prostate androgen-regulated mucin-like protein 1 1 1
MIRT026678 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT026679 CCDC14 coiled-coil domain containing 14 1 1
MIRT026680 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT026681 TMEM180 transmembrane protein 180 1 1
MIRT026682 LMNB1 lamin B1 1 1
MIRT026683 WNT3 wingless-type MMTV integration site family, member 3 1 1
MIRT026684 MIPOL1 mirror-image polydactyly 1 1 1
MIRT026685 BRCA2 breast cancer 2, early onset 1 1
MIRT026686 TJP2 tight junction protein 2 (zona occludens 2) 1 1
MIRT026687 KIF18A kinesin family member 18A 1 1
MIRT026688 UVRAG UV radiation resistance associated gene 1 1
MIRT026689 TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b 1 1
MIRT026690 TPGS2 chromosome 18 open reading frame 10 1 1
MIRT026691 PABPC4 poly(A) binding protein, cytoplasmic 4 (inducible form) 1 1
MIRT026692 EEF1A2 eukaryotic translation elongation factor 1 alpha 2 1 1
MIRT026693 RAB23 RAB23, member RAS oncogene family 1 1
MIRT026694 TARDBP TAR DNA binding protein 1 1
MIRT026695 ZNF226 zinc finger protein 226 1 1
MIRT026696 SERAC1 serine active site containing 1 1 1
MIRT026697 SLC9A5 solute carrier family 9 (sodium/hydrogen exchanger), member 5 1 1
MIRT026698 ARHGEF10 Rho guanine nucleotide exchange factor (GEF) 10 1 1
MIRT026699 NOXO1 NADPH oxidase organizer 1 1 1
MIRT026700 PPP2R2D protein phosphatase 2, regulatory subunit B, delta 1 1
MIRT026701 ATAD5 ATPase family, AAA domain containing 5 1 1
MIRT026702 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 1 1
MIRT026703 RTKN2 rhotekin 2 1 1
MIRT026704 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT026705 PGM3 phosphoglucomutase 3 1 1
MIRT026706 HADH hydroxyacyl-CoA dehydrogenase 1 1
MIRT026707 CCDC7 coiled-coil domain containing 7 1 1
MIRT026708 MAP6D1 MAP6 domain containing 1 1 1
MIRT026709 PRSS23 protease, serine, 23 1 1
MIRT026710 GAS2L3 growth arrest-specific 2 like 3 1 1
MIRT026711 ZNF85 zinc finger protein 85 1 1
MIRT026712 HESX1 HESX homeobox 1 1 1
MIRT026713 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT026714 RET ret proto-oncogene 1 1
MIRT026715 GID8 chromosome 20 open reading frame 11 1 1
MIRT026716 KIF23 kinesin family member 23 1 1
MIRT026717 CHPT1 choline phosphotransferase 1 1 1
MIRT026718 EPDR1 ependymin related protein 1 (zebrafish) 1 1
MIRT026719 LRIG1 leucine-rich repeats and immunoglobulin-like domains 1 1 1
MIRT026720 MPZL1 myelin protein zero-like 1 1 1
MIRT026721 ZNF519 zinc finger protein 519 1 1
MIRT026722 NFYA nuclear transcription factor Y, alpha 1 1
MIRT026723 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT026724 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 1 1
MIRT026725 C1orf86 chromosome 1 open reading frame 86 1 1
MIRT026726 MIB1 mindbomb homolog 1 (Drosophila) 1 1
MIRT026727 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT026728 UBL3 ubiquitin-like 3 1 1
MIRT026729 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT026730 KDM4D lysine (K)-specific demethylase 4D 1 1
MIRT026731 ASPH aspartate beta-hydroxylase 1 1
MIRT026732 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT026733 FAM71E1 family with sequence similarity 71, member E1 1 1
MIRT026734 ZNF320 zinc finger protein 320 1 1
MIRT026735 GEN1 Gen homolog 1, endonuclease (Drosophila) 1 1
MIRT026736 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT026737 RAB1A RAB1A, member RAS oncogene family 1 1
MIRT026738 MAP1LC3B microtubule-associated protein 1 light chain 3 beta 1 1
MIRT026739 BYSL bystin-like 1 1
MIRT026740 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT026741 PIGM phosphatidylinositol glycan anchor biosynthesis, class M 2 2
MIRT026742 XK X-linked Kx blood group (McLeod syndrome) 1 1
MIRT026743 RADIL Ras association and DIL domains 1 1
MIRT026744 CEP128 chromosome 14 open reading frame 145 1 1
MIRT026745 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT026746 BCL2L13 BCL2-like 13 (apoptosis facilitator) 1 1
MIRT026747 CADPS2 Ca++-dependent secretion activator 2 1 1
MIRT026748 ZNF346 zinc finger protein 346 1 1
MIRT026749 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT026750 CKLF chemokine-like factor 1 1
MIRT026751 CDKN3 cyclin-dependent kinase inhibitor 3 1 1
MIRT026752 E2F8 E2F transcription factor 8 1 1
MIRT026753 ATAD1 ATPase family, AAA domain containing 1 1 1
MIRT026754 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT026755 SOWAHC ankyrin repeat domain 57 1 1
MIRT026756 ZNF200 zinc finger protein 200 1 1
MIRT026757 SAMD13 sterile alpha motif domain containing 13 1 1
MIRT026758 FAM189A2 family with sequence similarity 189, member A2 1 1
MIRT026759 CD83 CD83 molecule 1 1
MIRT026760 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 1 1
MIRT026761 SATB2 SATB homeobox 2 1 1
MIRT026762 EEA1 early endosome antigen 1 1 1
MIRT026763 DBT dihydrolipoamide branched chain transacylase E2 1 1
MIRT026764 SLC48A1 solute carrier family 48 (heme transporter), member 1 1 1
MIRT026765 ORC1 origin recognition complex, subunit 1-like (yeast) 1 1
MIRT026766 CCZ1B chromosome 7 open reading frame 28B 1 1
MIRT026767 NPTXR neuronal pentraxin receptor 1 1
MIRT026768 NOD2 nucleotide-binding oligomerization domain containing 2 1 1
MIRT026769 ZNF45 zinc finger protein 45 1 1
MIRT026770 BRIP1 BRCA1 interacting protein C-terminal helicase 1 1 1
MIRT026771 SAP30 Sin3A-associated protein, 30kDa 1 1
MIRT026772 CHSY3 chondroitin sulfate synthase 3 1 1
MIRT026773 LRRCC1 leucine rich repeat and coiled-coil domain containing 1 1 1
MIRT026774 NMU neuromedin U 1 1
MIRT026775 GPR180 G protein-coupled receptor 180 1 1
MIRT026776 INPP5F inositol polyphosphate-5-phosphatase F 1 1
MIRT026777 FAM101B family with sequence similarity 101, member B 1 1
MIRT026778 IRX4 iroquois homeobox 4 1 1
MIRT026779 RUFY3 RUN and FYVE domain containing 3 1 1
MIRT026780 PLEKHF2 pleckstrin homology domain containing, family F (with FYVE domain) member 2 1 1
MIRT026781 IL7 interleukin 7 1 1
MIRT026782 CDCA4 cell division cycle associated 4 1 1
MIRT026783 SNX10 sorting nexin 10 1 1
MIRT026784 C5orf34 chromosome 5 open reading frame 34 1 1
MIRT026785 NHLRC3 NHL repeat containing 3 1 1
MIRT026786 LIMCH1 LIM and calponin homology domains 1 1 1
MIRT026787 FBXO4 F-box protein 4 1 1
MIRT026788 CEP78 centrosomal protein 78kDa 1 1
MIRT026789 NBN nibrin 1 1
MIRT026790 UCK1 uridine-cytidine kinase 1 1 1
MIRT026791 PURA purine-rich element binding protein A 1 1
MIRT026792 PDLIM3 PDZ and LIM domain 3 1 1
MIRT026793 HSPBAP1 HSPB (heat shock 27kDa) associated protein 1 1 1
MIRT026794 STXBP4 syntaxin binding protein 4 1 1
MIRT026795 KIF15 kinesin family member 15 1 1
MIRT026796 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT026797 DNAJB5 DnaJ (Hsp40) homolog, subfamily B, member 5 1 1
MIRT026798 IQGAP1 IQ motif containing GTPase activating protein 1 1 1
MIRT026799 ACSF3 acyl-CoA synthetase family member 3 1 1
MIRT026800 RAD54B RAD54 homolog B (S. cerevisiae) 1 1
MIRT026801 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT026802 EXTL2 exostoses (multiple)-like 2 1 1
MIRT026803 USP1 ubiquitin specific peptidase 1 1 1
MIRT026804 UBIAD1 UbiA prenyltransferase domain containing 1 1 1
MIRT026805 CGNL1 cingulin-like 1 1 1
MIRT026806 B4GALT6 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 1 1
MIRT026807 SOAT1 sterol O-acyltransferase 1 1 1
MIRT026808 MCM6 minichromosome maintenance complex component 6 1 1
MIRT026809 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT026810 SPATA13 spermatogenesis associated 13 1 1
MIRT026811 C16orf46 chromosome 16 open reading frame 46 1 1
MIRT026812 MKL2 MKL/myocardin-like 2 1 1
MIRT026813 ARL2BP ADP-ribosylation factor-like 2 binding protein 1 1
MIRT026814 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT026815 BLM Bloom syndrome, RecQ helicase-like 1 1
MIRT026816 KCTD12 potassium channel tetramerisation domain containing 12 1 1
MIRT026817 EIF2AK3 eukaryotic translation initiation factor 2-alpha kinase 3 1 1
MIRT026818 ESCO2 establishment of cohesion 1 homolog 2 (S. cerevisiae) 1 1
MIRT026819 STAM signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 1 1
MIRT026820 TTF2 transcription termination factor, RNA polymerase II 1 1
MIRT026821 PXDC1 chromosome 6 open reading frame 145 1 1
MIRT026822 SH2B3 SH2B adaptor protein 3 1 1
MIRT026823 OVOL1 ovo-like 1(Drosophila) 1 1
MIRT026824 ARHGAP11A Rho GTPase activating protein 11A 1 1
MIRT026825 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT026826 CASP7 caspase 7, apoptosis-related cysteine peptidase 1 1
MIRT026827 TCFL5 transcription factor-like 5 (basic helix-loop-helix) 1 1
MIRT026828 C8orf47 chromosome 8 open reading frame 47 1 1
MIRT026829 CCNO cyclin O 1 1
MIRT026830 DNAJC3 DnaJ (Hsp40) homolog, subfamily C, member 3 1 1
MIRT026831 ADRBK2 adrenergic, beta, receptor kinase 2 1 1
MIRT026832 DLGAP5 discs, large (Drosophila) homolog-associated protein 5 1 1
MIRT026833 CXorf57 chromosome X open reading frame 57 1 1
MIRT026834 SASS6 spindle assembly 6 homolog (C. elegans) 1 1
MIRT026835 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT026836 WHSC1L1 Wolf-Hirschhorn syndrome candidate 1-like 1 1 1
MIRT026837 PIGX phosphatidylinositol glycan anchor biosynthesis, class X 1 1
MIRT026838 FEN1 flap structure-specific endonuclease 1 1 1
MIRT026839 PIF1 PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae) 1 1
MIRT026840 RMI1 RMI1, RecQ mediated genome instability 1, homolog (S. cerevisiae) 1 1
MIRT026841 FAM111B family with sequence similarity 111, member B 1 1
MIRT026842 KLHL8 kelch-like 8 (Drosophila) 1 1
MIRT026843 CIB2 calcium and integrin binding family member 2 1 1
MIRT026844 EML1 echinoderm microtubule associated protein like 1 1 1
MIRT026845 PPAT phosphoribosyl pyrophosphate amidotransferase 1 1
MIRT026846 TAF9B TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa 1 1
MIRT026847 CUZD1 CUB and zona pellucida-like domains 1 1 1
MIRT026848 ENDOD1 endonuclease domain containing 1 1 1
MIRT026849 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 1 1
MIRT026850 ZNF114 zinc finger protein 114 1 1
MIRT026851 ZMYND11 zinc finger, MYND domain containing 11 1 1
MIRT026852 SLC35G1 transmembrane protein 20 1 1
MIRT026853 ZNF385B zinc finger protein 385B 1 1
MIRT026854 NPHP3 nephronophthisis 3 (adolescent) 1 1
MIRT026855 ROPN1L ropporin 1-like 1 1
MIRT026856 MEX3B mex-3 homolog B (C. elegans) 1 1
MIRT026857 CCDC111 coiled-coil domain containing 111 1 1
MIRT026858 RECQL RecQ protein-like (DNA helicase Q1-like) 1 1
MIRT026859 KIF20A kinesin family member 20A 1 1
MIRT026860 ATAD2 ATPase family, AAA domain containing 2 1 1
MIRT026861 ANKRD6 ankyrin repeat domain 6 1 1
MIRT026862 TRPC1 transient receptor potential cation channel, subfamily C, member 1 1 1
MIRT026863 ARHGEF40 protein SOLO 1 1
MIRT026864 MEIS2 Meis homeobox 2 1 1
MIRT026865 RNASEL ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) 1 1
MIRT026866 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT026867 DNAJC19 DnaJ (Hsp40) homolog, subfamily C, member 19 1 1
MIRT026868 SAMHD1 SAM domain and HD domain 1 1 1
MIRT026869 CAMK4 calcium/calmodulin-dependent protein kinase IV 1 1
MIRT026870 NRG4 neuregulin 4 1 1
MIRT026871 VANGL1 vang-like 1 (van gogh, Drosophila) 1 1
MIRT026872 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT026873 PRRC1 proline-rich coiled-coil 1 1 1
MIRT026874 PRKAA2 protein kinase, AMP-activated, alpha 2 catalytic subunit 1 1
MIRT026875 DDX50 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 1 1
MIRT026876 SRD5A1 steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1) 1 1
MIRT026877 PTBP2 polypyrimidine tract binding protein 2 1 1
MIRT026878 ZNF267 zinc finger protein 267 1 1
MIRT026879 ZNF611 zinc finger protein 611 1 1
MIRT026880 CDC14A CDC14 cell division cycle 14 homolog A (S. cerevisiae) 1 1
MIRT026881 RIC8B resistance to inhibitors of cholinesterase 8 homolog B (C. elegans) 1 1
MIRT026882 CRLF3 cytokine receptor-like factor 3 1 1
MIRT026883 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 1 1
MIRT026884 DICER1 dicer 1, ribonuclease type III 1 1
MIRT026885 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT026886 APC adenomatous polyposis coli 1 1
MIRT026887 FZD7 frizzled homolog 7 (Drosophila) 1 1
MIRT026888 RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) 2 2
MIRT026889 FAM178A family with sequence similarity 178, member A 1 1
MIRT026890 COPS7A COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) 1 1
MIRT026891 ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 1 1
MIRT026892 PPP1CA protein phosphatase 1, catalytic subunit, alpha isozyme 1 1
MIRT026893 C16orf52 chromosome 16 open reading frame 52 1 1
MIRT026894 FBXO5 F-box protein 5 1 1
MIRT026895 HSPA2 heat shock 70kDa protein 2 1 1
MIRT026896 FBXO25 F-box protein 25 1 1
MIRT026897 DCP1A DCP1 decapping enzyme homolog A (S. cerevisiae) 1 1
MIRT026898 FOS FBJ murine osteosarcoma viral oncogene homolog 1 1
MIRT026899 TROAP trophinin associated protein (tastin) 1 1
MIRT026900 C10orf137 chromosome 10 open reading frame 137 1 1
MIRT026901 OTUD1 OTU domain containing 1 1 1
MIRT026902 PHF19 PHD finger protein 19 1 1
MIRT026903 NFKBIZ nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta 1 1
MIRT026904 TUBGCP3 tubulin, gamma complex associated protein 3 1 1
MIRT026905 TRIM68 tripartite motif-containing 68 1 1
MIRT026906 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT026907 NUFIP1 nuclear fragile X mental retardation protein interacting protein 1 1 1
MIRT026908 G2E3 G2/M-phase specific E3 ubiquitin ligase 1 1
MIRT026909 ELL2 elongation factor, RNA polymerase II, 2 1 1
MIRT026910 ARFGEF1 ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited) 1 1
MIRT026911 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 1
MIRT026912 KIAA1731 KIAA1731 1 1
MIRT026913 VASH2 vasohibin 2 1 1
MIRT026914 LEPROTL1 leptin receptor overlapping transcript-like 1 1 1
MIRT026915 HYLS1 hydrolethalus syndrome 1 1 1
MIRT026916 PCOLCE2 procollagen C-endopeptidase enhancer 2 1 1
MIRT026917 SLC39A8 solute carrier family 39 (zinc transporter), member 8 1 1
MIRT026918 KIF14 kinesin family member 14 1 1
MIRT026919 ZNF273 zinc finger protein 273 1 1
MIRT026920 TBL1X transducin (beta)-like 1X-linked 1 1
MIRT026921 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 1 1
MIRT026922 KRT18P8 keratin 18 pseudogene 8 1 1
MIRT026923 BORA chromosome 13 open reading frame 34 1 1
MIRT026924 PCSK9 proprotein convertase subtilisin/kexin type 9 1 1
MIRT026925 PET112 PET112-like (yeast) 1 1
MIRT026926 NDFIP2 Nedd4 family interacting protein 2 1 1
MIRT026927 ZDHHC23 zinc finger, DHHC-type containing 23 1 1
MIRT026928 GATM glycine amidinotransferase (L-arginine:glycine amidinotransferase) 1 1
MIRT026929 THEM6 chromosome 8 open reading frame 55 1 1
MIRT026930 SAYSD1 chromosome 6 open reading frame 64 1 1
MIRT026931 RHOBTB3 Rho-related BTB domain containing 3 1 1
MIRT026932 CMPK2 cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial 1 1
MIRT026933 CDON Cdon homolog (mouse) 1 1
MIRT026934 ANKRD13A ankyrin repeat domain 13A 1 1
MIRT026935 CREBL2 cAMP responsive element binding protein-like 2 1 1
MIRT026936 NUCB2 nucleobindin 2 1 1
MIRT026937 TMTC2 transmembrane and tetratricopeptide repeat containing 2 1 1
MIRT026938 DDHD1 DDHD domain containing 1 1 1
MIRT026939 HBEGF heparin-binding EGF-like growth factor 1 1
MIRT026940 TCEB3 transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A) 1 1
MIRT026941 VPS13C vacuolar protein sorting 13 homolog C (S. cerevisiae) 1 1
MIRT026942 UBASH3B ubiquitin associated and SH3 domain containing B 1 1
MIRT026943 STOX2 storkhead box 2 1 1
MIRT026944 IL1RAP interleukin 1 receptor accessory protein 1 1
MIRT026945 ENC1 ectodermal-neural cortex 1 (with BTB-like domain) 1 1
MIRT026946 TRIM23 tripartite motif-containing 23 1 1
MIRT026947 MYB v-myb myeloblastosis viral oncogene homolog (avian) 1 1
MIRT026948 EFNB2 ephrin-B2 1 1
MIRT026949 ACADSB acyl-CoA dehydrogenase, short/branched chain 1 1
MIRT026950 C8orf46 chromosome 8 open reading frame 46 1 1
MIRT026951 WWC2 WW and C2 domain containing 2 1 1
MIRT026952 KIAA1958 KIAA1958 1 1
MIRT026953 CHST12 carbohydrate (chondroitin 4) sulfotransferase 12 1 1
MIRT026954 WDR47 WD repeat domain 47 1 1
MIRT026955 KDM1B lysine (K)-specific demethylase 1B 1 1
MIRT026956 CTH cystathionase (cystathionine gamma-lyase) 1 1
MIRT026957 HNF1B HNF1 homeobox B 1 1
MIRT026958 TRIB3 tribbles homolog 3 (Drosophila) 1 1
MIRT026959 EAF1 ELL associated factor 1 1 1
MIRT026960 POU2F1 POU class 2 homeobox 1 1 1
MIRT026961 IL1R1 interleukin 1 receptor, type I 1 1
MIRT026962 FAM126B family with sequence similarity 126, member B 1 1
MIRT026963 MAN2A2 mannosidase, alpha, class 2A, member 2 1 1
MIRT026964 CTNNBIP1 catenin, beta interacting protein 1 1 1
MIRT026965 C5orf30 chromosome 5 open reading frame 30 1 1
MIRT026966 ZMAT3 zinc finger, matrin type 3 1 1
MIRT026967 OTUD3 OTU domain containing 3 1 1
MIRT048284 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT048285 KIAA1671 KIAA1671 1 1
MIRT048286 RCC2 regulator of chromosome condensation 2 1 1