Accession ID: MIRT027144 [miRNA, hsa-miR-103a-3p :: RAD51, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-103a-2LinkOut: [miRBase ]
Description Homo sapiens miR-103a-2 stem-loop
Comment This sequence was localised to chromosome 20 and named mir-103-20 in reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-103a-3p
Mature Sequence 48| AGCAGCAUUGUACAGGGCUAUGA |70
Evidence Experimental
Experiments Cloned
Putative hsa-miR-103a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol RAD51 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BRCC5, HRAD51, HsRad51, HsT16930, RAD51A, RECA
Description RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)
Transcript NM_0011642    LinkOut: [ RefSeq ]
Other Transcripts NM_0011642 , NM_0028 , NM_1334   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on RAD51 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of RAD51
(miRNA target sites are highlighted)
>RAD51|NM_0011642|3'UTR
   1 AACCAGAATCTGCAAAATCTACGACTCTCCCTGTCTTCCTGAAGCTGAAGCTATGTTCGCCATTAATGCAGATGGAGTGG
  81 GAGATGCCAAAGACTGAATCATTGGGTTTTTCCTCTGTTAAAAACCTTAAGTGCTGCAGCCTAATGAGAGTGCACTGCTC
 161 CCTGGGGTTCTCTACAGGCCTCTTCCTGTTGTGACTGCCAGGATAAAGCTTCCGGGAAAACAGCTATTATATCAGCTTTT
 241 CTGATGGTATAAACAGGAGACAGGTCAGTAGTCACAAACTGATCTAAAATGTTTATTCCTTCTGTAGTGTATTAATCTCT
 321 GTGTGTTTTCTTTGGTTTTGGAGGAGGGGTATGAAGTATCTTTGACATGGTGCCTTAGGAATGACTTGGGTTTAACAAGC
 401 TGTCTACTGGACAATCTTATGTTTCCAAGAGAACTAAAGCTGGAGAGACCTGACCCTTCTCTCACTTCTAAATTAATGGT
 481 AAAATAAAATGCCTCAGCTATGTAGCAAAGGGAATGGGTCTGCACAGATTCTTTTTTTCTGTCAGTAAAACTCTCAAGCA
 561 GGTTTTTAAGTTGTCTGTCTGAATGATCTTGTGTAAGGTTTTGGTTATGGAGTCTTGTGCCAAACCTACTAGGCCATTAG
 641 CCCTTCACCATCTACCTGCTTGGTCTTTCATTGCTAAGACTAACTCAAGATAATCCTAGAGTCTTAAAGCATTTCAGGCC
 721 AGTGTGGTGTCTTGCGCCTGTACTCCCAGCACTTTGGGAGGCCGAGGCAGGTGGATCGCTTGAGCCCAGGAGTTTTAAGT
 801 CCAGCTTGGCCAAGGTGGTGAAATCCCATCTCTACAAAAAATGCAGAACTTAATCTGGACACACTGTTACACGTGCCTGT
 881 AGTCCCAGCTACTCGATAGCCTGAGGTGGGAGAATCACTTAAGCCTGGAAGGTGGAAGTTGCAGTGAGTCGAGATTGCAC
 961 TGCTGCATTCCAGCCAGGGTGACAGAGTGAGACCATGTTTCAAACAAGAAACATTTCAGAGGGTAAGTAAACAGATTTGA
1041 TTGTGAGGCTTCTAATAAAGTAGTTATTAGTAGTGAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agUAUCGGGACAUGUUACGACGa 5'
            | |  ||| || |:|||||| 
Target 5' ttAAAAACCT-TA-AGTGCTGCa 3'
118 - 138 139.00 -13.10
2
miRNA  3' aguaUCGGGAC--AUGUUACGACGa 5'
              ||:|  |  |:|| |||||| 
Target 5' agtgAGTCGAGATTGCACTGCTGCa 3'
943 - 967 129.00 -12.10
3
miRNA  3' agUAUCGGGACAUGUUACGACGa 5'
            :|| |::|| || ||| ||| 
Target 5' aaGTATCTTTG-AC-ATGGTGCc 3'
354 - 374 127.00 -10.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-103a-3p :: RAD51    [ Functional MTI ]
Validation Method Sequencing
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
273 hsa-miR-103a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001842 GPD1 glycerol-3-phosphate dehydrogenase 1 (soluble) 1 1
MIRT004762 CCNE1 cyclin E1 3 1
MIRT004763 Ccne1 cyclin E1 3 1
MIRT004764 CDK2 cyclin-dependent kinase 2 3 1
MIRT004765 Cdk2 cyclin-dependent kinase 2 3 1
MIRT004766 CREB1 cAMP responsive element binding protein 1 3 1
MIRT004767 Creb1 cAMP responsive element binding protein 1 3 1
MIRT005347 DICER1 dicer 1, ribonuclease type III 3 2
MIRT006428 CAV1 caveolin 1, caveolae protein, 22kDa 2 1
MIRT006688 KLF4 Kruppel-like factor 4 (gut) 2 1
MIRT006690 DAPK1 death-associated protein kinase 1 2 1
MIRT006693 PTEN phosphatase and tensin homolog 1 1
MIRT006955 CYP2C8 cytochrome P450, family 2, subfamily C, polypeptide 8 2 1
MIRT006991 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT007062 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 2 1
MIRT026982 SCAF1 SR-related CTD-associated factor 1 1 1
MIRT026983 NSF N-ethylmaleimide-sensitive factor 1 1
MIRT026984 ARF6 ADP-ribosylation factor 6 1 1
MIRT026985 MEX3C mex-3 homolog C (C. elegans) 1 1
MIRT026986 MTF1 metal-regulatory transcription factor 1 1 1
MIRT026987 ING1 inhibitor of growth family, member 1 1 1
MIRT026988 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT026989 SPATS2 spermatogenesis associated, serine-rich 2 1 1
MIRT026990 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT026991 SYS1 SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae) 1 1
MIRT026992 ZNF606 zinc finger protein 606 1 1
MIRT026993 LPHN1 latrophilin 1 1 1
MIRT026994 FLCN folliculin 1 1
MIRT026995 SLC52A2 G protein-coupled receptor 172A 1 1
MIRT026996 IVNS1ABP influenza virus NS1A binding protein 1 1
MIRT026997 OIP5 Opa interacting protein 5 1 1
MIRT026998 CEP55 centrosomal protein 55kDa 1 1
MIRT026999 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT027000 TMEM100 transmembrane protein 100 1 1
MIRT027001 SLC39A10 solute carrier family 39 (zinc transporter), member 10 1 1
MIRT027002 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT027003 BFAR bifunctional apoptosis regulator 1 1
MIRT027004 NIN ninein (GSK3B interacting protein) 1 1
MIRT027005 STK40 serine/threonine kinase 40 1 1
MIRT027006 ZRANB1 zinc finger, RAN-binding domain containing 1 1 1
MIRT027007 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative function) 1 1
MIRT027008 KLHL18 kelch-like 18 (Drosophila) 1 1
MIRT027009 C20orf27 chromosome 20 open reading frame 27 1 1
MIRT027010 KCNG3 potassium voltage-gated channel, subfamily G, member 3 1 1
MIRT027011 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT027012 CAAP1 chromosome 9 open reading frame 82 1 1
MIRT027013 ATG9A ATG9 autophagy related 9 homolog A (S. cerevisiae) 1 1
MIRT027014 KIF5B kinesin family member 5B 1 1
MIRT027015 SMAD7 SMAD family member 7 1 1
MIRT027016 FAM171A1 family with sequence similarity 171, member A1 1 1
MIRT027017 ZNRF3 zinc and ring finger 3 1 1
MIRT027018 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT027019 SDCBP syndecan binding protein (syntenin) 1 1
MIRT027020 LATS1 LATS, large tumor suppressor, homolog 1 (Drosophila) 1 1
MIRT027021 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT027022 IGSF3 immunoglobulin superfamily, member 3 1 1
MIRT027023 ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) 1 1
MIRT027024 PRDM4 PR domain containing 4 1 1
MIRT027025 GOPC golgi-associated PDZ and coiled-coil motif containing 1 1
MIRT027026 LUZP1 leucine zipper protein 1 1 1
MIRT027027 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT027028 RIMS3 regulating synaptic membrane exocytosis 3 1 1
MIRT027029 UBN2 ubinuclein 2 1 1
MIRT027030 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT027031 SIPA1L2 signal-induced proliferation-associated 1 like 2 1 1
MIRT027032 NDEL1 nudE nuclear distribution gene E homolog (A. nidulans)-like 1 1 1
MIRT027033 SUN2 Sad1 and UNC84 domain containing 2 1 1
MIRT027034 SALL1 sal-like 1 (Drosophila) 1 1
MIRT027035 ZNRF2 zinc and ring finger 2 1 1
MIRT027036 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT027037 YTHDC1 YTH domain containing 1 1 1
MIRT027038 N4BP1 NEDD4 binding protein 1 1 1
MIRT027039 ATP13A3 ATPase type 13A3 1 1
MIRT027040 ZHX1 zinc fingers and homeoboxes 1 1 1
MIRT027041 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT027042 INSIG1 insulin induced gene 1 1 1
MIRT027043 SRSF1 splicing factor, arginine/serine-rich 1 1 1
MIRT027044 IFT74 intraflagellar transport 74 homolog (Chlamydomonas) 1 1
MIRT027045 MIS18BP1 chromosome 14 open reading frame 106 1 1
MIRT027046 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT027047 LARP4B La ribonucleoprotein domain family, member 4B 1 1
MIRT027048 STAMBPL1 STAM binding protein-like 1 1 1
MIRT027049 PHC3 polyhomeotic homolog 3 (Drosophila) 1 1
MIRT027050 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT027051 C11orf58 chromosome 11 open reading frame 58 1 1
MIRT027052 CITED2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 1 1
MIRT027053 YAF2 YY1 associated factor 2 1 1
MIRT027054 LAMP2 lysosomal-associated membrane protein 2 1 1
MIRT027055 FAM98A family with sequence similarity 98, member A 1 1
MIRT027056 C7orf55 chromosome 7 open reading frame 55 1 1
MIRT027057 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT027058 USP42 ubiquitin specific peptidase 42 1 1
MIRT027059 ARL4C ADP-ribosylation factor-like 4C 1 1
MIRT027060 FURIN furin (paired basic amino acid cleaving enzyme) 1 1
MIRT027061 FAM122B family with sequence similarity 122B 1 1
MIRT027062 SLC25A39 solute carrier family 25, member 39 1 1
MIRT027063 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT027064 CDV3 CDV3 homolog (mouse) 1 1
MIRT027065 AEBP2 AE binding protein 2 1 1
MIRT027066 YIF1B Yip1 interacting factor homolog B (S. cerevisiae) 1 1
MIRT027067 FAM122A family with sequence similarity 122A 1 1
MIRT027068 FAM89A family with sequence similarity 89, member A 1 1
MIRT027069 HOXA3 homeobox A3 1 1
MIRT027070 ITM2C integral membrane protein 2C 1 1
MIRT027071 SVIP small VCP/p97-interacting protein 1 1
MIRT027072 DMTF1 cyclin D binding myb-like transcription factor 1 1 1
MIRT027073 HIST2H2BE histone cluster 2, H2be 1 1
MIRT027074 HOXC10 homeobox C10 1 1
MIRT027075 VEZT vezatin, adherens junctions transmembrane protein 1 1
MIRT027076 GLRX glutaredoxin (thioltransferase) 1 1
MIRT027077 SIRT4 sirtuin (silent mating type information regulation 2 homolog) 4 (S. cerevisiae) 1 1
MIRT027078 RECK reversion-inducing-cysteine-rich protein with kazal motifs 1 1
MIRT027079 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT027080 SON SON DNA binding protein 1 1
MIRT027081 SLC6A9 solute carrier family 6 (neurotransmitter transporter, glycine), member 9 1 1
MIRT027082 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 1
MIRT027083 MYO5A myosin VA (heavy chain 12, myoxin) 1 1
MIRT027084 AADAT aminoadipate aminotransferase 1 1
MIRT027085 PPP1R12C protein phosphatase 1, regulatory (inhibitor) subunit 12C 1 1
MIRT027086 RPRD1B regulation of nuclear pre-mRNA domain containing 1B 1 1
MIRT027087 PDE4D phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) 1 1
MIRT027088 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 1
MIRT027089 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT027090 GABARAPL1 GABA(A) receptor-associated protein like 1 1 1
MIRT027091 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 1 1
MIRT027092 PPP6R3 SAPS domain family, member 3 1 1
MIRT027093 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT027094 SAV1 salvador homolog 1 (Drosophila) 1 1
MIRT027095 PPP1R11 protein phosphatase 1, regulatory (inhibitor) subunit 11 1 1
MIRT027096 RAB1B RAB1B, member RAS oncogene family 1 1
MIRT027097 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 1
MIRT027098 SLC35B2 solute carrier family 35, member B2 1 1
MIRT027099 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 1 1
MIRT027100 CYB561A3 cytochrome b, ascorbate dependent 3 1 1
MIRT027101 CARD10 caspase recruitment domain family, member 10 1 1
MIRT027102 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT027103 ACVR2B activin A receptor, type IIB 1 1
MIRT027104 TMCC1 transmembrane and coiled-coil domain family 1 1 1
MIRT027105 CLIP1 CAP-GLY domain containing linker protein 1 1 1
MIRT027106 SNX16 sorting nexin 16 1 1
MIRT027107 CUL4A cullin 4A 1 1
MIRT027108 ARL3 ADP-ribosylation factor-like 3 1 1
MIRT027109 ATG14 KIAA0831 1 1
MIRT027110 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT027111 ZNF622 zinc finger protein 622 1 1
MIRT027112 TMEM55B transmembrane protein 55B 1 1
MIRT027113 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT027114 MTHFR methylenetetrahydrofolate reductase (NAD(P)H) 1 1
MIRT027115 CDK17 cyclin-dependent kinase 17 1 1
MIRT027116 PRKAB2 protein kinase, AMP-activated, beta 2 non-catalytic subunit 1 1
MIRT027117 POLD3 polymerase (DNA-directed), delta 3, accessory subunit 1 1
MIRT027118 KIAA1432 KIAA1432 1 1
MIRT027119 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 1 1
MIRT027120 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT027121 XPO7 exportin 7 1 1
MIRT027122 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 1
MIRT027123 KCNC4 potassium voltage-gated channel, Shaw-related subfamily, member 4 1 1
MIRT027124 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 1
MIRT027125 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT027126 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 1
MIRT027127 HELZ helicase with zinc finger 1 1
MIRT027128 PLSCR4 phospholipid scramblase 4 1 1
MIRT027129 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT027130 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT027131 NUP50 nucleoporin 50kDa 1 1
MIRT027132 WNT3A wingless-type MMTV integration site family, member 3A 1 1
MIRT027133 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT027134 PAG1 phosphoprotein associated with glycosphingolipid microdomains 1 1 1
MIRT027135 CCT3 chaperonin containing TCP1, subunit 3 (gamma) 1 1
MIRT027136 JAKMIP2 janus kinase and microtubule interacting protein 2 1 1
MIRT027137 AXIN2 axin 2 1 1
MIRT027138 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT027139 TLK1 tousled-like kinase 1 1 1
MIRT027140 DESI1 PPPDE peptidase domain containing 2 1 1
MIRT027141 FGF2 fibroblast growth factor 2 (basic) 1 1
MIRT027142 PAGR1 chromosome 16 open reading frame 53 1 1
MIRT027143 DIEXF chromosome 1 open reading frame 107 1 1
MIRT027144 RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) 1 1
MIRT027145 IFNGR2 interferon gamma receptor 2 (interferon gamma transducer 1) 1 1
MIRT027146 HOXD13 homeobox D13 1 1
MIRT027147 MAP4 microtubule-associated protein 4 1 1
MIRT027148 EXD2 exonuclease 3'-5' domain containing 2 1 1
MIRT027149 RAB23 RAB23, member RAS oncogene family 1 1
MIRT027150 C10orf2 chromosome 10 open reading frame 2 1 1
MIRT027151 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 1
MIRT027152 SLC35A4 solute carrier family 35, member A4 1 1
MIRT027153 FEM1C fem-1 homolog c (C. elegans) 1 1
MIRT027154 MED13 mediator complex subunit 13 1 1
MIRT027155 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 1
MIRT027156 CD274 CD274 molecule 1 1
MIRT027157 CALU calumenin 1 1
MIRT027158 BCL2 B-cell CLL/lymphoma 2 1 1
MIRT027159 OSBPL3 oxysterol binding protein-like 3 1 1
MIRT027160 MLLT6 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 1 1
MIRT027161 EPC1 enhancer of polycomb homolog 1 (Drosophila) 1 1
MIRT027162 CAMSAP1 calmodulin regulated spectrin-associated protein 1 1 1
MIRT027163 GTPBP1 GTP binding protein 1 1 1
MIRT027164 CNNM2 cyclin M2 1 1
MIRT027165 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT027166 RSL1D1 ribosomal L1 domain containing 1 1 1
MIRT027167 ALG2 asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT027168 ARL8A ADP-ribosylation factor-like 8A 1 1
MIRT027169 SF3A3 splicing factor 3a, subunit 3, 60kDa 1 1
MIRT027170 SOWAHC ankyrin repeat domain 57 1 1
MIRT027171 CYP26B1 cytochrome P450, family 26, subfamily B, polypeptide 1 1 1
MIRT027172 PNPLA6 patatin-like phospholipase domain containing 6 1 1
MIRT027173 GPR180 G protein-coupled receptor 180 1 1
MIRT027174 CPSF7 cleavage and polyadenylation specific factor 7, 59kDa 1 1
MIRT027175 UBE2R2 ubiquitin-conjugating enzyme E2R 2 1 1
MIRT027176 CKAP5 cytoskeleton associated protein 5 1 1
MIRT027177 ZFHX3 zinc finger homeobox 3 1 1
MIRT027178 DNAJC9 DnaJ (Hsp40) homolog, subfamily C, member 9 1 1
MIRT027179 CAMKK2 calcium/calmodulin-dependent protein kinase kinase 2, beta 1 1
MIRT027180 RNF144B ring finger protein 144B 1 1
MIRT027181 EFNB2 ephrin-B2 1 1
MIRT027182 CA12 carbonic anhydrase XII 1 1
MIRT027183 RFK riboflavin kinase 1 1
MIRT027184 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT027185 TMEM43 transmembrane protein 43 1 1
MIRT027186 GNS glucosamine (N-acetyl)-6-sulfatase 1 1
MIRT027187 IPPK inositol 1,3,4,5,6-pentakisphosphate 2-kinase 1 1
MIRT027188 GOLT1B golgi transport 1 homolog B (S. cerevisiae) 1 1
MIRT027189 NUMB numb homolog (Drosophila) 1 1
MIRT027190 SPRED1 sprouty-related, EVH1 domain containing 1 1 1
MIRT027191 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 1
MIRT027192 PTPN3 protein tyrosine phosphatase, non-receptor type 3 1 1
MIRT027193 RNF217 ring finger protein 217 1 1
MIRT027194 SETD1B SET domain containing 1B 1 1
MIRT027195 HAUS3 HAUS augmin-like complex, subunit 3 1 1
MIRT027196 STK38 serine/threonine kinase 38 1 1
MIRT027197 SLC9A6 solute carrier family 9 (sodium/hydrogen exchanger), member 6 1 1
MIRT027198 TMEM255A family with sequence similarity 70, member A 1 1
MIRT027199 MYO5B myosin VB 1 1
MIRT027200 EN2 engrailed homeobox 2 1 1
MIRT027201 SH3BP5 SH3-domain binding protein 5 (BTK-associated) 1 1
MIRT027202 STK33 serine/threonine kinase 33 1 1
MIRT027203 NAA15 N(alpha)-acetyltransferase 15, NatA auxiliary subunit 1 1
MIRT027204 CDCA4 cell division cycle associated 4 1 1
MIRT027205 MIB1 mindbomb homolog 1 (Drosophila) 1 1
MIRT027206 PAQR3 progestin and adipoQ receptor family member III 1 1
MIRT027207 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT027208 C1orf21 chromosome 1 open reading frame 21 1 1
MIRT027209 TBC1D12 TBC1 domain family, member 12 1 1
MIRT027210 CCDC19 coiled-coil domain containing 19 1 1
MIRT027211 USP15 ubiquitin specific peptidase 15 1 1
MIRT027212 MTMR4 myotubularin related protein 4 1 1
MIRT027213 E2F7 E2F transcription factor 7 1 1
MIRT027214 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 1
MIRT027215 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT027216 UBFD1 ubiquitin family domain containing 1 1 1
MIRT027217 EXOC5 exocyst complex component 5 1 1
MIRT027218 TPD52 tumor protein D52 1 1
MIRT027219 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 1
MIRT027220 ZYX zyxin 1 1
MIRT027221 SPATS2L spermatogenesis associated, serine-rich 2-like 1 1
MIRT027222 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT027223 C16orf72 chromosome 16 open reading frame 72 1 1
MIRT027224 SYNJ1 synaptojanin 1 1 1
MIRT027225 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT027226 GCC1 GRIP and coiled-coil domain containing 1 1 1
MIRT027227 PURA purine-rich element binding protein A 1 1
MIRT027228 PHF19 PHD finger protein 19 1 1
MIRT027229 PDK4 pyruvate dehydrogenase kinase, isozyme 4 1 1
MIRT027230 VPS4A vacuolar protein sorting 4 homolog A (S. cerevisiae) 1 1
MIRT027231 KIF5A kinesin family member 5A 1 1
MIRT027232 FBXW7 F-box and WD repeat domain containing 7 1 1
MIRT027233 AGFG1 ArfGAP with FG repeats 1 1 1
MIRT027234 CDK6 cyclin-dependent kinase 6 1 1
MIRT027235 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 1 1
MIRT027236 PPP6C protein phosphatase 6, catalytic subunit 1 1
MIRT048356 TK1 thymidine kinase 1, soluble 1 1
MIRT048357 RPN1 ribophorin I 1 1
MIRT048358 POMGNT1 protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase 1 1