Accession ID: MIRT027662 [miRNA, hsa-miR-98-5p :: SLC19A2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-98LinkOut: [miRBase ]
Synonyms MIRN98, hsa-mir-98, miR-98, MIR98
Description Homo sapiens miR-98 stem-loop
Comment This sequence is localised to chromosome X and was named mir-98-X in reference . The predicted stem-loop precursor sequence is clearly related to let-7.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-98-5p
Mature Sequence 22| UGAGGUAGUAAGUUGUAUUGUU |43
Evidence Experimental
Experiments Cloned
Putative hsa-miR-98-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SLC19A2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TC1, THT1, THTR1, TRMA
Description solute carrier family 19 (thiamine transporter), member 2
Transcript NM_0069    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SLC19A2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SLC19A2
(miRNA target sites are highlighted)
>SLC19A2|NM_0069|3'UTR
   1 TAATATACTGCTGAAGGGCTTCTTCTTATAGCAAGAACTCTGCACAGCAACTGCCTGGATGTGTTTGATTTTTTAAAGCG
  81 TAGACATATATTTATGAATGTGCATTTCTTGACTTCACAGCAGCCACTTGACTAATACCTTGTGTTCCGGGAATAACATG
 161 ATACTATTCAGAGGAGCCAGAAGTAAAGTTTATTTCATGGATTATTTATGAGAGCTAATTTAAGGATGACTTTTTTTCTG
 241 ATTCAAAAGTGAACTTGATTTTAAAAACCAGTCAAGAGCAATCAAAGCAGCACATGGTGTTGTATACTTCATTAGCAAGT
 321 GAGTTTGGTGTTTTATAGGTCACATATGTCTGTATCTACTTAGCCAGATGCTTGGCCTGGTGGGACCAGGGCTCCACAGA
 401 GGCCACAAAATGTTGCAAGTCATGATGGATGGAAATATGTTCTAACAGCATCTGCCTCTATTCAATTTAATTCTTATTTC
 481 TGTGTTACTCATGTACATTGGTCTTTCTACATAGTTATTCTATCACTGGCAATATTTGTTCTGGTTTAGTGTTCTGTATT
 561 TTAAGGTGTACGTATCATTTCTAATTTTAAGTTATTTTAAAAAAATTCATCATATGAATGTTCTTGGTTCCCATTGTGAC
 641 GATTATTTATTTCTGTAAAATTTGTTTAGAAGTACGTTTTTGCATTATTCATATGCTTCCCAGAGAAGCTCATTTAGTTA
 721 GAAAATAAGGCAAGTTTTGAAGCCTGCTAAATGAAGAGACTTAAGAAAGCTTAAGGTACGCTTGCTTGTCTTTAAATCTT
 801 CAATATGAAGGACTATTAATTCCAAGATTAAAAGTTCATATATAGGCTAAAGATGTAACTAGGCCATTTGTATTTGTATT
 881 CCCTTTTATTTCCAAAATAAAATGAAAAATCTTTTTTTAATAATTTCATCCCTATTTATAGTTTTTATATTAATTTGTTT
 961 TTCTTATCCAAGTAAAGATGTCAATAGGAATTGCATTAGTCCAAGGCCTTTTTCATAAACTGAGCCTCTTTTCAATTATT
1041 TCAATGGGACAGGAACTAGGATAGATGTGATTCCTGCATTTTTTTACCTTAAATCTGCCTTTGTTTCTAAAGGTAGATCA
1121 TCTTGAATATTTGCTTAAAATTGCTAGTGATTTCATTACCAAGTTACTTGAAAAAATGTTCTATATGCATTTAATTCTGA
1201 AATCAGTCTACCAAGGGGCTGCTAGTATATGTCAGACATGAAAACTATTTTAAAGCTGACTTTGTTGCCTTATCTTGAAA
1281 AGAATCTAGATAGGTGCTTTTAACTGGGGTATTAACTTTTTTAGAATGACACAGCTGAACAGTGTTAATAATAGTGTGTC
1361 AAGATTGCAAAGTCGACATACTCATTTGGTTTAAGCAGGAATCCTAGAAGCAAATGGATGGGGATAAGAATAGGTCATTT
1441 TCTATTCACCATCCTTTACTATTAAGGGAAAGGAAAAGAACACTAGCTAAGGAAGGGAAAGGGAAGTGATATCATAAAAG
1521 TAGCAACCTTCATTTTACATTCTGTCTGTTTTTCTTTTTTTGCTTTGTTTTGTTTGTGCTAATTTGGGAATTGTGTACTC
1601 CGAAACAAGTAGAAAAGTGCTGTTTGAGGGATTTTATTAAATCTTTTTTTAATGGAATGTGGTACAAATTGTTCATGTTA
1681 CCAAAGCAATATTTCCCTGGAATTTAATTCAAAGTTTGTGGCATACAACCTGAGCCTTTTCTTATATAAGACAAGAATAT
1761 GTTCACATCTTGGTATGTGGCCATATTTATAGAATGCTGAACTCAATGTGCAAGTTGTACTGTATGCAGTTTTGTAAATA
1841 AGTGAAAATAATTTGTTGTACTTTTTATTCAATTCTGTATAGATTATAAAATTATTTTTATTAAATAAATATTTTACAGT
1921 ATATTTTCTCTTTTTAATCAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuguuaUGUUGAAUGAUGGAGu 5'
                |||:| | ||:|||| 
Target 5' gttctaACAGCAT-CTGCCTCt 3'
439 - 459 139.00 -14.10
2
miRNA  3' uuguuAUGUUGAAUGAUGGAGu 5'
               |:|| :|| :|||||: 
Target 5' attccTGCATTTTTTTACCTTa 3'
1070 - 1091 129.00 -10.60
3
miRNA  3' uuGU-UAUGUUGA-AU-GAUGGAgu 5'
            || |||:: || || ||||:|  
Target 5' gtCACATATGTCTGTATCTACTTag 3'
339 - 363 124.00 -6.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-98-5p :: SLC19A2    [ Functional MTI ]
Validation Method Microarray
Article - Gennarino, V. A. Sardiello, M. Avellino, R. et al.
- Genome Res, 2009
MicroRNAs (miRNAs) are small noncoding RNAs that control gene expression by inducing RNA cleavage or translational inhibition. Most human miRNAs are intragenic and are transcribed as part of their hosting transcription units. We hypothesized that the expression profiles of miRNA host genes and of their targets are inversely correlated and devised a novel procedure, HOCTAR (host gene oppositely correlated targets), which ranks predicted miRNA target genes based on their anti-correlated expression behavior relative to their respective miRNA host genes. HOCTAR is the first tool for systematic miRNA target prediction that utilizes the same set of microarray experiments to monitor the expression of both miRNAs (through their host genes) and candidate targets. We applied the procedure to 178 human intragenic miRNAs and found that it performs better than currently available prediction softwares in pinpointing previously validated miRNA targets. The high-scoring HOCTAR predicted targets were enriched in Gene Ontology categories, which were consistent with previously published data, as in the case of miR-106b and miR-93. By means of overexpression and loss-of-function assays, we also demonstrated that HOCTAR is efficient in predicting novel miRNA targets and we identified, by microarray and qRT-PCR procedures, 34 and 28 novel targets for miR-26b and miR-98, respectively. Overall, we believe that the use of HOCTAR significantly reduces the number of candidate miRNA targets to be tested compared to the procedures based solely on target sequence recognition. Finally, our data further confirm that miRNAs have a significant impact on the mRNA levels of most of their targets.
LinkOut: [PMID: 19088304]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
499 hsa-miR-98-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001124 E2F1 E2F transcription factor 1 2 1
MIRT001126 E2F2 E2F transcription factor 2 4 1
MIRT002999 HMGA2 high mobility group AT-hook 2 4 3
MIRT003438 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 4 4
MIRT004305 NCOA3 nuclear receptor coactivator 3 3 2
MIRT004411 TUSC2 tumor suppressor candidate 2 4 3
MIRT004941 ZFP36L1 zinc finger protein 36, C3H type-like 1 2 1
MIRT004942 ZMPSTE24 zinc metallopeptidase (STE24 homolog, S. cerevisiae) 2 1
MIRT004943 THBS1 thrombospondin 1 3 2
MIRT004944 SERP1 stress-associated endoplasmic reticulum protein 1 2 1
MIRT004945 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 3 2
MIRT004946 MEIS1 Meis homeobox 1 2 1
MIRT004947 CNOT4 CCR4-NOT transcription complex, subunit 4 2 1
MIRT004948 HNRPDL heterogeneous nuclear ribonucleoprotein D-like 2 1
MIRT004949 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 2 1
MIRT004950 CBX5 chromobox homolog 5 (HP1 alpha homolog, Drosophila) 2 1
MIRT004951 CHRNB1 cholinergic receptor, nicotinic, beta 1 (muscle) 2 1
MIRT004953 ACADM acyl-CoA dehydrogenase, C-4 to C-12 straight chain 2 1
MIRT005326 SOCS4 suppressor of cytokine signaling 4 4 1
MIRT005676 KLF13 Kruppel-like factor 13 1 1
MIRT005677 CCL5 chemokine (C-C motif) ligand 5 0 1
MIRT005721 EZH2 enhancer of zeste homolog 2 (Drosophila) 3 2
MIRT006397 IL13 interleukin 13 2 1
MIRT006408 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT007106 CCNJ cyclin J 2 2
MIRT027399 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT027400 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT027401 MIR671 microRNA 671 1 1
MIRT027402 COLGALT1 glycosyltransferase 25 domain containing 1 1 1
MIRT027403 ZFAND3 zinc finger, AN1-type domain 3 1 1
MIRT027404 GCNT2 glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group) 1 1
MIRT027405 INHBE inhibin, beta E 1 1
MIRT027406 SNX24 sorting nexin 24 1 1
MIRT027407 SUV39H1 suppressor of variegation 3-9 homolog 1 (Drosophila) 1 1
MIRT027408 HIST2H4A histone cluster 2, H4a 1 1
MIRT027409 KCNJ15 potassium inwardly-rectifying channel, subfamily J, member 15 1 1
MIRT027410 WBP11 WW domain binding protein 11 1 1
MIRT027411 BFAR bifunctional apoptosis regulator 1 1
MIRT027412 ARRB1 arrestin, beta 1 1 1
MIRT027413 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 1 1
MIRT027414 VPS54 vacuolar protein sorting 54 homolog (S. cerevisiae) 1 1
MIRT027415 GATA6 GATA binding protein 6 1 1
MIRT027416 USP10 ubiquitin specific peptidase 10 1 1
MIRT027417 TIMM17B translocase of inner mitochondrial membrane 17 homolog B (yeast) 1 1
MIRT027418 FADS3 fatty acid desaturase 3 1 1
MIRT027419 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT027420 GMPR2 guanosine monophosphate reductase 2 1 1
MIRT027421 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT027422 MED8 mediator complex subunit 8 1 1
MIRT027423 IL6R interleukin 6 receptor 1 1
MIRT027424 COIL coilin 1 1
MIRT027425 ARHGAP28 Rho GTPase activating protein 28 1 1
MIRT027426 SEC24B SEC24 family, member B (S. cerevisiae) 1 1
MIRT027427 CHRNA9 cholinergic receptor, nicotinic, alpha 9 1 1
MIRT027428 ARCN1 archain 1 1 1
MIRT027429 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT027430 A2M alpha-2-macroglobulin 1 1
MIRT027431 TPST2 tyrosylprotein sulfotransferase 2 1 1
MIRT027432 ZNF573 zinc finger protein 573 1 1
MIRT027433 GRPEL1 GrpE-like 1, mitochondrial (E. coli) 1 1
MIRT027434 TMEM45A transmembrane protein 45A 1 1
MIRT027435 TEAD4 TEA domain family member 4 1 1
MIRT027436 SUPV3L1 suppressor of var1, 3-like 1 (S. cerevisiae) 1 1
MIRT027437 BIRC3 baculoviral IAP repeat-containing 3 1 1
MIRT027438 MYBBP1A MYB binding protein (P160) 1a 1 1
MIRT027439 CA9 carbonic anhydrase IX 1 1
MIRT027440 GABRE gamma-aminobutyric acid (GABA) A receptor, epsilon 1 1
MIRT027441 ECM2 extracellular matrix protein 2, female organ and adipocyte specific 1 1
MIRT027442 CALCB calcitonin-related polypeptide beta 1 1
MIRT027443 ASMTL acetylserotonin O-methyltransferase-like 1 1
MIRT027444 TNFRSF9 tumor necrosis factor receptor superfamily, member 9 1 1
MIRT027445 SNORA25 small nucleolar RNA, H/ACA box 25 1 1
MIRT027446 USP3 ubiquitin specific peptidase 3 1 1
MIRT027447 FOXO1 forkhead box O1 1 1
MIRT027448 SORD sorbitol dehydrogenase 1 1
MIRT027449 IL6 interleukin 6 (interferon, beta 2) 1 1
MIRT027450 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT027451 HIST1H2AC histone cluster 1, H2ac 1 1
MIRT027452 PPAN peter pan homolog (Drosophila) 1 1
MIRT027453 PUS1 pseudouridylate synthase 1 1 1
MIRT027454 CYB5R3 cytochrome b5 reductase 3 1 1
MIRT027455 HIST1H2BE histone cluster 1, H2be 1 1
MIRT027456 TRAF1 TNF receptor-associated factor 1 1 1
MIRT027457 SOLH small optic lobes homolog (Drosophila) 1 1
MIRT027458 TMEM164 transmembrane protein 164 1 1
MIRT027459 ST5 suppression of tumorigenicity 5 1 1
MIRT027460 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT027461 AVEN apoptosis, caspase activation inhibitor 1 1
MIRT027462 CPOX coproporphyrinogen oxidase 1 1
MIRT027463 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT027464 LPCAT3 lysophosphatidylcholine acyltransferase 3 1 1
MIRT027465 SNX5 sorting nexin 5 1 1
MIRT027466 HMMR hyaluronan-mediated motility receptor (RHAMM) 1 1
MIRT027467 RND3 Rho family GTPase 3 1 1
MIRT027468 RASAL2 RAS protein activator like 2 1 1
MIRT027469 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 1 1
MIRT027470 SERTAD2 SERTA domain containing 2 1 1
MIRT027471 PRDM4 PR domain containing 4 1 1
MIRT027472 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 1 1
MIRT027473 NIPSNAP1 nipsnap homolog 1 (C. elegans) 1 1
MIRT027474 MMACHC methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria 1 1
MIRT027475 KIAA0922 KIAA0922 1 1
MIRT027476 ATG9A ATG9 autophagy related 9 homolog A (S. cerevisiae) 1 1
MIRT027477 TMEM8A transmembrane protein 8A 1 1
MIRT027478 ARSJ arylsulfatase family, member J 1 1
MIRT027479 RNF13 ring finger protein 13 1 1
MIRT027480 XPO4 exportin 4 1 1
MIRT027481 ATP7B ATPase, Cu++ transporting, beta polypeptide 1 1
MIRT027482 SMAD7 SMAD family member 7 1 1
MIRT027483 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT027484 ALG3 asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT027485 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT027486 CANT1 calcium activated nucleotidase 1 1 1
MIRT027487 PDHB pyruvate dehydrogenase (lipoamide) beta 1 1
MIRT027488 TTI1 KIAA0406 1 1
MIRT027489 CAP1 CAP, adenylate cyclase-associated protein 1 (yeast) 1 1
MIRT027490 MLXIP MLX interacting protein 1 1
MIRT027491 MAGEA6 melanoma antigen family A, 6 1 1
MIRT027492 TAF5L TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT027493 VAV3 vav 3 guanine nucleotide exchange factor 1 1
MIRT027494 STEAP3 STEAP family member 3 1 1
MIRT027495 MTF2 metal response element binding transcription factor 2 1 1
MIRT027496 TLDC1 KIAA1609 1 1
MIRT027497 GALNT2 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2) 1 1
MIRT027498 ADCY9 adenylate cyclase 9 1 1
MIRT027499 TRIB1 tribbles homolog 1 (Drosophila) 1 1
MIRT027500 ATP13A3 ATPase type 13A3 1 1
MIRT027501 YIPF1 Yip1 domain family, member 1 1 1
MIRT027502 ZNF473 zinc finger protein 473 1 1
MIRT027503 MED6 mediator complex subunit 6 1 1
MIRT027504 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT027505 ZNF202 zinc finger protein 202 1 1
MIRT027506 DUSP9 dual specificity phosphatase 9 1 1
MIRT027507 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT027508 VPS33A vacuolar protein sorting 33 homolog A (S. cerevisiae) 1 1
MIRT027509 TAF5 TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa 1 1
MIRT027510 PXDN peroxidasin homolog (Drosophila) 1 1
MIRT027511 RGS16 regulator of G-protein signaling 16 1 1
MIRT027512 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 1
MIRT027513 TARBP2 TAR (HIV-1) RNA binding protein 2 1 1
MIRT027514 CPA4 carboxypeptidase A4 1 1
MIRT027515 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT027516 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT027517 OSMR oncostatin M receptor 1 1
MIRT027518 BMP2K BMP2 inducible kinase 1 1
MIRT027519 IFI16 interferon, gamma-inducible protein 16 1 1
MIRT027520 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT027521 SNRPA1 small nuclear ribonucleoprotein polypeptide A' 'protein-coding 1 1
MIRT027522 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT027523 CNNM4 cyclin M4 1 1
MIRT027524 IL32 interleukin 32 1 1
MIRT027525 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT027526 COQ10B coenzyme Q10 homolog B (S. cerevisiae) 1 1
MIRT027527 HIST1H4H histone cluster 1, H4h 1 1
MIRT027528 TIMM13 translocase of inner mitochondrial membrane 13 homolog (yeast) 1 1
MIRT027529 HIST1H2BG histone cluster 1, H2bg 1 1
MIRT027530 PALMD palmdelphin 1 1
MIRT027531 SCHIP1 schwannomin interacting protein 1 1 1
MIRT027532 NUAK2 NUAK family, SNF1-like kinase, 2 1 1
MIRT027533 SEC31A SEC31 homolog A (S. cerevisiae) 1 1
MIRT027534 TNFRSF21 tumor necrosis factor receptor superfamily, member 21 1 1
MIRT027535 ZNF74 zinc finger protein 74 1 1
MIRT027536 HIST2H2BC histone cluster 2, H2bc 1 1
MIRT027537 STC2 stanniocalcin 2 1 1
MIRT027538 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT027539 NARF nuclear prelamin A recognition factor 1 1
MIRT027540 PALM2-AKAP2 PALM2-AKAP2 readthrough 1 1
MIRT027541 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 1 1
MIRT027542 EMR2 egf-like module containing, mucin-like, hormone receptor-like 2 1 1
MIRT027543 B4GALT3 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 1 1
MIRT027544 HIST1H2BH histone cluster 1, H2bh 1 1
MIRT027545 JAG1 jagged 1 (Alagille syndrome) 1 1
MIRT027546 MFSD5 major facilitator superfamily domain containing 5 1 1
MIRT027547 PDCD11 programmed cell death 11 1 1
MIRT027548 RTCA RNA terminal phosphate cyclase domain 1 1 1
MIRT027549 AKAP2 A kinase (PRKA) anchor protein 2 1 1
MIRT027550 HIST1H2BL histone cluster 1, H2bl 1 1
MIRT027551 NPR3 natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) 1 1
MIRT027552 SPRY1 sprouty homolog 1, antagonist of FGF signaling (Drosophila) 1 1
MIRT027553 GNPTAB N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits 1 1
MIRT027554 PROSER1 chromosome 13 open reading frame 23 1 1
MIRT027555 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT027556 MBNL2 muscleblind-like 2 (Drosophila) 1 1
MIRT027557 POM121 POM121 membrane glycoprotein (rat) 1 1
MIRT027558 MGEA5 meningioma expressed antigen 5 (hyaluronidase) 1 1
MIRT027559 CDK17 cyclin-dependent kinase 17 1 1
MIRT027560 RASSF9 Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 1 1
MIRT027561 PARP12 poly (ADP-ribose) polymerase family, member 12 1 1
MIRT027562 AHR aryl hydrocarbon receptor 1 1
MIRT027563 CHML choroideremia-like (Rab escort protein 2) 1 1
MIRT027564 MYLK3 myosin light chain kinase 3 1 1
MIRT027565 ZNF281 zinc finger protein 281 1 1
MIRT027566 EIF4E2 eukaryotic translation initiation factor 4E family member 2 1 1
MIRT027567 COX10 COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) 1 1
MIRT027568 LRFN4 leucine rich repeat and fibronectin type III domain containing 4 1 1
MIRT027569 RHBDF2 rhomboid 5 homolog 2 (Drosophila) 1 1
MIRT027570 EIF3J eukaryotic translation initiation factor 3, subunit J 1 1
MIRT027571 TEAD1 TEA domain family member 1 (SV40 transcriptional enhancer factor) 1 1
MIRT027572 ROR1 receptor tyrosine kinase-like orphan receptor 1 1 1
MIRT027573 C10orf88 chromosome 10 open reading frame 88 1 1
MIRT027574 GPR56 G protein-coupled receptor 56 1 1
MIRT027575 BIN3 bridging integrator 3 1 1
MIRT027576 DOCK4 dedicator of cytokinesis 4 1 1
MIRT027577 OSBPL10 oxysterol binding protein-like 10 1 1
MIRT027578 BAZ1A bromodomain adjacent to zinc finger domain, 1A 1 1
MIRT027579 RBPMS RNA binding protein with multiple splicing 1 1
MIRT027580 TMEM2 transmembrane protein 2 1 1
MIRT027581 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT027582 DOLK dolichol kinase 1 1
MIRT027583 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 1
MIRT027584 MAPRE1 microtubule-associated protein, RP/EB family, member 1 1 1
MIRT027585 RPAP1 RNA polymerase II associated protein 1 1 1
MIRT027586 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 1
MIRT027587 MIOS missing oocyte, meiosis regulator, homolog (Drosophila) 1 1
MIRT027588 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT027589 POM121C POM121 membrane glycoprotein C 1 1
MIRT027590 UBE2D3 ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) 1 1
MIRT027591 BTN2A1 butyrophilin, subfamily 2, member A1 1 1
MIRT027592 CEBPD CCAAT/enhancer binding protein (C/EBP), delta 1 1
MIRT027593 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT027594 CLP1 CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae) 1 1
MIRT027595 GNG5P2 guanine nucleotide binding protein (G protein), gamma 5 pseudogene 2 1 1
MIRT027596 TSC22D2 TSC22 domain family, member 2 1 1
MIRT027597 WDR73 WD repeat domain 73 1 1
MIRT027598 FAS Fas (TNF receptor superfamily, member 6) 1 1
MIRT027599 TXLNG taxilin gamma 1 1
MIRT027600 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT027601 PGRMC1 progesterone receptor membrane component 1 1 1
MIRT027602 PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha 1 1
MIRT027603 TTLL4 tubulin tyrosine ligase-like family, member 4 1 1
MIRT027604 TMEM38B transmembrane protein 38B 1 1
MIRT027605 SPARCL1 SPARC-like 1 (hevin) 1 1
MIRT027606 DDX10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 1 1
MIRT027607 IER3 immediate early response 3 1 1
MIRT027608 TMEM147 transmembrane protein 147 1 1
MIRT027609 ZDHHC3 zinc finger, DHHC-type containing 3 1 1
MIRT027610 KLF10 Kruppel-like factor 10 1 1
MIRT027611 NLE1 notchless homolog 1 (Drosophila) 1 1
MIRT027612 MITF microphthalmia-associated transcription factor 1 1
MIRT027613 RAPGEF4 Rap guanine nucleotide exchange factor (GEF) 4 1 1
MIRT027614 SGMS1 sphingomyelin synthase 1 1 1
MIRT027615 ICAM1 intercellular adhesion molecule 1 1 1
MIRT027616 CHPF2 chondroitin polymerizing factor 2 1 1
MIRT027617 WDR74 WD repeat domain 74 1 1
MIRT027618 OXA1L oxidase (cytochrome c) assembly 1-like 1 1
MIRT027619 RABGGTB Rab geranylgeranyltransferase, beta subunit 1 1
MIRT027620 TES testis derived transcript (3 LIM domains) 1 1
MIRT027621 DUSP10 dual specificity phosphatase 10 1 1
MIRT027622 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT027623 MOB3B MOB1, Mps One Binder kinase activator-like 2B (yeast) 1 1
MIRT027624 HIST1H2BF histone cluster 1, H2bf 1 1
MIRT027625 SYNGR2 synaptogyrin 2 1 1
MIRT027626 GPR37 G protein-coupled receptor 37 (endothelin receptor type B-like) 1 1
MIRT027627 ZFX zinc finger protein, X-linked 1 1
MIRT027628 TAF1D TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa 1 1
MIRT027629 HIST1H2BI histone cluster 1, H2bi 1 1
MIRT027630 TEX10 testis expressed 10 1 1
MIRT027631 TBC1D4 TBC1 domain family, member 4 1 1
MIRT027632 NAV2 neuron navigator 2 1 1
MIRT027633 TRAF3IP2 TRAF3 interacting protein 2 1 1
MIRT027634 PDSS1 prenyl (decaprenyl) diphosphate synthase, subunit 1 1 1
MIRT027635 ACTL8 actin-like 8 1 1
MIRT027636 WDR33 WD repeat domain 33 1 1
MIRT027637 PPT2 palmitoyl-protein thioesterase 2 1 1
MIRT027638 FZD10 frizzled homolog 10 (Drosophila) 1 1
MIRT027639 CLINT1 clathrin interactor 1 1 1
MIRT027640 FAM134C family with sequence similarity 134, member C 1 1
MIRT027641 C8orf4 chromosome 8 open reading frame 4 1 1
MIRT027642 HIST1H2AG histone cluster 1, H2ag 1 1
MIRT027643 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT027644 NFKB2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) 1 1
MIRT027645 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT027646 DOCK5 dedicator of cytokinesis 5 1 1
MIRT027647 HIST1H3D histone cluster 1, H3d 1 1
MIRT027648 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT027649 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT027650 KLF3 Kruppel-like factor 3 (basic) 1 1
MIRT027651 CD46 CD46 molecule, complement regulatory protein 1 1
MIRT027652 CNIH cornichon homolog (Drosophila) 1 1
MIRT027653 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT027654 STK17B serine/threonine kinase 17b 1 1
MIRT027655 MED24 mediator complex subunit 24 1 1
MIRT027656 COG5 component of oligomeric golgi complex 5 1 1
MIRT027657 RBM19 RNA binding motif protein 19 1 1
MIRT027658 HSPB7 heat shock 27kDa protein family, member 7 (cardiovascular) 1 1
MIRT027659 IFNAR1 interferon (alpha, beta and omega) receptor 1 1 1
MIRT027660 RAB30 RAB30, member RAS oncogene family 1 1
MIRT027661 THOC5 THO complex 5 1 1
MIRT027662 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 1 1
MIRT027663 PRRC2C HLA-B associated transcript 2-like 2 1 1
MIRT027664 SLC25A13 solute carrier family 25, member 13 (citrin) 1 1
MIRT027665 HK2 hexokinase 2 1 1
MIRT027666 AGPS alkylglycerone phosphate synthase 1 1
MIRT027667 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT027668 SLC16A3 solute carrier family 16, member 3 (monocarboxylic acid transporter 4) 1 1
MIRT027669 PIGC phosphatidylinositol glycan anchor biosynthesis, class C 1 1
MIRT027670 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT027671 VGLL3 vestigial like 3 (Drosophila) 1 1
MIRT027672 PLK2 polo-like kinase 2 (Drosophila) 1 1
MIRT027673 HDHD1 haloacid dehalogenase-like hydrolase domain containing 1A 1 1
MIRT027674 IQCB1 IQ motif containing B1 1 1
MIRT027675 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT027676 ALKBH1 alkB, alkylation repair homolog 1 (E. coli) 1 1
MIRT027677 SLC35F2 solute carrier family 35, member F2 1 1
MIRT027678 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 1
MIRT027679 FAM60A family with sequence similarity 60, member A 1 1
MIRT027680 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT027681 CRTAP cartilage associated protein 1 1
MIRT027682 E2F6 E2F transcription factor 6 1 1
MIRT027683 MAGEA2B melanoma antigen family A, 2B 1 1
MIRT027684 ESRP2 epithelial splicing regulatory protein 2 1 1
MIRT027685 ADA adenosine deaminase 1 1
MIRT027686 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT027687 CDC34 cell division cycle 34 homolog (S. cerevisiae) 1 1
MIRT027688 GDAP2 ganglioside induced differentiation associated protein 2 1 1
MIRT027689 SENP2 SUMO1/sentrin/SMT3 specific peptidase 2 1 1
MIRT027690 ASAP1 ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 1 1
MIRT027691 RPS6KB2 ribosomal protein S6 kinase, 70kDa, polypeptide 2 1 1
MIRT027692 SLC35D2 solute carrier family 35, member D2 1 1
MIRT027693 DIDO1 death inducer-obliterator 1 1 1
MIRT027694 HIST1H2BO histone cluster 1, H2bo 1 1
MIRT027695 HIST1H2BC histone cluster 1, H2bc 1 1
MIRT027696 LTBR lymphotoxin beta receptor (TNFR superfamily, member 3) 1 1
MIRT027697 SLC25A32 solute carrier family 25, member 32 1 1
MIRT027698 PTTG1IP pituitary tumor-transforming 1 interacting protein 1 1
MIRT027699 MTPAP mitochondrial poly(A) polymerase 1 1
MIRT027700 NRBF2 nuclear receptor binding factor 2 1 1
MIRT027701 FAM69A family with sequence similarity 69, member A 1 1
MIRT027702 LMO7 LIM domain 7 1 1
MIRT027703 PPRC1 peroxisome proliferator-activated receptor gamma, coactivator-related 1 1 1
MIRT027704 NFIL3 nuclear factor, interleukin 3 regulated 1 1
MIRT027705 SEMA3C sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C 1 1
MIRT027706 SLC17A5 solute carrier family 17 (anion/sugar transporter), member 5 1 1
MIRT027707 PRKRIR protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) 1 1
MIRT027708 MRTO4 mRNA turnover 4 homolog (S. cerevisiae) 1 1
MIRT027709 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 1
MIRT027710 NNMT nicotinamide N-methyltransferase 1 1
MIRT027711 HIST2H4B histone cluster 2, H4b 1 1
MIRT027712 MAGEB2 melanoma antigen family B, 2 1 1
MIRT027713 RNF111 ring finger protein 111 1 1
MIRT027714 CDKN2B cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) 1 1
MIRT027715 AIM1 absent in melanoma 1 1 1
MIRT027716 KCTD5 potassium channel tetramerisation domain containing 5 1 1
MIRT027717 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 1 1
MIRT027718 POLR1D polymerase (RNA) I polypeptide D, 16kDa 1 1
MIRT027719 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT027720 AKR1C3 aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) 1 1
MIRT027721 ZKSCAN8 zinc finger protein 192 1 1
MIRT027722 IFNGR1 interferon gamma receptor 1 1 1
MIRT027723 C10orf2 chromosome 10 open reading frame 2 1 1
MIRT027724 PLOD2 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 1 1
MIRT027725 HEG1 HEG homolog 1 (zebrafish) 1 1
MIRT027726 CXCL2 chemokine (C-X-C motif) ligand 2 1 1
MIRT027727 POLR3E polymerase (RNA) III (DNA directed) polypeptide E (80kD) 1 1
MIRT027728 NREP chromosome 5 open reading frame 13 1 1
MIRT027729 HIST1H2BD histone cluster 1, H2bd 1 1
MIRT027730 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 1 1
MIRT027731 PLAGL1 pleiomorphic adenoma gene-like 1 1 1
MIRT027732 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT027733 VAMP3 vesicle-associated membrane protein 3 (cellubrevin) 1 1
MIRT027734 SOAT1 sterol O-acyltransferase 1 1 1
MIRT027735 NUP98 nucleoporin 98kDa 1 1
MIRT027736 RGS19 regulator of G-protein signaling 19 1 1
MIRT027737 P2RX5 purinergic receptor P2X, ligand-gated ion channel, 5 1 1
MIRT027738 UTP20 UTP20, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT027739 DENND1A DENN/MADD domain containing 1A 1 1
MIRT027740 URB2 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) 1 1
MIRT027741 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT027742 SLC19A3 solute carrier family 19, member 3 1 1
MIRT027743 TBC1D30 TBC1 domain family, member 30 1 1
MIRT027744 KCTD14 potassium channel tetramerisation domain containing 14 1 1
MIRT027745 LRIG1 leucine-rich repeats and immunoglobulin-like domains 1 1 1
MIRT027746 PABPC4 poly(A) binding protein, cytoplasmic 4 (inducible form) 1 1
MIRT027747 NAA15 N(alpha)-acetyltransferase 15, NatA auxiliary subunit 1 1
MIRT027748 FLAD1 FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) 1 1
MIRT027749 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT027750 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 1
MIRT027751 TRAM2 translocation associated membrane protein 2 1 1
MIRT027752 DBF4 DBF4 homolog (S. cerevisiae) 1 1
MIRT027753 ITGA5 integrin, alpha 5 (fibronectin receptor, alpha polypeptide) 1 1
MIRT027754 ZFHX3 zinc finger homeobox 3 1 1
MIRT027755 TMEM41B transmembrane protein 41B 1 1
MIRT027756 FAM46C family with sequence similarity 46, member C 1 1
MIRT027757 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT027758 ALG8 asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae) 1 1
MIRT027759 GLMN glomulin, FKBP associated protein 1 1
MIRT027760 ERGIC2 ERGIC and golgi 2 1 1
MIRT027761 C6orf211 chromosome 6 open reading frame 211 1 1
MIRT027762 IMP4 IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) 1 1
MIRT027763 PSME4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT027764 DPAGT1 dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase) 1 1
MIRT027765 CTSC cathepsin C 1 1
MIRT027766 DTX4 deltex homolog 4 (Drosophila) 1 1
MIRT027767 ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 1 1
MIRT027768 S100A8 S100 calcium binding protein A8 1 1
MIRT027769 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT027770 TNFSF10 tumor necrosis factor (ligand) superfamily, member 10 1 1
MIRT027771 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT027772 NME6 non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) 1 1
MIRT027773 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 1
MIRT027774 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT027775 PCTP phosphatidylcholine transfer protein 1 1
MIRT027776 ZNF200 zinc finger protein 200 1 1
MIRT027777 C11orf57 chromosome 11 open reading frame 57 1 1
MIRT027778 FZD3 frizzled homolog 3 (Drosophila) 1 1
MIRT027779 CLUH KIAA0664 1 1
MIRT027780 CCNF cyclin F 1 1
MIRT027781 SEMA3G sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G 1 1
MIRT027782 SLC2A14 solute carrier family 2 (facilitated glucose transporter), member 14 1 1
MIRT027783 CXCR7 chemokine (C-X-C motif) receptor 7 1 1
MIRT027784 PICALM phosphatidylinositol binding clathrin assembly protein 1 1
MIRT027785 TNS1 tensin 1 1 1
MIRT027786 SOX4 SRY (sex determining region Y)-box 4 1 1
MIRT027787 CDK7 cyclin-dependent kinase 7 1 1
MIRT027788 SCG2 secretogranin II 1 1
MIRT027789 MCAT malonyl CoA:ACP acyltransferase (mitochondrial) 1 1
MIRT027790 GNA12 guanine nucleotide binding protein (G protein) alpha 12 1 1
MIRT027791 RB1CC1 RB1-inducible coiled-coil 1 1 1
MIRT027792 NELFCD TH1-like (Drosophila) 1 1
MIRT027793 USP36 ubiquitin specific peptidase 36 1 1
MIRT027794 DIEXF chromosome 1 open reading frame 107 1 1
MIRT027795 MAST4 microtubule associated serine/threonine kinase family member 4 1 1
MIRT027796 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT027797 HIST1H1C histone cluster 1, H1c 1 1
MIRT027798 COA1 chromosome 7 open reading frame 44 1 1
MIRT027799 CHD1 chromodomain helicase DNA binding protein 1 1 1
MIRT027800 CHST11 carbohydrate (chondroitin 4) sulfotransferase 11 1 1
MIRT027801 IP6K2 inositol hexakisphosphate kinase 2 1 1
MIRT027802 CFB complement factor B 1 1
MIRT027803 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 1
MIRT027804 WNT10B wingless-type MMTV integration site family, member 10B 1 1
MIRT027805 VANGL1 vang-like 1 (van gogh, Drosophila) 1 1
MIRT027806 C19orf53 chromosome 19 open reading frame 53 1 1
MIRT027807 GPN1 GPN-loop GTPase 1 1 1
MIRT027808 AK2 adenylate kinase 2 1 1
MIRT027809 FAM57A family with sequence similarity 57, member A 1 1
MIRT027810 JMJD4 jumonji domain containing 4 1 1
MIRT027811 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT027812 ZBED4 zinc finger, BED-type containing 4 1 1
MIRT027813 ZNF267 zinc finger protein 267 1 1
MIRT027814 C3 complement component 3 1 1
MIRT027815 TET3 tet oncogene family member 3 1 1
MIRT027816 BCL9 B-cell CLL/lymphoma 9 1 1
MIRT027817 ZFAND5 zinc finger, AN1-type domain 5 1 1
MIRT027818 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT027819 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 1
MIRT027820 HBEGF heparin-binding EGF-like growth factor 1 1
MIRT027821 MED13L mediator complex subunit 13-like 1 1
MIRT027822 MTUS1 microtubule associated tumor suppressor 1 1 1
MIRT027823 SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 1 1
MIRT027824 FKBP3 FK506 binding protein 3, 25kDa 1 1
MIRT027825 PLCXD1 phosphatidylinositol-specific phospholipase C, X domain containing 1 1 1
MIRT027826 PPAT phosphoribosyl pyrophosphate amidotransferase 1 1
MIRT027827 PIK3C3 phosphoinositide-3-kinase, class 3 1 1
MIRT027828 TCERG1 transcription elongation regulator 1 1 1
MIRT027829 CCNA2 cyclin A2 1 1
MIRT027830 SIGMAR1 sigma non-opioid intracellular receptor 1 1 1
MIRT027831 RHOBTB3 Rho-related BTB domain containing 3 1 1
MIRT027832 SLC7A6 solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 1 1
MIRT027833 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 1 1
MIRT027834 LGR4 leucine-rich repeat-containing G protein-coupled receptor 4 1 1
MIRT027835 C5orf30 chromosome 5 open reading frame 30 1 1
MIRT027836 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT027837 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 1 1
MIRT027838 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT027839 RIPK2 receptor-interacting serine-threonine kinase 2 1 1
MIRT027840 WARS2 tryptophanyl tRNA synthetase 2, mitochondrial 1 1
MIRT027841 PRKAA2 protein kinase, AMP-activated, alpha 2 catalytic subunit 1 1
MIRT027842 LEPROTL1 leptin receptor overlapping transcript-like 1 1 1
MIRT027843 ANKRD11 ankyrin repeat domain 11 1 1
MIRT027844 UST uronyl-2-sulfotransferase 1 1
MIRT027845 CHST3 carbohydrate (chondroitin 6) sulfotransferase 3 1 1
MIRT027846 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif, 5 1 1
MIRT027847 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT027848 MAGEA2 melanoma antigen family A, 2 1 1
MIRT027849 NEK3 NIMA (never in mitosis gene a)-related kinase 3 1 1
MIRT027850 ERO1L ERO1-like (S. cerevisiae) 1 1
MIRT027851 POU2F1 POU class 2 homeobox 1 1 1
MIRT027852 HMGA1 high mobility group AT-hook 1 1 1
MIRT027853 IGF2BP2 insulin-like growth factor 2 mRNA binding protein 2 1 1
MIRT027854 RNF44 ring finger protein 44 1 1
MIRT027855 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 1 1
MIRT027856 SNAP23 synaptosomal-associated protein, 23kDa 1 1
MIRT027857 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 1
MIRT027858 DICER1 dicer 1, ribonuclease type III 1 1
MIRT027859 ABT1 activator of basal transcription 1 1 1
MIRT027860 XK X-linked Kx blood group (McLeod syndrome) 1 1
MIRT027861 FGD6 FYVE, RhoGEF and PH domain containing 6 1 1
MIRT027862 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 1 1
MIRT027863 IRS2 insulin receptor substrate 2 1 1
MIRT027864 FRMD4B FERM domain containing 4B 1 1
MIRT027865 TGFBR1 transforming growth factor, beta receptor 1 1 1
MIRT027866 PPP4C protein phosphatase 4, catalytic subunit 1 1
MIRT027867 MRS2 MRS2 magnesium homeostasis factor homolog (S. cerevisiae) 1 1
MIRT027868 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT048710 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 1 1
MIRT048711 CDC42BPA CDC42 binding protein kinase alpha (DMPK-like) 1 1
MIRT048712 E2F4 E2F transcription factor 4, p107/p130-binding 1 1
MIRT048713 NDUFAF3 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 1 1