Accession ID: MIRT028679 [miRNA, hsa-miR-30a-5p :: GNA13, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-30aLinkOut: [miRBase ]
Description Homo sapiens miR-30a stem-loop
Comment The mature sequences miR-30 . Related miRNAs are processed from the 5' arms of other precursor loci (mir-30b, MIR:MI0000441; mir-30c-1, MIR:MI0000736; mir-30c-2, MIR:MI0000254; mir-30d, MIR:MI0000255; mir-30e, MI0000749).
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-30a-5p
Mature Sequence 6| UGUAAACAUCCUCGACUGGAAG |27
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-30a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol GNA13 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms G13
Description guanine nucleotide binding protein (G protein), alpha 13
Transcript NM_006572    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on GNA13 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of GNA13
(miRNA target sites are highlighted)
>GNA13|NM_006572|3'UTR
   1 TGTACAAAAGACTTGCTGTTTTAATATCTTTTTGTGTTTTTGATGTTTTCTGTTTGTTTTGTTTTTTAAAATAGCAGTTT
  81 ACAACCAGAATTAGAACAATCTTAATTCTACGTTTAACTTCTTGAAAATCTTAGTACTTTTTCTGCGGCCTTTGGTTTGT
 161 GGCTGAAAGCTGTTGAGTGACTCATCGCCAAGATTTGCTGTAATGCAGGCTTTGATCTGTTTCACCATGGCTTCTATTCA
 241 AGTCCAGTTAAAACCTCCCAGCTGACCTCAGACTAGGCATATTTCAGGCTTTAAATTATTCTACTTTCCAAACTGAATTC
 321 TCCTGCAGTGCCAAGTATCAAAGGTGTCCTTAAATACTTGTAGGGATGAGGTTAGGAATATTCAGTTCCAAAACAAGATA
 401 TCTTCTGTCCGCCTTACATATAGCAGTGACACTTGTTGCCTAACTTTATGGTGACCTCCTATTTTGTAAGGGCTGTTAGA
 481 AGTTCTATCTAAGAAATGGCATTCTGTAGGTTTATAGAAGGTTTAGCCTTCATATTTTAATTGCTTGTATACACAACAGC
 561 TGTTTTGCTTTTAGATTTCTGTGTTTCTGAAGGTAATGTTCTTCCTGTTTTCAAGTTTACATAAGGATCTTTGGTCTGAT
 641 GCTGATGAAGAGTTCACAGGTGGTATGGGAGAGCAAAAGGCAAGCTAATGCTGTTTACCGTGTTTTGGTCAAACGTAACG
 721 AGTGAAATAGAATTTGCCTTTCTCATATTTAATTATCATGTAGTTTAATGTACCATATGTGAAACATTCTGGCCATAGCA
 801 GCAACTAAAAACTGCAAGCAACTTGGTAACAGAACTTTCTAAATAAACTTAACCTGTTCCAGAATGTCATGTATTTGACT
 881 TTTAAGCCCTATCTCAGTTGGTCAGTAAAGACCAATCCTTACTGTAGGAAATCATTGTTGTATCATCACAAACATCTATC
 961 TTTTGCTGTCCTGTCCAGTCCCATCAACTCCACACTGTGCCATTTGTGGCATCGTTTTGTTTATTTGGAGTTTGCTAAGG
1041 GCAGTATTTTTCTGTCAAGACTATTCAAGAAGGCATTATTTGAGATTCCTGTTCATTCTTGGTGTGTCTCTAACAGATAC
1121 AGTATGTATACATTTGTATAATTGTTGTTGTTGAAAGTCCAGCTTTTTTGAGGTATATTTTAAATGTTTTAAGGATGCTT
1201 CTAAGGATCAGTAGTAATTTTTTTAGTTCGCACCTAAAGATGATTACATTGACCTCCCCCGACTGCTTACCAAATTAAAA
1281 TGTGTCCACGAAGTAGCTTTGTGATCGCAGATACATTCATAGTGAACTCATCAGAATGGCTGGTTTGCAGTACTGAAATA
1361 CTATCTTCTAGGCTGTATGTAGTGCTACAATTAGAGAAACAGAAGTCCAAGGCTGGCGACAGCTTGAAAAGTCTGACAGC
1441 TTTTCTACTTTTCCTGAAAATTTTAAGACTGTGATATCTGTCATTTTACTGTATAGCTGACTGTGTACTCAGGTATTTTA
1521 TTGGTCCTTGAAAGATTGGTCGTTATGGATCACCCAGCCTTTCCAAGTCAGTGGCTGTTGTTCTGTCTTGCTGTCTGATA
1601 CGAGAGTGGGGCTTTTCAGTGAACTAACCAGGGATTGTTCTTGACATACCTGACTTTTCTCACATTTGAACTTCCACTAT
1681 CATTGTATCCATATAACTTCTAGCATTTTCATGCCATGGTAATCCATGAGCTACACATACGTAGCCCGGCACCGTGATGC
1761 AAGTTCATGGTATCGTGCATGTTCGTGGTATCATGGTATCATTCATGCGTGTTTGAATAGTTCTACATCTAGTGCTTCTT
1841 GCCAAAAAGAATACATTGTTTAAATTCACAAAATTAGCATAATTGCAGTGCTAATGAATATCGGAATATGTGCACAGTAA
1921 CATTTGGACTATTCATTGGAGAGTTTACCCATACATTTAGCAAATTGAATGGCCAAAACATTTGACTCCAGTGAGGGCTC
2001 AAGTTAGATCCCTATAGAAAGAGGACACTTCATCTTACTTAAGTCATAGTTAAGATCTGTGATACGAACCATAGATATTG
2081 CCTGACAAAGCAGAAATCACCAAGTTTCCCCCTTTTGAATTACCACCAAGAAGTGTTGAAACACCAAATAGATATCATGT
2161 TATTTTGGGCATTTGCAGTTTTCTTCCCTGCTGCATGTAATGTCTCAGAATCAACATTCTTTTAAAATCTAGACTATATT
2241 TTGAGGCAATGAATTACTTATATTCAACTTAGGCTTGTTTTGACATTCAGTAGAACTTTAAGTTCAATCTAAAGGCTTCA
2321 GTCCACATTTTTTTATACGTTGTATTTTAAAAACGTTTGAAAGGAGTCTTACACCTGTATCATGAAAACTGAATCCTTTT
2401 GAAATACCACTATATGAAGAGAGAGATGAAATTTAGTGAACAGAATTGAAAAGGTGCTCATAATTTCACTATGCAAACTT
2481 ACCCCAGTCTCTAAAAAAGTAATTTAGATTTAAAGTTCTTTGATGTATTTGATTTTCTAAATCTTTATGGTTATGATTTG
2561 GAATAAAATGTGCCTAATCCTGTGTTACATTCTGTTCTTAAATCTGAATGCCTTCTCATTTAATTCTGAGGAAATATCAC
2641 ACAAGTGTCTTCATTGACCTTGAAGAAATGTATATACAGTTGCCTTATAAAACAACATAAATTTAGACCATAACTTTTAT
2721 AGAGAAAGGGTTTTGTCAAATGTTTTCTGAAAATCTGAGTAATTCAAAGCATGCCTCTGCCCCTTTAATATTTTTAATAA
2801 CCTGCATTGTTGCTGTCTGCCAAATATTAAATTGAAATCTTCATTTCAATTTTATTATCTGGAAAGGGCACTGGATTGCT
2881 CTGCAACCAAAGAAAGCAATATGGAATGAAAAAACTCATTCACTTTTGTCTTATTTTCTTTTAAGGTGTATTGGCATGTA
2961 ATTTGCATAGAGAAGGTCCTCTGGTTAGTCTCTCAAATTGAGGCTGTTTAGGGAAATCCTTATTCAGTTGGTGGCAGTGG
3041 TTGGTTTAAAGTAGAAGGAAATAAGATCGCCTTAATACCAGAAATGATTAGAAGTGCTGATTTAGATTCAACAAATACCA
3121 TATGTCCTTATCATTTTTTGTAAGAAGAAATTGGTTAAGTCCTAACTTTCAATGTGTACCCAAATACTTGTATTTATGCT
3201 TTTGATAAAATGTATTTTCAGCATTAATACACATCCGATTATGCCTTATTTATATATGAAGAATAAAGTTACCATGTTAT
3281 ACTGTTATGTCCTAAAATTCAAATCACTATTTGAGAAACCCTCAAATTGGTGCTTTCATTATATAATGATACATTTAGAC
3361 AAAACCCCAAACTAAGCCATTTGAAACAAGATTCTCTCCATTGCAGTTTGTAGCAATGTTATTTCTGTGTATGTCATGAG
3441 AAGGCTAAATATCAGTGTTAATTTCTTGTTTGAATCCGTGAAATCATGCCTGTAAAGCCCAAACATTTGTAACAAACTCC
3521 CTAATAAATTTAGAGAAAGTCACTCTGTTACCATTTCATTTATTTTAGTTTTATTTGAGAAATTAAGACCAGAAGTTTTG
3601 CTCATGTCTTTTTCACTTGGAAATCTGACTTAGTACCTAGTTAATTTGTCTCTCTCCCATCATTTTAAGGCGTTCGCTTC
3681 TGTTAATCACAGATGATCTGTCCTTGTGTTGTGCTGCTTGACTAAAAGCACTGTTTTGTTTTGTTTTGTTTTGTTTTTTA
3761 ATGATAGGATACAGGGTGGCTTTTCAGTCTAGTAAACATGAGGAGGGGAGAGATTGTGGGTGGGTGTGGGTGTGTCCGCA
3841 TGTCCCAAATACAGCACATGCCCATTTTTTTATGGTACGAGGTTAGGGCTTATTAATAAATGTATACTAGATCTTGAAGT
3921 GTAAGTCTAAGTCTGAACATTTTAAACAAGTTGGACTTTATGGCTTTTTCAAGTTCCATCAAGTAGATACTAGTCTTAGG
4001 CTGGTAGGTGATTAACAACATCATTTGGAGTACAGTGTTTGTACCACTAGCATTCTTATGTCTGTACTTGAACGTGTAGT
4081 TAGCATTTAAGTTATGTTCACTCTTGTAGCATTCAGGTCTTACCATCTGGTTTCAAATGCGAGAGCTTATATGAACATTG
4161 TTTTGAAAGCATGAATGATATGGCAATATTTTATGTCTTGATAAGGAGAGTTTTGTGACATATACAAATCTGCTGTTGAT
4241 GATGAAAGTTTACAGGTGGATCAGAGTATGCTGGAACTCAGTGTGCATAAAATTTCAGTCAGTGAATATCACTGAACGTC
4321 ATATACTACTTGGTATGTGACTTTGGTTTGTGTTAAGAAAGCTTGTATATAATATTTTTTGCCATAGTAAGTGAGAAATT
4401 GTCCTTAATCATGCCTGTTTGATGGTACTAGGAAAGAAAGGGGTAGAGATTAATTCTTGCACAGTATAAGCAACAGTGCA
4481 ACAAACTATGCCATTTACCTTTTACCTCTTACTTGAAGGCAGAATCGCAAAACGTTTGAAATGGCTTTTCTAAACTACTC
4561 TACTCTGGTGAGAGCTCATTTACCACAAGAAGCCTTATAAAAAAGTATATTTTGTAATAACCCCGTAGATACTGTACCTA
4641 ACAAAACATGACTCGTATTAGCTCTATAAAATATTTGTGGCTTAGGATTTTTTTTTTACATATATCTTTTTATAACTTTC
4721 CAGGAACTAAGCACATTATCTGATAATTGTTGTAAATTTTTTTGTCAGTGCTTTAGTTCAGGATGGGCAATAAATTATTT
4801 CTAAAGGAGGTCTAAAAGTGGAAAGAATGGTTTGATTTTATAAAATGAGTTGCTAGTTCATTACAGCTTTTTACTTTTGT
4881 ACATATTTTGCAAAACATTTGCCTCTTGCTATTAATATTTGCTTTGTAAAAATTACTGACATTTAATAAACATTTGTAAA
4961 CAATTCAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaAGGUCAGCUCCUACAAAUgu 5'
            || | |:|||| ||||||  
Target 5' tcTCAAATTGAGGCTGTTTAgg 3'
2991 - 3012 152.00 -12.30
2
miRNA  3' gaaGGUCAGCUCCUACAAAUGu 5'
             | || : | | ||||||| 
Target 5' aggCAAGCTAATGCTGTTTACc 3'
678 - 699 151.00 -5.70
3
miRNA  3' gaaGGUCAGCUCC-U------ACAAAUGu 5'
             ||| |:| || |      ||||||: 
Target 5' gtgCCATTTGTGGCATCGTTTTGTTTATt 3'
997 - 1025 133.00 -11.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30a-5p :: GNA13    [ Functional MTI ]
Validation Method Proteomics
Article - Selbach, M. Schwanhausser, B. Thierfelder, et al.
- Nature, 2008
Animal microRNAs (miRNAs) regulate gene expression by inhibiting translation and/or by inducing degradation of target messenger RNAs. It is unknown how much translational control is exerted by miRNAs on a genome-wide scale. We used a new proteomic approach to measure changes in synthesis of several thousand proteins in response to miRNA transfection or endogenous miRNA knockdown. In parallel, we quantified mRNA levels using microarrays. Here we show that a single miRNA can repress the production of hundreds of proteins, but that this repression is typically relatively mild. A number of known features of the miRNA-binding site such as the seed sequence also govern repression of human protein synthesis, and we report additional target sequence characteristics. We demonstrate that, in addition to downregulating mRNA levels, miRNAs also directly repress translation of hundreds of genes. Finally, our data suggest that a miRNA can, by direct or indirect effects, tune protein synthesis from thousands of genes.
LinkOut: [PMID: 18668040]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30a-5p :: GNA13    [ Functional MTI ]
Validation Method
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30a-5p :: GNA13    [ Functional MTI ]
Validation Method
Article - Gottwein, E. Corcoran, D. L. Mukherjee, N. et al.
- Cell Host Microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000439174.2 | 3UTR | UUUUUUAAAAUAGCAGUUUACAACCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000439174.2 | 3UTR | UUUUUUAAAAUAGCAGUUUACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000439174.2 | 3UTR | UUUUUUAAAAUAGCAGUUUAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000439174.2 | 3UTR | UUUUUUAAAAUAGCAGUUUAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000439174.2 | 3UTR | UCAAGUUUACAUAAGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000439174.2 | 3UTR | UCAAGUUUACAUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
703 hsa-miR-30a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001946 BDNF brain-derived neurotrophic factor 2 1
MIRT002876 NOTCH1 notch 1 5 2
MIRT004509 BECN1 beclin 1, autophagy related 3 2
MIRT004785 TNRC6A trinucleotide repeat containing 6A 3 3
MIRT005120 HNRNPM heterogeneous nuclear ribonucleoprotein M 2 1
MIRT005121 ELMOD2 ELMO/CED-12 domain containing 2 2 1
MIRT005122 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 3 2
MIRT005123 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 2 1
MIRT005124 TMEM87A transmembrane protein 87A 2 1
MIRT005125 IDH1 isocitrate dehydrogenase 1 (NADP+), soluble 2 1
MIRT005126 SEC62 SEC62 homolog (S. cerevisiae) 2 1
MIRT005127 CHD1 chromodomain helicase DNA binding protein 1 3 2
MIRT005128 JUN jun proto-oncogene 2 1
MIRT005129 SLC4A10 solute carrier family 4, sodium bicarbonate transporter, member 10 2 1
MIRT005130 NT5E 5'-nucleotidase, ecto (CD73) 2 1
MIRT005131 LMNB2 lamin B2 2 1
MIRT005132 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 3 2
MIRT005133 TMEM41B transmembrane protein 41B 2 1
MIRT005134 CPNE8 copine VIII 2 1
MIRT005135 MBNL1 muscleblind-like splicing regulator 1 2 1
MIRT005136 KDELC2 KDEL (Lys-Asp-Glu-Leu) containing 2 2 1
MIRT005137 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 3 2
MIRT005138 TMEM59 transmembrane protein 59 2 1
MIRT005139 TMED10 transmembrane emp24-like trafficking protein 10 (yeast) 2 1
MIRT005140 TMED3 transmembrane emp24 protein transport domain containing 3 2 1
MIRT005141 SLC38A1 solute carrier family 38, member 1 2 1
MIRT005142 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 2 1
MIRT005143 IFRD1 interferon-related developmental regulator 1 2 1
MIRT005144 PEX11B peroxisomal biogenesis factor 11 beta 2 1
MIRT005145 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 2 1
MIRT005146 SLC9A3R2 solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2 2 1
MIRT005147 GPD2 glycerol-3-phosphate dehydrogenase 2 (mitochondrial) 2 1
MIRT005148 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 3 2
MIRT005149 PTGFRN prostaglandin F2 receptor negative regulator 2 1
MIRT005150 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 2 1
MIRT005151 NCEH1 neutral cholesterol ester hydrolase 1 2 1
MIRT005152 SEC23A Sec23 homolog A (S. cerevisiae) 2 1
MIRT005153 PBRM1 polybromo 1 3 2
MIRT005154 MLLT11 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 2 1
MIRT005155 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 3 2
MIRT005156 DPY19L1 dpy-19-like 1 (C. elegans) 2 1
MIRT005157 C1D C1D nuclear receptor corepressor 2 1
MIRT005158 LTN1 listerin E3 ubiquitin protein ligase 1 2 1
MIRT005159 NPR3 natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) 2 1
MIRT005160 SLC38A2 solute carrier family 38, member 2 2 1
MIRT005161 PTPRK protein tyrosine phosphatase, receptor type, K 2 1
MIRT005162 WNT5A wingless-type MMTV integration site family, member 5A 2 1
MIRT005163 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 2 1
MIRT005164 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 3 2
MIRT005165 ATRX alpha thalassemia/mental retardation syndrome X-linked 2 1
MIRT005166 STMN1 stathmin 1 2 1
MIRT005167 MET met proto-oncogene (hepatocyte growth factor receptor) 2 1
MIRT005168 P4HA2 prolyl 4-hydroxylase, alpha polypeptide II 2 1
MIRT005169 LRRC8C leucine rich repeat containing 8 family, member C 2 1
MIRT005170 MPDU1 mannose-P-dolichol utilization defect 1 2 1
MIRT005171 THEM4 thioesterase superfamily member 4 2 1
MIRT005172 RAD23B RAD23 homolog B (S. cerevisiae) 3 2
MIRT005173 CNPY4 canopy 4 homolog (zebrafish) 2 1
MIRT005174 KRT85 keratin 85 2 1
MIRT005175 PGM1 phosphoglucomutase 1 2 1
MIRT005176 SLC12A4 solute carrier family 12 (potassium/chloride transporters), member 4 2 1
MIRT005177 PTRH1 peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) 2 1
MIRT005178 CDCP1 CUB domain containing protein 1 2 1
MIRT005179 ADPGK ADP-dependent glucokinase 2 1
MIRT005180 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 2 1
MIRT005181 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 3 2
MIRT005182 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 2 1
MIRT005183 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 2 1
MIRT005184 NT5C3 5'-nucleotidase, cytosolic III 2 1
MIRT005185 TMCO1 transmembrane and coiled-coil domains 1 2 1
MIRT005186 TMED7 transmembrane emp24 protein transport domain containing 7 2 1
MIRT005187 TMED2 transmembrane emp24 domain trafficking protein 2 3 2
MIRT005188 PPP2R4 protein phosphatase 2A activator, regulatory subunit 4 2 1
MIRT005189 CEP72 centrosomal protein 72kDa 2 1
MIRT005190 MTX3 metaxin 3 2 1
MIRT005191 STRN striatin, calmodulin binding protein 3 2
MIRT005192 SEC11C SEC11 homolog C (S. cerevisiae) 2 1
MIRT005193 RRP36 ribosomal RNA processing 36 homolog (S. cerevisiae) 2 1
MIRT005194 RBMS1 RNA binding motif, single stranded interacting protein 1 2 1
MIRT005195 TBCB tubulin folding cofactor B 2 1
MIRT005196 TNFAIP2 tumor necrosis factor, alpha-induced protein 2 2 1
MIRT005197 RAB27B RAB27B, member RAS oncogene family 2 1
MIRT005198 PPP3CA protein phosphatase 3, catalytic subunit, alpha isozyme 2 1
MIRT005199 STX7 syntaxin 7 2 1
MIRT005200 UAP1 UDP-N-acteylglucosamine pyrophosphorylase 1 2 1
MIRT005201 LIMCH1 LIM and calponin homology domains 1 2 1
MIRT005202 DOCK7 dedicator of cytokinesis 7 2 1
MIRT005203 SYPL1 synaptophysin-like 1 2 1
MIRT005204 NCL nucleolin 2 1
MIRT005205 NUCB1 nucleobindin 1 2 1
MIRT005206 RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) 2 1
MIRT005207 FXR2 fragile X mental retardation, autosomal homolog 2 2 1
MIRT005208 C5orf15 chromosome 5 open reading frame 15 2 1
MIRT005209 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 2 1
MIRT005210 PRPF40A PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) 2 1
MIRT005211 ANPEP alanyl (membrane) aminopeptidase 2 1
MIRT005212 MYO10 myosin X 2 1
MIRT005213 MAT2A methionine adenosyltransferase II, alpha 2 1
MIRT005214 CTSL1 cathepsin L1 2 1
MIRT005215 FRG1 FSHD region gene 1 2 1
MIRT005216 WDR82 WD repeat domain 82 2 1
MIRT005217 CBFB core-binding factor, beta subunit 2 1
MIRT006319 SMAD1 SMAD family member 1 2 1
MIRT006563 DTL denticleless E3 ubiquitin protein ligase homolog (Drosophila) 3 1
MIRT006606 Snai1 snail homolog 1 (Drosophila) 2 1
MIRT006760 SNAI1 snail homolog 1 (Drosophila) 4 3
MIRT007097 PIK3CD phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta 3 1
MIRT007218 PRDM1 PR domain containing 1, with ZNF domain 2 2
MIRT007238 SEPT7 septin 7 1 1
MIRT007276 AVEN apoptosis, caspase activation inhibitor 1 1
MIRT007277 FOXD1 forkhead box D1 1 1
MIRT007296 TUBB4B tubulin, beta 4B class IVb 1 1
MIRT007297 NEUROD1 neuronal differentiation 1 1 1
MIRT007359 ABL1 c-abl oncogene 1, non-receptor tyrosine kinase 2 1
MIRT028389 CD44 CD44 molecule (Indian blood group) 1 1
MIRT028390 CDC123 cell division cycle 123 homolog (S. cerevisiae) 1 1
MIRT028391 CNDP2 CNDP dipeptidase 2 (metallopeptidase M20 family) 1 1
MIRT028392 SARS seryl-tRNA synthetase 1 1
MIRT028393 RAB34 RAB34, member RAS oncogene family 1 1
MIRT028394 DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 1 1
MIRT028395 PPID peptidylprolyl isomerase D 1 1
MIRT028396 SEC11A SEC11 homolog A (S. cerevisiae) 1 1
MIRT028397 UTP11L UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) 1 1
MIRT028398 MOSPD2 motile sperm domain containing 2 1 1
MIRT028399 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT028400 KIF5B kinesin family member 5B 2 4
MIRT028401 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT028402 YBX3 cold shock domain protein A 1 1
MIRT028403 NDEL1 nudE nuclear distribution E homolog (A. nidulans)-like 1 2 2
MIRT028404 UBE2H ubiquitin-conjugating enzyme E2H 1 1
MIRT028405 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 1 1
MIRT028406 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 1 1
MIRT028407 TOM1 target of myb1 (chicken) 1 1
MIRT028408 SERPINB5 serpin peptidase inhibitor, clade B (ovalbumin), member 5 1 1
MIRT028409 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT028410 ESRRA estrogen-related receptor alpha 1 1
MIRT028411 CPSF3L cleavage and polyadenylation specific factor 3-like 1 1
MIRT028412 SCAF1 SR-related CTD-associated factor 1 1 1
MIRT028413 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT028414 MPP2 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) 1 1
MIRT028415 SMN2 survival of motor neuron 2, centromeric 1 1
MIRT028416 EFTUD1 elongation factor Tu GTP binding domain containing 1 1 1
MIRT028417 KRT7 keratin 7 1 1
MIRT028418 PHLDA2 pleckstrin homology-like domain, family A, member 2 1 1
MIRT028419 RHOF ras homolog family member F (in filopodia) 1 1
MIRT028420 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT028421 ARF6 ADP-ribosylation factor 6 1 1
MIRT028422 OGFOD1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT028423 DNAJA4 DnaJ (Hsp40) homolog, subfamily A, member 4 1 1
MIRT028424 PPA1 pyrophosphatase (inorganic) 1 1 1
MIRT028425 NXT1 NTF2-like export factor 1 1 1
MIRT028426 SCYL1 SCY1-like 1 (S. cerevisiae) 1 1
MIRT028427 HK1 hexokinase 1 1 1
MIRT028428 PCNT pericentrin 1 1
MIRT028429 TRRAP transformation/transcription domain-associated protein 1 1
MIRT028430 AK1 adenylate kinase 1 1 1
MIRT028431 TGFBI transforming growth factor, beta-induced, 68kDa 1 1
MIRT028432 PDLIM7 PDZ and LIM domain 7 (enigma) 1 1
MIRT028433 C16orf62 chromosome 16 open reading frame 62 1 1
MIRT028434 CIRBP cold inducible RNA binding protein 1 1
MIRT028435 EIF2B4 eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa 1 1
MIRT028436 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT028437 HEATR2 HEAT repeat containing 2 1 1
MIRT028438 TLDC1 KIAA1609 1 1
MIRT028439 TNPO3 transportin 3 1 1
MIRT028440 MGST2 microsomal glutathione S-transferase 2 1 1
MIRT028441 JUP junction plakoglobin 1 1
MIRT028442 DNAJC2 DnaJ (Hsp40) homolog, subfamily C, member 2 1 1
MIRT028443 CPSF3 cleavage and polyadenylation specific factor 3, 73kDa 1 1
MIRT028444 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT028445 RFT1 RFT1 homolog (S. cerevisiae) 1 1
MIRT028446 AP2S1 adaptor-related protein complex 2, sigma 1 subunit 1 1
MIRT028447 SDCBP syndecan binding protein (syntenin) 1 1
MIRT028448 SEC24B SEC24 family, member B (S. cerevisiae) 1 1
MIRT028449 LSM12 LSM12 homolog (S. cerevisiae) 1 1
MIRT028450 CAST calpastatin 1 1
MIRT028451 FDX1 ferredoxin 1 1 1
MIRT028452 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT028453 NOL8 nucleolar protein 8 1 1
MIRT028454 TMEM192 transmembrane protein 192 1 1
MIRT028455 DYNC1LI1 dynein, cytoplasmic 1, light intermediate chain 1 2 2
MIRT028456 RETSAT retinol saturase (all-trans-retinol 13,14-reductase) 1 1
MIRT028457 BCL2L1 BCL2-like 1 1 1
MIRT028458 NCKAP1 NCK-associated protein 1 1 1
MIRT028459 LDLR low density lipoprotein receptor 2 2
MIRT028460 REEP5 receptor accessory protein 5 1 1
MIRT028461 CPOX coproporphyrinogen oxidase 1 1
MIRT028462 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 1
MIRT028463 GLIPR1 GLI pathogenesis-related 1 1 1
MIRT028464 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT028465 CCPG1 cell cycle progression 1 1 1
MIRT028466 MARCH5 membrane-associated ring finger (C3HC4) 5 1 1
MIRT028467 RND3 Rho family GTPase 3 1 1
MIRT028468 DERL1 derlin 1 1 1
MIRT028469 RAB14 RAB14, member RAS oncogene family 1 1
MIRT028470 ACP2 acid phosphatase 2, lysosomal 1 1
MIRT028471 OSBPL8 oxysterol binding protein-like 8 1 1
MIRT028472 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT028473 RRM2 ribonucleotide reductase M2 2 3
MIRT028474 ITGA6 integrin, alpha 6 1 1
MIRT028475 DHX36 DEAH (Asp-Glu-Ala-His) box polypeptide 36 1 1
MIRT028476 XPO1 exportin 1 (CRM1 homolog, yeast) 2 2
MIRT028477 RHOB ras homolog family member B 1 1
MIRT028478 MTDH metadherin 4 3
MIRT028479 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 1 1
MIRT028480 MAN2B1 mannosidase, alpha, class 2B, member 1 1 1
MIRT028481 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT028482 TUBB3 tubulin, beta 3 class III 1 1
MIRT028483 TM9SF1 transmembrane 9 superfamily member 1 1 1
MIRT028484 USP5 ubiquitin specific peptidase 5 (isopeptidase T) 1 1
MIRT028485 KRT77 keratin 77 1 1
MIRT028486 PPP1R10 protein phosphatase 1, regulatory subunit 10 1 1
MIRT028487 PAICS phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase 1 1
MIRT028488 SON SON DNA binding protein 1 1
MIRT028489 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 1
MIRT028490 GTF2H2C general transcription factor IIH, polypeptide 2C 1 1
MIRT028491 GLRX glutaredoxin (thioltransferase) 1 1
MIRT028492 SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1 1
MIRT028493 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT028494 SUCLA2 succinate-CoA ligase, ADP-forming, beta subunit 1 1
MIRT028495 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 1
MIRT028496 SMN1 survival of motor neuron 1, telomeric 1 1
MIRT028497 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT028498 GNG2 guanine nucleotide binding protein (G protein), gamma 2 1 1
MIRT028499 KRT6B keratin 6B 1 1
MIRT028500 RRP15 ribosomal RNA processing 15 homolog (S. cerevisiae) 1 1
MIRT028501 PPOX protoporphyrinogen oxidase 1 1
MIRT028502 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT028503 DHX8 DEAH (Asp-Glu-Ala-His) box polypeptide 8 1 1
MIRT028504 RPRD1B regulation of nuclear pre-mRNA domain containing 1B 1 1
MIRT028505 GTF2H2 general transcription factor IIH, polypeptide 2, 44kDa 1 1
MIRT028506 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT028507 PLA2G4A phospholipase A2, group IVA (cytosolic, calcium-dependent) 1 1
MIRT028508 NT5C1B 5'-nucleotidase, cytosolic IB 1 1
MIRT028509 SLC12A2 solute carrier family 12 (sodium/potassium/chloride transporters), member 2 1 1
MIRT028510 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT028511 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT028512 PRMT1 protein arginine methyltransferase 1 1 1
MIRT028513 MAK16 MAK16 homolog (S. cerevisiae) 1 1
MIRT028514 TRIO trio Rho guanine nucleotide exchange factor 1 1
MIRT028515 YRDC yrdC domain containing (E. coli) 1 1
MIRT028516 TICAM2 toll-like receptor adaptor molecule 2 1 1
MIRT028517 NFU1 NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) 1 1
MIRT028518 CDC20 cell division cycle 20 homolog (S. cerevisiae) 1 1
MIRT028519 MKI67IP MKI67 (FHA domain) interacting nucleolar phosphoprotein 1 1
MIRT028520 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT028521 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT028522 HINT3 histidine triad nucleotide binding protein 3 1 1
MIRT028523 DAG1 dystroglycan 1 (dystrophin-associated glycoprotein 1) 1 1
MIRT028524 RBMS3 RNA binding motif, single stranded interacting protein 3 1 1
MIRT028525 EIF2B1 eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa 1 1
MIRT028526 PLIN3 perilipin 3 1 1
MIRT028527 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT028528 IFRD2 interferon-related developmental regulator 2 1 1
MIRT028529 INTS6 integrator complex subunit 6 1 1
MIRT028530 URM1 ubiquitin related modifier 1 1 1
MIRT028531 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT028532 CSNK1G1 casein kinase 1, gamma 1 2 4
MIRT028533 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT028534 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT028535 KIF11 kinesin family member 11 2 3
MIRT028536 LARP4 La ribonucleoprotein domain family, member 4 1 1
MIRT028537 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT028538 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT028539 KIDINS220 kinase D-interacting substrate, 220kDa 1 1
MIRT028540 ATL2 atlastin GTPase 2 1 1
MIRT028541 DSG2 desmoglein 2 1 1
MIRT028542 FXR1 fragile X mental retardation, autosomal homolog 1 1 1
MIRT028543 VIM vimentin 5 2
MIRT028544 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 4
MIRT028545 SEC24A SEC24 family, member A (S. cerevisiae) 2 2
MIRT028546 LCLAT1 lysocardiolipin acyltransferase 1 2 2
MIRT028547 ELOVL5 ELOVL fatty acid elongase 5 2 2
MIRT028548 SAMD9 sterile alpha motif domain containing 9 1 1
MIRT028549 RBM34 RNA binding motif protein 34 1 1
MIRT028550 PAIP1 poly(A) binding protein interacting protein 1 1 1
MIRT028551 EXOSC10 exosome component 10 1 1
MIRT028552 LSS lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) 1 1
MIRT028553 MAP2K3 mitogen-activated protein kinase kinase 3 1 1
MIRT028554 ITGB4 integrin, beta 4 1 1
MIRT028555 TPBG trophoblast glycoprotein 1 1
MIRT028556 UBL3 ubiquitin-like 3 1 1
MIRT028557 TIMM8A translocase of inner mitochondrial membrane 8 homolog A (yeast) 1 1
MIRT028558 RPP40 ribonuclease P/MRP 40kDa subunit 1 1
MIRT028559 PTMS parathymosin 1 1
MIRT028560 SERPINE2 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 1 1
MIRT028561 PPP2R5C protein phosphatase 2, regulatory subunit B', gamma 1 1
MIRT028562 PES1 pescadillo ribosomal biogenesis factor 1 1 1
MIRT028563 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT028564 SLC38A5 solute carrier family 38, member 5 1 1
MIRT028565 CORO1C coronin, actin binding protein, 1C 1 1
MIRT028566 MLH1 mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) 1 1
MIRT028567 DDX10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 1 1
MIRT028568 FAM96A family with sequence similarity 96, member A 1 1
MIRT028569 CPSF1 cleavage and polyadenylation specific factor 1, 160kDa 1 1
MIRT028570 TRIP12 thyroid hormone receptor interactor 12 1 1
MIRT028571 RPP14 ribonuclease P/MRP 14kDa subunit 1 1
MIRT028572 MAP1LC3B2 microtubule-associated protein 1 light chain 3 beta 2 1 1
MIRT028573 NOP14 NOP14 nucleolar protein homolog (yeast) 1 1
MIRT028574 STUB1 STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase 1 1
MIRT028575 SNX3 sorting nexin 3 1 1
MIRT028576 HECTD1 HECT domain containing E3 ubiquitin protein ligase 1 1 1
MIRT028577 WDR74 WD repeat domain 74 1 1
MIRT028578 MRPS5 mitochondrial ribosomal protein S5 1 1
MIRT028579 TIMM10 translocase of inner mitochondrial membrane 10 homolog (yeast) 1 1
MIRT028580 ZFPL1 zinc finger protein-like 1 1 1
MIRT028581 NDE1 nudE nuclear distribution E homolog 1 (A. nidulans) 1 1
MIRT028582 BMS1 BMS1 homolog, ribosome assembly protein (yeast) 1 1
MIRT028583 RBM5 RNA binding motif protein 5 1 1
MIRT028584 LARP4B La ribonucleoprotein domain family, member 4B 1 1
MIRT028585 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT028586 OGDH oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) 1 1
MIRT028587 TBC1D4 TBC1 domain family, member 4 1 1
MIRT028588 TMED1 transmembrane emp24 protein transport domain containing 1 1 1
MIRT028589 GATC glutamyl-tRNA(Gln) amidotransferase, subunit C 1 1
MIRT028590 MAP1LC3B microtubule-associated protein 1 light chain 3 beta 1 1
MIRT028591 DNAJB1 DnaJ (Hsp40) homolog, subfamily B, member 1 1 1
MIRT028592 ATXN10 ataxin 10 1 1
MIRT028593 TMED5 transmembrane emp24 protein transport domain containing 5 1 1
MIRT028594 NDUFAF1 NADH dehydrogenase (ubiquinone) complex I, assembly factor 1 1 1
MIRT028595 SH3GL1 SH3-domain GRB2-like 1 2 2
MIRT028596 UFM1 ubiquitin-fold modifier 1 1 1
MIRT028597 ATOX1 ATX1 antioxidant protein 1 homolog (yeast) 1 1
MIRT028598 KPNA4 karyopherin alpha 4 (importin alpha 3) 1 1
MIRT028599 REXO4 REX4, RNA exonuclease 4 homolog (S. cerevisiae) 1 1
MIRT028600 EGFR epidermal growth factor receptor 1 1
MIRT028601 PDCD10 programmed cell death 10 2 2
MIRT028602 EPT1 ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) 1 1
MIRT028603 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 1
MIRT028604 PSME4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT028605 FAF2 Fas associated factor family member 2 1 1
MIRT028606 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT028607 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT028608 FBN1 fibrillin 1 1 1
MIRT028609 VAMP3 vesicle-associated membrane protein 3 1 1
MIRT028610 RBFOX1 RNA binding protein, fox-1 homolog (C. elegans) 1 1 1
MIRT028611 PPP1R12A protein phosphatase 1, regulatory subunit 12A 2 2
MIRT028612 RAB21 RAB21, member RAS oncogene family 1 1
MIRT028613 STX16 syntaxin 16 2 2
MIRT028614 CAT catalase 1 1
MIRT028615 MAN1A2 mannosidase, alpha, class 1A, member 2 1 1
MIRT028616 ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 1 1
MIRT028617 POLR2B polymerase (RNA) II (DNA directed) polypeptide B, 140kDa 1 1
MIRT028618 RUNX2 runt-related transcription factor 2 3 2
MIRT028619 PAK1IP1 PAK1 interacting protein 1 1 1
MIRT028620 HIST1H1A histone cluster 1, H1a 1 1
MIRT028621 AK2 adenylate kinase 2 1 1
MIRT028622 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT028623 USE1 unconventional SNARE in the ER 1 homolog (S. cerevisiae) 1 1
MIRT028624 ITPRIP inositol 1,4,5-trisphosphate receptor interacting protein 1 1
MIRT028625 UTP15 UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) 1 1
MIRT028626 ZNF638 zinc finger protein 638 1 1
MIRT028627 CPSF4 cleavage and polyadenylation specific factor 4, 30kDa 1 1
MIRT028628 TELO2 TEL2, telomere maintenance 2, homolog (S. cerevisiae) 1 1
MIRT028629 DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 1 1
MIRT028630 GGCT gamma-glutamylcyclotransferase 1 1
MIRT028631 TAPBP TAP binding protein (tapasin) 1 1
MIRT028632 TIMM9 translocase of inner mitochondrial membrane 9 homolog (yeast) 1 1
MIRT028633 ARG1 arginase, liver 1 1
MIRT028634 CSNK1G2 casein kinase 1, gamma 2 1 1
MIRT028635 WDR12 WD repeat domain 12 1 1
MIRT028636 LIG3 ligase III, DNA, ATP-dependent 1 1
MIRT028637 KCNN4 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 1 1
MIRT028638 CTNND1 catenin (cadherin-associated protein), delta 1 1 1
MIRT028639 POLR2C polymerase (RNA) II (DNA directed) polypeptide C, 33kDa 1 1
MIRT028640 DDX50 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 2 2
MIRT028641 PHB2 prohibitin 2 1 1
MIRT028642 DNAJC3 DnaJ (Hsp40) homolog, subfamily C, member 3 1 1
MIRT028643 SAMHD1 SAM domain and HD domain 1 1 1
MIRT028644 GABARAPL2 GABA(A) receptor-associated protein-like 2 1 1
MIRT028645 THBS1 thrombospondin 1 1 1
MIRT028646 PYCR2 pyrroline-5-carboxylate reductase family, member 2 1 1
MIRT028647 APEH N-acylaminoacyl-peptide hydrolase 1 1
MIRT028648 ME3 malic enzyme 3, NADP(+)-dependent, mitochondrial 1 1
MIRT028649 PRKCDBP protein kinase C, delta binding protein 1 1
MIRT028650 ANXA1 annexin A1 1 1
MIRT028651 BAX BCL2-associated X protein 1 1
MIRT028652 NIP7 nuclear import 7 homolog (S. cerevisiae) 1 1
MIRT028653 PKM pyruvate kinase, muscle 1 1
MIRT028654 GLRX3 glutaredoxin 3 1 1
MIRT028655 VWA8 von Willebrand factor A domain containing 8 1 1
MIRT028656 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT028657 UTP6 UTP6, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT028658 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT028659 CAPN2 calpain 2, (m/II) large subunit 1 1
MIRT028660 COPS7B COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) 1 1
MIRT028661 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 1
MIRT028662 LSM1 LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT028663 CSNK1G3 casein kinase 1, gamma 3 1 1
MIRT028664 PRPF4B PRP4 pre-mRNA processing factor 4 homolog B (yeast) 1 1
MIRT028665 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT028666 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 1
MIRT028667 NAP1L1 nucleosome assembly protein 1-like 1 2 5
MIRT028668 RARS2 arginyl-tRNA synthetase 2, mitochondrial 1 1
MIRT028669 ATP8A2 ATPase, aminophospholipid transporter, class I, type 8A, member 2 1 1
MIRT028670 IKBIP IKBKB interacting protein 1 1
MIRT028671 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 1 1
MIRT028672 GMFB glia maturation factor, beta 1 1
MIRT028673 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 1 1
MIRT028674 WDR75 WD repeat domain 75 1 1
MIRT028675 UHRF2 ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase 1 1
MIRT028676 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 1 1
MIRT028677 GTF3C4 general transcription factor IIIC, polypeptide 4, 90kDa 1 1
MIRT028678 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT028679 GNA13 guanine nucleotide binding protein (G protein), alpha 13 2 3
MIRT028680 AP3S1 adaptor-related protein complex 3, sigma 1 subunit 1 1
MIRT028681 PICALM phosphatidylinositol binding clathrin assembly protein 2 3
MIRT028682 ERLIN1 ER lipid raft associated 1 2 2
MIRT049927 PRPF19 PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) 1 1
MIRT049928 EXOC2 exocyst complex component 2 1 1
MIRT049929 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT049930 HDGF hepatoma-derived growth factor 1 1
MIRT049931 THUMPD1 THUMP domain containing 1 1 1
MIRT049932 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT049933 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein-like 2 1 1
MIRT049934 CLEC4D C-type lectin domain family 4, member D 1 1
MIRT049935 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT049936 NOL9 nucleolar protein 9 1 1
MIRT049937 TUBA1B tubulin, alpha 1b 1 1
MIRT049938 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT049939 ANKRD26 ankyrin repeat domain 26 1 1
MIRT049940 CARS cysteinyl-tRNA synthetase 1 1
MIRT049941 ZNF324 zinc finger protein 324 1 1
MIRT049942 XPO7 exportin 7 1 1
MIRT049943 TPI1 triosephosphate isomerase 1 1 1
MIRT049944 RPN2 ribophorin II 1 1
MIRT049945 RPS17 ribosomal protein S17 1 1
MIRT049946 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 1
MIRT049947 TOMM5 translocase of outer mitochondrial membrane 5 homolog (yeast) 1 2
MIRT049948 HDAC1 histone deacetylase 1 1 1
MIRT049949 ERP44 endoplasmic reticulum protein 44 1 1
MIRT049950 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT049951 CNP 2',3'-cyclic nucleotide 3' phosphodiesterase 1 1
MIRT049952 ANAPC5 anaphase promoting complex subunit 5 1 1
MIRT049953 TRIM28 tripartite motif containing 28 1 1
MIRT049954 USP16 ubiquitin specific peptidase 16 1 1
MIRT049955 MRPL28 mitochondrial ribosomal protein L28 1 1
MIRT049956 PNMA2 paraneoplastic Ma antigen 2 1 1
MIRT049957 XPOT exportin, tRNA 1 1
MIRT049958 DROSHA drosha, ribonuclease type III 1 1
MIRT049959 REXO1 REX1, RNA exonuclease 1 homolog (S. cerevisiae) 1 1
MIRT049960 PCNA proliferating cell nuclear antigen 1 1
MIRT049961 LRRN1 leucine rich repeat neuronal 1 1 1
MIRT049962 MSL2 male-specific lethal 2 homolog (Drosophila) 1 1
MIRT049963 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT053131 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 2 1
MIRT053340 ERG v-ets erythroblastosis virus E26 oncogene homolog (avian) 4 1
MIRT054508 ESR2 estrogen receptor 2 (ER beta) 4 1
MIRT054585 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 2 1
MIRT054614 BCL9 B-cell CLL/lymphoma 9 3 1
MIRT054632 HSPA5 heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) 3 1
MIRT054651 EYA2 eyes absent homolog 2 (Drosophila) 3 1
MIRT057355 PCGF5 polycomb group ring finger 5 1 1
MIRT057672 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT059171 SLC35C1 solute carrier family 35, member C1 1 1
MIRT067975 TFDP1 transcription factor Dp-1 1 3
MIRT068113 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT068385 S100PBP S100P binding protein 1 1
MIRT069731 FOXG1 forkhead box G1 1 2
MIRT075438 PSMD7 proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 1 3
MIRT079941 RNF138 ring finger protein 138, E3 ubiquitin protein ligase 1 2
MIRT080956 LRRC8B leucine rich repeat containing 8 family, member B 1 1
MIRT081711 ZNF507 zinc finger protein 507 1 2
MIRT082851 ZNF543 zinc finger protein 543 1 2
MIRT084232 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT087145 HIC2 hypermethylated in cancer 2 1 4
MIRT088679 EML4 echinoderm microtubule associated protein like 4 1 2
MIRT088933 ASB3 ankyrin repeat and SOCS box containing 3 1 1
MIRT090501 SLC35G2 solute carrier family 35, member G2 1 1
MIRT091575 FBXO45 F-box protein 45 1 1
MIRT096077 SFXN1 sideroflexin 1 1 1
MIRT098035 SOBP sine oculis binding protein homolog (Drosophila) 1 1
MIRT099796 SOX4 SRY (sex determining region Y)-box 4 4 3
MIRT100762 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 1 2
MIRT100907 CD2AP CD2-associated protein 1 1
MIRT103190 SP4 Sp4 transcription factor 1 4
MIRT104519 PEG10 paternally expressed 10 1 1
MIRT105029 FAM91A1 family with sequence similarity 91, member A1 1 1
MIRT115920 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 1
MIRT118141 ZNF264 zinc finger protein 264 1 1
MIRT128241 STRIP1 striatin interacting protein 1 1 1
MIRT131793 CEP350 centrosomal protein 350kDa 1 1
MIRT131850 IER5 immediate early response 5 1 1
MIRT134329 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT135674 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT136211 STX12 syntaxin 12 1 1
MIRT137016 WDFY2 WD repeat and FYVE domain containing 2 1 1
MIRT137121 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT138278 RNF220 ring finger protein 220 1 1
MIRT139246 JDP2 Jun dimerization protein 2 1 1
MIRT140628 PLEKHO2 pleckstrin homology domain containing, family O member 2 1 1
MIRT140877 GLCE glucuronic acid epimerase 1 1
MIRT142585 IL21R interleukin 21 receptor 1 2
MIRT143347 PAPD5 PAP associated domain containing 5 1 1
MIRT144534 ZNRF1 zinc and ring finger 1, E3 ubiquitin protein ligase 1 1
MIRT145446 RNF135 ring finger protein 135 1 1
MIRT149112 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT150758 MAST3 microtubule associated serine/threonine kinase 3 1 1
MIRT152409 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 2
MIRT155233 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 1
MIRT159107 NRBP1 nuclear receptor binding protein 1 1 1
MIRT159242 RASGRP3 RAS guanyl releasing protein 3 (calcium and DAG-regulated) 1 1
MIRT160841 PLXNA1 plexin A1 1 1
MIRT164233 GAB1 GRB2-associated binding protein 1 1 1
MIRT165594 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT170140 KLHDC10 kelch domain containing 10 1 1
MIRT171348 PHTF2 putative homeodomain transcription factor 2 1 2
MIRT171548 DBF4 DBF4 homolog (S. cerevisiae) 1 1
MIRT176032 JADE3 PHD finger protein 16 1 1
MIRT177709 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT185097 LYPLAL1 lysophospholipase-like 1 1 1
MIRT188271 RAP1B RAP1B, member of RAS oncogene family 1 1
MIRT192224 MKRN3 makorin ring finger protein 3 1 1
MIRT194169 IREB2 iron-responsive element binding protein 2 1 1
MIRT197645 DHX40 DEAH (Asp-Glu-Ala-His) box polypeptide 40 1 1
MIRT206178 RAB10 RAB10, member RAS oncogene family 1 1
MIRT210815 SETD5 SET domain containing 5 1 1
MIRT212858 N4BP2 NEDD4 binding protein 2 1 1
MIRT215129 MFAP3 microfibrillar-associated protein 3 1 1
MIRT218370 FAM8A1 family with sequence similarity 8, member A1 1 1
MIRT244292 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT257168 TBPL1 TBP-like 1 1 1
MIRT258124 UBE3C ubiquitin protein ligase E3C 1 1
MIRT258175 CBX3 chromobox homolog 3 1 1
MIRT283400 CCNF cyclin F 1 1
MIRT289627 CBX2 chromobox homolog 2 1 1
MIRT292166 CDC7 cell division cycle 7 homolog (S. cerevisiae) 1 1
MIRT292813 MTF2 metal response element binding transcription factor 2 1 1
MIRT293782 SAE1 SUMO1 activating enzyme subunit 1 1 1
MIRT294574 ZNF460 zinc finger protein 460 1 2
MIRT302900 FOXN2 forkhead box N2 1 1
MIRT306841 FYTTD1 forty-two-three domain containing 1 1 1
MIRT313772 MIER3 mesoderm induction early response 1, family member 3 1 2
MIRT322686 BAG4 BCL2-associated athanogene 4 1 1
MIRT368806 MZT1 mitotic spindle organizing protein 1 1 1
MIRT379726 ZXDB zinc finger, X-linked, duplicated B 1 1
MIRT387952 H6PD hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 1 1
MIRT437492 TP53 tumor protein p53 3 1
MIRT438620 CD99 CD99 molecule 3 1
MIRT444599 TGFA transforming growth factor, alpha 1 1
MIRT446452 CHST15 carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 1 1
MIRT448489 SEC61A2 Sec61 alpha 2 subunit (S. cerevisiae) 1 1
MIRT448514 ROCK2 Rho-associated, coiled-coil containing protein kinase 2 1 1
MIRT448654 NCOA3 nuclear receptor coactivator 3 1 1
MIRT449711 TSPYL1 TSPY-like 1 1 1
MIRT450764 PGGT1B protein geranylgeranyltransferase type I, beta subunit 1 1
MIRT452143 PPP2R1B protein phosphatase 2, regulatory subunit A, beta 1 1
MIRT463401 ZDHHC20 zinc finger, DHHC-type containing 20 1 1
MIRT464290 VASH1 vasohibin 1 1 1
MIRT467410 SOCS3 suppressor of cytokine signaling 3 1 1
MIRT467628 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 1
MIRT470407 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT471081 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta 1 2
MIRT471149 PHF13 PHD finger protein 13 1 3
MIRT472494 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 1
MIRT473658 MARCKSL1 MARCKS-like 1 1 1
MIRT473699 MAPK8 mitogen-activated protein kinase 8 1 2
MIRT474086 LMBR1L limb region 1 homolog (mouse)-like 1 2
MIRT474285 LARP1 La ribonucleoprotein domain family, member 1 1 3
MIRT474325 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT475698 HHIPL1 HHIP-like 1 1 1
MIRT476172 GOLGA8B golgin A8 family, member B 1 2
MIRT481138 AZIN1 antizyme inhibitor 1 1 3
MIRT481467 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 2
MIRT482067 ALG9 asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT482127 AKIRIN1 akirin 1 1 2
MIRT488726 ADPRHL1 ADP-ribosylhydrolase like 1 1 1
MIRT492209 SOCS1 suppressor of cytokine signaling 1 1 3
MIRT492610 POLR3E polymerase (RNA) III (DNA directed) polypeptide E (80kD) 1 1
MIRT497128 IFNE interferon, epsilon 1 1
MIRT498613 MTRNR2L10 MT-RNR2-like 10 1 3
MIRT503028 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT507128 GIGYF1 GRB10 interacting GYF protein 1 1 3
MIRT514181 PGPEP1 pyroglutamyl-peptidase I 1 2
MIRT530622 CXCL11 chemokine (C-X-C motif) ligand 11 1 1
MIRT531358 FAM81B family with sequence similarity 81, member B 1 1
MIRT534308 SKIDA1 SKI/DACH domain containing 1 1 1
MIRT536980 HABP4 hyaluronan binding protein 4 1 2
MIRT538156 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 2
MIRT544268 SIKE1 suppressor of IKBKE 1 1 1
MIRT544515 GTF2E2 general transcription factor IIE, polypeptide 2, beta 34kDa 1 1
MIRT547153 PGM3 phosphoglucomutase 3 1 1
MIRT547750 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 2
MIRT548194 FOXA1 forkhead box A1 1 1
MIRT552928 VPS33A vacuolar protein sorting 33 homolog A (S. cerevisiae) 1 1
MIRT553991 SRPR signal recognition particle receptor (docking protein) 1 1
MIRT554287 SIX4 SIX homeobox 4 1 1
MIRT555306 PPP3CB protein phosphatase 3, catalytic subunit, beta isozyme 1 1
MIRT556573 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT557733 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT557783 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT558469 DCUN1D1 DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) 1 1
MIRT562489 CELSR3 cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) 1 1
MIRT562797 NDUFA12 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 1 1
MIRT563235 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT563269 ST3GAL5 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 1 1
MIRT565079 UHRF1BP1 UHRF1 binding protein 1 1 2
MIRT565832 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT566682 MYLIP myosin regulatory light chain interacting protein 1 1
MIRT566742 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 2
MIRT567608 FANCF Fanconi anemia, complementation group F 1 1
MIRT568344 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 2
MIRT572871 OPHN1 oligophrenin 1 1 1
MIRT623309 MARCH4 membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase 1 1
MIRT626127 PLSCR1 phospholipid scramblase 1 1 2
MIRT653919 SERPINC1 serpin peptidase inhibitor, clade C (antithrombin), member 1 1 1
MIRT653989 SEMA6A sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 1 1
MIRT656335 MED29 mediator complex subunit 29 1 1
MIRT669388 BAHD1 bromo adjacent homology domain containing 1 1 1
MIRT687188 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha 1 1
MIRT688639 CREM cAMP responsive element modulator 1 1
MIRT704912 CCDC71L coiled-coil domain containing 71-like 1 1
MIRT705593 APLP2 amyloid beta (A4) precursor-like protein 2 1 1
MIRT705913 ADAM9 ADAM metallopeptidase domain 9 1 1
MIRT716460 MRO maestro 1 1
MIRT718297 MOGAT1 monoacylglycerol O-acyltransferase 1 1 1
MIRT718888 SLFN5 schlafen family member 5 1 1
MIRT719020 SHROOM3 shroom family member 3 1 1
MIRT726000 ZSCAN29 zinc finger and SCAN domain containing 29 1 1
MIRT726049 ZNF200 zinc finger protein 200 1 1
MIRT726062 ZMYND8 zinc finger, MYND-type containing 8 1 1
MIRT726072 ZFAND5 zinc finger, AN1-type domain 5 1 1
MIRT726077 ZCRB1 zinc finger CCHC-type and RNA binding motif 1 1 1
MIRT726124 VPS41 vacuolar protein sorting 41 homolog (S. cerevisiae) 1 1
MIRT726148 VAPA VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa 1 1
MIRT726162 USP37 ubiquitin specific peptidase 37 1 1
MIRT726183 UBXN4 UBX domain protein 4 1 1
MIRT726194 UBN1 ubinuclein 1 1 1
MIRT726207 TXNDC5 thioredoxin domain containing 5 (endoplasmic reticulum) 1 1
MIRT726232 TRIM23 tripartite motif containing 23 1 1
MIRT726381 TBC1D10B TBC1 domain family, member 10B 1 1
MIRT726389 TAOK1 TAO kinase 1 1 1
MIRT726394 TANK TRAF family member-associated NFKB activator 1 1
MIRT726400 TAF4B TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa 1 1
MIRT726432 STAU1 staufen, RNA binding protein, homolog 1 (Drosophila) 1 1
MIRT726469 SOX12 SRY (sex determining region Y)-box 12 1 1
MIRT726533 SLC38A7 solute carrier family 38, member 7 1 1
MIRT726589 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT726613 SRSF7 serine/arginine-rich splicing factor 7 1 1
MIRT726621 SETD3 SET domain containing 3 1 1
MIRT726655 SBF1 SET binding factor 1 1 1
MIRT726666 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT726694 RPA2 replication protein A2, 32kDa 1 1
MIRT726735 RNF122 ring finger protein 122 1 1
MIRT726769 REV3L REV3-like, polymerase (DNA directed), zeta, catalytic subunit 1 1
MIRT726844 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT726862 PREPL prolyl endopeptidase-like 1 1
MIRT726867 PPTC7 PTC7 protein phosphatase homolog (S. cerevisiae) 1 1
MIRT726888 PPP1R2 protein phosphatase 1, regulatory (inhibitor) subunit 2 1 1
MIRT726919 PNMA1 paraneoplastic Ma antigen 1 1 1
MIRT726981 PER2 period homolog 2 (Drosophila) 1 1
MIRT726998 PCDH10 protocadherin 10 1 1
MIRT727012 PAWR PRKC, apoptosis, WT1, regulator 1 1
MIRT727034 OTUD4 OTU domain containing 4 1 1
MIRT727125 MYBL2 v-myb myeloblastosis viral oncogene homolog (avian)-like 2 1 1
MIRT727169 MLXIP MLX interacting protein 1 1
MIRT727195 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727205 MIA3 melanoma inhibitory activity family, member 3 1 1
MIRT727249 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 1
MIRT727280 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT727305 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT727310 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT727315 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT727320 LCP1 lymphocyte cytosolic protein 1 (L-plastin) 1 1
MIRT727345 KLF10 Kruppel-like factor 10 1 1
MIRT727355 EPG5 ectopic P-granules autophagy protein 5 homolog (C. elegans) 1 1
MIRT727394 JOSD1 Josephin domain containing 1 1 1
MIRT727399 KDM3A lysine (K)-specific demethylase 3A 1 1
MIRT727408 JAK1 Janus kinase 1 1 1
MIRT727435 IQCB1 IQ motif containing B1 1 1
MIRT727440 IP6K3 inositol hexakisphosphate kinase 3 1 1
MIRT727455 IL1A interleukin 1, alpha 1 1
MIRT727467 IKZF2 IKAROS family zinc finger 2 (Helios) 1 1
MIRT727547 GOLGA1 golgin A1 1 1
MIRT727570 GXYLT1 glucoside xylosyltransferase 1 1 1
MIRT727590 GCLC glutamate-cysteine ligase, catalytic subunit 1 1
MIRT727595 GCSAM germinal center-associated, signaling and motility 1 1
MIRT727636 FUCA1 fucosidase, alpha-L- 1, tissue 1 1
MIRT727691 FANCL Fanconi anemia, complementation group L 1 1
MIRT727726 FAM104A family with sequence similarity 104, member A 1 1
MIRT727767 EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) 1 1
MIRT727776 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT727798 EED embryonic ectoderm development 1 1
MIRT727811 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT727832 DYNLT3 dynein, light chain, Tctex-type 3 1 1
MIRT727902 DCTN4 dynactin 4 (p62) 1 1
MIRT727933 CREG1 cellular repressor of E1A-stimulated genes 1 1 1
MIRT727958 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT727979 CLCC1 chloride channel CLIC-like 1 1 1
MIRT728014 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 1
MIRT728049 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT728066 C8orf76 chromosome 8 open reading frame 76 1 1
MIRT728070 C7orf60 chromosome 7 open reading frame 60 1 1
MIRT728079 C7orf43 chromosome 7 open reading frame 43 1 1
MIRT728163 KIAA0226L KIAA0226-like 1 1
MIRT728180 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT728191 BTBD1 BTB (POZ) domain containing 1 1 1
MIRT728212 CFDP1 craniofacial development protein 1 1 1
MIRT728233 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT728244 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT728270 ATM ataxia telangiectasia mutated 1 1
MIRT728346 ANKRA2 ankyrin repeat, family A (RFXANK-like), 2 1 1
MIRT728375 AFF4 AF4/FMR2 family, member 4 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*