Accession ID: MIRT030421 [miRNA, hsa-miR-24-3p :: VPS35, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-24-1LinkOut: [miRBase ]
Synonyms MIR189, MIRN24-1, miR-24-1, miRNA24-1, MIR24-1
Description Homo sapiens miR-24-1 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-24-3p
Mature Sequence 44| UGGCUCAGUUCAGCAGGAACAG |65
Evidence Experimental
Experiments Cloned
Putative hsa-miR-24-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol VPS35 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms DKFZp434E1211, DKFZp434P1672, FLJ10752, FLJ13588, FLJ20388, MEM3
Description vacuolar protein sorting 35 homolog (S. cerevisiae)
Transcript NM_0182    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on VPS35 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of VPS35
(miRNA target sites are highlighted)
>VPS35|NM_0182|3'UTR
   1 TAAAAAGGAAATAGCTCACCATACTCCTTTCCATGTACATCCAGTGAGGGTTTTATTACGCTAGGTTTCCCTTCCATAGA
  81 TTGTGCCTTTCAGAAATGCTGAGGTAGGTTTCCCATTTCTTACCTGTGATGTGTTTTACCCAGCACCTCCGGACACTCAC
 161 CTTCAGGACCTTAATAAAATTATTCACTTGGTAAGTGTTCAAGTCTTTCTGATCACCCCAAGTAGCATGACTGATCTGCA
 241 ATTTAAAATTCCTGTGATCTGTAAAAAAAAAAAAAAAAAAAAAAACAAAACCCACAAGCACTTATCTTGGCTACTAATGA
 321 AGCTCTCCTTTTTTTTGTTTGTTTGTTTGCTTCATTGTTGATTGTGTATTTTCTTCATTCCTGGGGAGTACTAACCCAAA
 401 AGCGTCTGTCTCTTGTTTTCTAGTCCAGTTTGAGATTAATTTAGAAGAAAGGAATACTGTATGTGAAATTCATCTTGGGC
 481 TTTCCCCTAAATTGCAAGATAAGGCCATGTGTAAGATTTTCCCTAAAACTAGAATATATTAATGCATGTTTGAGAATTTT
 561 AAAGCACCATGGTCAAAACCAGAAGCTATATTTTGCATATTTGGACTCAGCCATCCATTAAGAACCCATGTTGTCCTCTG
 641 GACATATTTATCAATATAATTGGGTTTTAAATAGTATAAAAGAAAACTTGTGATCTATATAATTTATGTATCACCTTCAT
 721 TGTAAATTTAGCAGGAAATGCATCACAATTATGATTTTTTTTTTTGCACCAGTGAAACAATAAAGATGCTATTAACAAAA
 801 AAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gacaAGGACG-----ACUUGACUCGGu 5'
              |::|||     ||:||| |||| 
Target 5' tataTTTTGCATATTTGGACTCAGCCa 3'
587 - 613 130.00 -15.80
2
miRNA  3' gaCAAGG-ACGACUU---GACUCggu 5'
            || || | | |||   |||||   
Target 5' ttGTGCCTTTCAGAAATGCTGAGgta 3'
81 - 106 116.00 -12.10
3
miRNA  3' gacAAGGACGACU--UGACUCGGu 5'
             ||||||  ||  ||| | || 
Target 5' tcaTTCCTGGGGAGTACTAACCCa 3'
375 - 398 105.00 -12.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-24-3p :: VPS35    [ Functional MTI ]
Validation Method Microarray
Article - Lal, A. Navarro, F. Maher, C. A. et al.
- Mol Cell, 2009
miR-24, upregulated during terminal differentiation of multiple lineages, inhibits cell-cycle progression. Antagonizing miR-24 restores postmitotic cell proliferation and enhances fibroblast proliferation, whereas overexpressing miR-24 increases the G1 compartment. The 248 mRNAs downregulated upon miR-24 overexpression are highly enriched for DNA repair and cell-cycle regulatory genes that form a direct interaction network with prominent nodes at genes that enhance (MYC, E2F2, CCNB1, and CDC2) or inhibit (p27Kip1 and VHL) cell-cycle progression. miR-24 directly regulates MYC and E2F2 and some genes that they transactivate. Enhanced proliferation from antagonizing miR-24 is abrogated by knocking down E2F2, but not MYC, and cell proliferation, inhibited by miR-24 overexpression, is rescued by miR-24-insensitive E2F2. Therefore, E2F2 is a critical miR-24 target. The E2F2 3'UTR lacks a predicted miR-24 recognition element. In fact, miR-24 regulates expression of E2F2, MYC, AURKB, CCNA2, CDC2, CDK4, and FEN1 by recognizing seedless but highly complementary sequences.
LinkOut: [PMID: 19748357]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
319 hsa-miR-24-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000116 FEN1 flap structure-specific endonuclease 1 5 1
MIRT000117 CDK4 cyclin-dependent kinase 4 5 1
MIRT000119 CCNA2 cyclin A2 5 1
MIRT000120 AURKB aurora kinase B 5 1
MIRT000121 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 5 1
MIRT000122 E2F2 E2F transcription factor 2 5 1
MIRT001773 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 2 2
MIRT002018 DHFR dihydrofolate reductase 5 3
MIRT002950 MAPK14 mitogen-activated protein kinase 14 2 1
MIRT003354 TRIB3 tribbles homolog 3 (Drosophila) 4 2
MIRT003355 HNF4A hepatocyte nuclear factor 4, alpha 5 2
MIRT003830 ACVR1B activin A receptor, type IB 3 2
MIRT003889 MLEC malectin 3 2
MIRT004362 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 4 1
MIRT004836 BRCA1 breast cancer 1, early onset 5 2
MIRT004837 POLD1 polymerase (DNA directed), delta 1, catalytic subunit 125kDa 5 1
MIRT005063 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 6 5
MIRT005397 KHSRP KH-type splicing regulatory protein 2 2
MIRT005398 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 2 2
MIRT005766 DND1 dead end homolog 1 (zebrafish) 3 1
MIRT005918 TGFB1 transforming growth factor, beta 1 4 1
MIRT005919 FURIN furin (paired basic amino acid cleaving enzyme) 4 1
MIRT006507 FAF1 Fas (TNFRSF6) associated factor 1 2 1
MIRT007012 ZNF217 zinc finger protein 217 2 2
MIRT007215 ST7L suppression of tumorigenicity 7 like 3 1
MIRT030361 VRK1 vaccinia related kinase 1 1 1
MIRT030362 NOP56 NOP56 ribonucleoprotein homolog (yeast) 1 1
MIRT030363 TBPL1 TBP-like 1 1 1
MIRT030364 TNPO3 transportin 3 1 1
MIRT030365 SNRPB2 small nuclear ribonucleoprotein polypeptide B' 1 1
MIRT030366 DDHD2 DDHD domain containing 2 1 1
MIRT030367 THOP1 thimet oligopeptidase 1 1 1
MIRT030368 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT030369 UBE2C ubiquitin-conjugating enzyme E2C 1 1
MIRT030370 GNPAT glyceronephosphate O-acyltransferase 1 1
MIRT030371 METAP2 methionyl aminopeptidase 2 1 1
MIRT030372 KIAA0020 KIAA0020 1 1
MIRT030373 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT030374 URM1 ubiquitin related modifier 1 homolog (S. cerevisiae) 1 1
MIRT030375 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT030376 MED22 mediator complex subunit 22 1 1
MIRT030377 USP10 ubiquitin specific peptidase 10 1 1
MIRT030378 FKBP1B FK506 binding protein 1B, 12.6 kDa 1 1
MIRT030379 SCML1 sex comb on midleg-like 1 (Drosophila) 1 1
MIRT030380 CNDP2 CNDP dipeptidase 2 (metallopeptidase M20 family) 2 1
MIRT030381 MCM10 minichromosome maintenance complex component 10 2 1
MIRT030382 TOP1 topoisomerase (DNA) I 2 1
MIRT030383 H2AFX H2A histone family, member X 4 2
MIRT030384 TOMM22 translocase of outer mitochondrial membrane 22 homolog (yeast) 1 1
MIRT030385 HBQ1 hemoglobin, theta 1 1 1
MIRT030386 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT030387 PSMD1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 1 1
MIRT030388 AUNIP chromosome 1 open reading frame 135 1 1
MIRT030389 NARF nuclear prelamin A recognition factor 1 1
MIRT030390 MALSU1 chromosome 7 open reading frame 30 1 1
MIRT030391 TCEA3 transcription elongation factor A (SII), 3 1 1
MIRT030392 ADRM1 adhesion regulating molecule 1 1 1
MIRT030393 AGFG1 ArfGAP with FG repeats 1 1 1
MIRT030394 ACD adrenocortical dysplasia homolog (mouse) 1 1
MIRT030395 RCE1 RCE1 homolog, prenyl protein peptidase (S. cerevisiae) 1 1
MIRT030396 SUMO3 SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae) 1 1
MIRT030397 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT030398 C18orf56 chromosome 18 open reading frame 56 1 1
MIRT030399 MIS18A chromosome 21 open reading frame 45 1 1
MIRT030400 GLYR1 glyoxylate reductase 1 homolog (Arabidopsis) 1 1
MIRT030401 NAE1 NEDD8 activating enzyme E1 subunit 1 1 1
MIRT030402 ACTL6A actin-like 6A 1 1
MIRT030403 NCBP2 nuclear cap binding protein subunit 2, 20kDa 1 1
MIRT030404 SLC29A4 solute carrier family 29 (nucleoside transporters), member 4 1 1
MIRT030405 PHF16 PHD finger protein 16 1 1
MIRT030406 GYG2 glycogenin 2 1 1
MIRT030407 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 1
MIRT030408 EXOSC8 exosome component 8 1 1
MIRT030409 TDRP chromosome 8 open reading frame 42 1 1
MIRT030410 R3HDM4 chromosome 19 open reading frame 22 1 1
MIRT030411 DCAF4 DDB1 and CUL4 associated factor 4 1 1
MIRT030412 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT030413 VPS25 vacuolar protein sorting 25 homolog (S. cerevisiae) 1 1
MIRT030414 NR0B2 nuclear receptor subfamily 0, group B, member 2 1 1
MIRT030415 NASP nuclear autoantigenic sperm protein (histone-binding) 1 1
MIRT030416 STRADB STE20-related kinase adaptor beta 1 1
MIRT030417 MTF2 metal response element binding transcription factor 2 1 1
MIRT030418 PHOSPHO2 phosphatase, orphan 2 1 1
MIRT030419 ATAD3A ATPase family, AAA domain containing 3A 1 1
MIRT030420 CCDC59 coiled-coil domain containing 59 1 1
MIRT030421 VPS35 vacuolar protein sorting 35 homolog (S. cerevisiae) 1 1
MIRT030422 PAF1 Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) 1 1
MIRT030423 CIRBP cold inducible RNA binding protein 1 1
MIRT030424 S100P S100 calcium binding protein P 1 1
MIRT030425 ARHGEF7 Rho guanine nucleotide exchange factor (GEF) 7 1 1
MIRT030426 PROSER1 chromosome 13 open reading frame 23 1 1
MIRT030427 PDLIM7 PDZ and LIM domain 7 (enigma) 1 1
MIRT030428 KIAA0100 KIAA0100 1 1
MIRT030429 TOMM34 translocase of outer mitochondrial membrane 34 1 1
MIRT030430 CTCF CCCTC-binding factor (zinc finger protein) 1 1
MIRT030431 EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 1 1
MIRT030432 SLC52A2 G protein-coupled receptor 172A 1 1
MIRT030433 KHNYN KH and NYN domain containing 1 1
MIRT030434 ADD1 adducin 1 (alpha) 1 1
MIRT030435 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT030436 KLHL23 kelch-like 23 (Drosophila) 1 1
MIRT030437 SULT2A1 sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 1 1
MIRT030438 LSM12 LSM12 homolog (S. cerevisiae) 1 1
MIRT030439 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT030440 CARD10 caspase recruitment domain family, member 10 1 1
MIRT030441 PPM1F protein phosphatase, Mg2+/Mn2+ dependent, 1F 1 1
MIRT030442 NRIP1 nuclear receptor interacting protein 1 1 1
MIRT030443 ARHGEF18 Rho/Rac guanine nucleotide exchange factor (GEF) 18 1 1
MIRT030444 FNTB farnesyltransferase, CAAX box, beta 1 1
MIRT030445 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 2 2
MIRT030446 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT030447 BCL2L2 BCL2-like 2 1 1
MIRT030448 PSTPIP2 proline-serine-threonine phosphatase interacting protein 2 1 1
MIRT030449 ACACA acetyl-CoA carboxylase alpha 1 1
MIRT030450 MATR3 matrin 3 1 1
MIRT030451 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT030452 TSPAN14 tetraspanin 14 1 1
MIRT030453 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT030454 MIDN midnolin 1 1
MIRT030455 CCDC58 coiled-coil domain containing 58 1 1
MIRT030456 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT030457 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT030458 ZNF813 zinc finger protein 813 1 1
MIRT030459 MAGI1 membrane associated guanylate kinase, WW and PDZ domain containing 1 1 1
MIRT030460 ZCCHC14 zinc finger, CCHC domain containing 14 1 1
MIRT030461 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT030462 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT030463 DNAJB12 DnaJ (Hsp40) homolog, subfamily B, member 12 1 1
MIRT030464 NUP54 nucleoporin 54kDa 2 2
MIRT030465 SESN1 sestrin 1 2 2
MIRT030466 SLC35B2 solute carrier family 35, member B2 2 2
MIRT030467 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 2 2
MIRT030468 UBD ubiquitin D 2 1
MIRT030469 RRM2 ribonucleotide reductase M2 2 1
MIRT030470 BCL2L12 BCL2-like 12 (proline rich) 2 1
MIRT030471 MBD6 methyl-CpG binding domain protein 6 2 1
MIRT030472 OXSR1 oxidative-stress responsive 1 1 1
MIRT030473 PER2 period homolog 2 (Drosophila) 2 1
MIRT030474 UNG uracil-DNA glycosylase 1 1
MIRT030475 RRP12 ribosomal RNA processing 12 homolog (S. cerevisiae) 1 1
MIRT030476 CWC27 CWC27 spliceosome-associated protein homolog (S. cerevisiae) 1 1
MIRT030477 SRRT serrate RNA effector molecule homolog (Arabidopsis) 1 1
MIRT030478 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 1 1
MIRT030479 EXOSC3 exosome component 3 1 1
MIRT030480 ALG5 asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) 1 1
MIRT030481 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT030482 MRPS24 mitochondrial ribosomal protein S24 1 1
MIRT030483 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT030484 GTF3C2 general transcription factor IIIC, polypeptide 2, beta 110kDa 1 1
MIRT030485 FAH fumarylacetoacetate hydrolase (fumarylacetoacetase) 1 1
MIRT030486 ARL1 ADP-ribosylation factor-like 1 1 1
MIRT030487 MED16 mediator complex subunit 16 1 1
MIRT030488 MED24 mediator complex subunit 24 1 1
MIRT030489 CCAR1 cell division cycle and apoptosis regulator 1 1 1
MIRT030490 DUS1L dihydrouridine synthase 1-like (S. cerevisiae) 1 1
MIRT030491 BEX1 brain expressed, X-linked 1 1 1
MIRT030492 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT030493 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT030494 DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) 1 1
MIRT030495 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 1 1
MIRT030496 UBE3A ubiquitin protein ligase E3A 1 1
MIRT030497 TYW3 tRNA-yW synthesizing protein 3 homolog (S. cerevisiae) 1 1
MIRT030498 UQCC ubiquinol-cytochrome c reductase complex chaperone 1 1
MIRT030499 NKD1 naked cuticle homolog 1 (Drosophila) 1 1
MIRT030500 NFKBIA nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha 1 1
MIRT030501 AK3 adenylate kinase 3 1 1
MIRT030502 NSA2 NSA2 ribosome biogenesis homolog (S. cerevisiae) 1 1
MIRT030503 CDK1 cyclin-dependent kinase 1 5 1
MIRT030504 HSF2 heat shock transcription factor 2 1 1
MIRT030505 CDCA7 cell division cycle associated 7 1 1
MIRT030506 NCOA6 nuclear receptor coactivator 6 1 1
MIRT030507 TNIP2 TNFAIP3 interacting protein 2 1 1
MIRT030508 AKAP7 A kinase (PRKA) anchor protein 7 1 1
MIRT030509 TUBGCP2 tubulin, gamma complex associated protein 2 1 1
MIRT030510 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 1
MIRT030511 FBXO34 F-box protein 34 1 1
MIRT030512 STK35 serine/threonine kinase 35 1 1
MIRT030513 CTDSP2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 1 1
MIRT030514 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT030515 ZDHHC3 zinc finger, DHHC-type containing 3 1 1
MIRT030516 IQCB1 IQ motif containing B1 1 1
MIRT030517 RHOT2 ras homolog gene family, member T2 1 1
MIRT030518 ALDH5A1 aldehyde dehydrogenase 5 family, member A1 1 1
MIRT030519 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT030520 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT030521 GBAS glioblastoma amplified sequence 1 1
MIRT030522 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 1
MIRT030523 NEK6 NIMA (never in mitosis gene a)-related kinase 6 1 1
MIRT030524 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT030525 GGA2 golgi-associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT030526 ADPGK ADP-dependent glucokinase 1 1
MIRT030527 DSCR3 Down syndrome critical region gene 3 1 1
MIRT030528 FZD4 frizzled homolog 4 (Drosophila) 1 1
MIRT030529 AAMP angio-associated, migratory cell protein 1 1
MIRT030530 PLIN3 perilipin 3 1 1
MIRT030531 LLGL1 lethal giant larvae homolog 1 (Drosophila) 1 1
MIRT030532 KLHDC3 kelch domain containing 3 1 1
MIRT030533 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT030534 MARCKSL1 MARCKS-like 1 1 1
MIRT030535 C1orf106 chromosome 1 open reading frame 106 1 1
MIRT030536 ADD3 adducin 3 (gamma) 1 1
MIRT030537 SNTB1 syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1) 1 1
MIRT030538 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT030539 TMTC4 transmembrane and tetratricopeptide repeat containing 4 1 1
MIRT030540 GLUL glutamate-ammonia ligase 1 1
MIRT030541 TMEM209 transmembrane protein 209 1 1
MIRT030542 LBR lamin B receptor 1 1
MIRT030543 LIMD1 LIM domains containing 1 1 1
MIRT030544 SPIN4 spindlin family, member 4 1 1
MIRT030545 ZNF264 zinc finger protein 264 1 1
MIRT030546 VGLL3 vestigial like 3 (Drosophila) 1 1
MIRT030547 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 1
MIRT030548 DEDD death effector domain containing 1 1
MIRT030549 CD34 CD34 molecule 1 1
MIRT030550 TMED7 transmembrane emp24 protein transport domain containing 7 1 1
MIRT030551 E2F3 E2F transcription factor 3 2 1
MIRT030552 ZNF317 zinc finger protein 317 2 1
MIRT030553 STX16 syntaxin 16 2 1
MIRT030554 DHFRP1 dihydrofolate reductase pseudogene 1 1 1
MIRT030555 CHEK1 CHK1 checkpoint homolog (S. pombe) 4 1
MIRT030556 NOTUM notum pectinacetylesterase homolog (Drosophila) 1 1
MIRT030557 ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 1 1
MIRT030558 CCL2 chemokine (C-C motif) ligand 2 1 1
MIRT030559 OARD1 chromosome 6 open reading frame 130 1 1
MIRT030560 PCGF6 polycomb group ring finger 6 1 1
MIRT030561 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 18kDa 1 1
MIRT030562 CTDSP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 1 1
MIRT030563 MAK16 MAK16 homolog (S. cerevisiae) 1 1
MIRT030564 RNF144A ring finger protein 144A 1 1
MIRT030565 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT030566 C15orf57 chromosome 15 open reading frame 57 1 1
MIRT030567 COMMD9 COMM domain containing 9 1 1
MIRT030568 SLC25A15 solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 1 1
MIRT030569 NOP14 NOP14 nucleolar protein homolog (yeast) 1 1
MIRT030570 CHD8 chromodomain helicase DNA binding protein 8 1 1
MIRT030571 OGFR opioid growth factor receptor 1 1
MIRT030572 ALG1 asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT030573 PCK2 phosphoenolpyruvate carboxykinase 2 (mitochondrial) 1 1
MIRT030574 SERGEF secretion regulating guanine nucleotide exchange factor 1 1
MIRT030575 ANPEP alanyl (membrane) aminopeptidase 1 1
MIRT030576 ITFG3 integrin alpha FG-GAP repeat containing 3 1 1
MIRT030577 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 1 1
MIRT030578 PRKRIR protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) 1 1
MIRT030579 AP5M1 MU-2/AP1M2 domain containing, death-inducing 1 1
MIRT030580 HMGB2 high-mobility group box 2 1 1
MIRT030581 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 1 1
MIRT030582 CSTF3 cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa 1 1
MIRT030583 FOXQ1 forkhead box Q1 1 1
MIRT030584 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT030585 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT030586 ZMYND19 zinc finger, MYND-type containing 19 1 1
MIRT030587 CHFR checkpoint with forkhead and ring finger domains 1 1
MIRT030588 CCNB1 cyclin B1 1 1
MIRT030589 ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 1 1
MIRT030590 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like 1 1
MIRT030591 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 1 1
MIRT030592 LAMTOR3 MAPK scaffold protein 1 1 1
MIRT030593 MRPL27 mitochondrial ribosomal protein L27 1 1
MIRT030594 COPS7A COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) 1 1
MIRT030595 DSC2 desmocollin 2 1 1
MIRT030596 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT030597 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT030598 KIAA0195 KIAA0195 1 1
MIRT030599 KIAA1967 KIAA1967 1 1
MIRT030600 HIC2 hypermethylated in cancer 2 1 1
MIRT030601 DTL denticleless homolog (Drosophila) 1 1
MIRT030602 NUBPL nucleotide binding protein-like 1 1
MIRT030603 GMFB glia maturation factor, beta 1 1
MIRT030604 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT030605 CMTM3 CKLF-like MARVEL transmembrane domain containing 3 1 1
MIRT030606 CSK c-src tyrosine kinase 1 1
MIRT030607 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 1 1
MIRT030608 MRPS22 mitochondrial ribosomal protein S22 1 1
MIRT030609 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT030610 NET1 neuroepithelial cell transforming 1 1 1
MIRT030611 GUCD1 chromosome 22 open reading frame 13 1 1
MIRT030612 RALA v-ral simian leukemia viral oncogene homolog A (ras related) 1 1
MIRT030613 AK4 adenylate kinase 4 1 1
MIRT030614 KCNJ14 potassium inwardly-rectifying channel, subfamily J, member 14 1 1
MIRT030615 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT030616 BRD8 bromodomain containing 8 1 1
MIRT030617 PIM2 pim-2 oncogene 1 1
MIRT030618 GFOD1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT030619 HDAC1 histone deacetylase 1 1 1
MIRT030620 WRB tryptophan rich basic protein 1 1
MIRT030621 TMEM194A transmembrane protein 194A 1 1
MIRT030622 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT030623 RNF11 ring finger protein 11 1 1
MIRT030624 RNF2 ring finger protein 2 1 1
MIRT030625 FZD5 frizzled homolog 5 (Drosophila) 1 1
MIRT030626 E2F1 E2F transcription factor 1 1 1
MIRT030627 CORO1A coronin, actin binding protein, 1A 1 1
MIRT030628 UBC ubiquitin C 1 1
MIRT030629 MCM4 minichromosome maintenance complex component 4 2 1
MIRT030630 PDXK pyridoxal (pyridoxine, vitamin B6) kinase 2 2
MIRT030631 PCNA proliferating cell nuclear antigen 3 1
MIRT035526 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT035527 PTPRF protein tyrosine phosphatase, receptor type, F 1 1
MIRT035542 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT035543 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT050365 RPS7 ribosomal protein S7 1 1
MIRT050366 EXOSC1 exosome component 1 1 1
MIRT050367 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT050368 RANBP1 RAN binding protein 1 1 1
MIRT050369 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT050370 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT050371 RPS16 ribosomal protein S16 1 1
MIRT050372 DEPDC1 DEP domain containing 1 1 1
MIRT050373 DDX5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 1 1
MIRT050374 BCL7A B-cell CLL/lymphoma 7A 1 1
MIRT050375 SNX12 sorting nexin 12 1 1
MIRT050376 GORASP2 golgi reassembly stacking protein 2, 55kDa 1 1
MIRT050377 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT050378 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT050379 CCNG1 cyclin G1 1 1
MIRT050380 IKBKAP inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein 1 1
MIRT050381 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT050382 GCLM glutamate-cysteine ligase, modifier subunit 1 1
MIRT050383 DCAF10 DDB1 and CUL4 associated factor 10 1 1