Accession ID: MIRT030438 [miRNA, hsa-miR-24-3p :: LSM12, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-24-1LinkOut: [miRBase ]
Synonyms MIR189, MIRN24-1, miR-24-1, miRNA24-1, MIR24-1
Description Homo sapiens miR-24-1 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-24-3p
Mature Sequence 44| UGGCUCAGUUCAGCAGGAACAG |65
Evidence Experimental
Experiments Cloned
Putative hsa-miR-24-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LSM12 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms PNAS-135
Description LSM12 homolog (S. cerevisiae)
Transcript NM_152344    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LSM12 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of LSM12
(miRNA target sites are highlighted)
>LSM12|NM_152344|3'UTR
   1 GTCCGTACACATGGAGGACTCTTCCAGCATCCAGCCAAGGAGGCGCTGGTGGTGGCTTCAGCGGAGGCAGGCCGGGGGAG
  81 GGAAGGGATCCTATATGTCCTGTTGGCTCTTAACAAAGGGTCAGCATTTCCAAATCTTAGACTTGAACAAACAAAACACC
 161 CAACAAAAAAGAACAAGAGAATAATTTAAAAGTTGAATCATTACTTGACTAACAGACTTCGGTCCACCATGTCCTTTTCA
 241 CAGCCCTCTTCTGGAACAGTCACCTTGTTAATTTTATTTTTGAAAATTATTTTCCCACTCTGCCCTTTACTTCTGACTTT
 321 CCTTTCCTAGTTTGTTCCTGCCATTCTGTTTTTATAAGTGGCTACACTTGCCTTCTGAATGATTGAAAGAAACTTTTACA
 401 TCTTTTCTTCCAAAATAAAAGTAACAAGCTGACTGTGATTCTTAAATTGAGACCAGAGCAGCAAACGTCTCACTTTAAAT
 481 TTTTGTTTTCTTTTCCTTTTTTTTTCTTTTTTCTTTTTTTTTTTTTTTTTGCACAGGGCATGGCTTGAATTAGTTTTATT
 561 TTTCTTAACTTTAAATATATATATGAAAATATATATTAAAATGTTCTCTAAATATTTTCTGCTTCTTGCAGGTCTCTTTT
 641 TACTAGATCATGGCTGTTCTTCCCACCTCATCCCTCTGAAAATAAAAATGTATTGCCCTCCCCACCATCCATCATAGCCA
 721 GGCCACTAACTTGACTTGGTGCAAGAGATTCTTGCTGCGAACTTTGTAGAGCCAGTGTGCAGATAGAATTTGGCTTTGAG
 801 GGTTCCTGATGGCTTTTTAGTCTTTAACTGTGTGTGTACCAGTCTCACATTTGGCCCAAACCTCAGGATTCTCCCTCTGC
 881 CTGTCTTACTTCATGGTACTAGAAGACCTTCCTCGCCACTCTCTCCACATGAGAGAGTCAGCTGCCCTTTCTCCTGTGCC
 961 TCTGCAGGAAGAACTCTCTTGCATGGCACATCTCAGCTCCTCATTGAGGGATAGTTTTCTTTGATAAGAAACCTGGAGTC
1041 CATTTACTCTGACCTCTCTTTAAATCTATATCCAGAGCCACTAGCCCAGGAAAAACTTGGGTGACCCGTAATTTCTCTTC
1121 TCCTGCTGTCCTTTTGCTCTTACGCCCCACCCCAACTCCCCTTAAATTTTACAGGCTTATGACAGTTTGTATGTGCTCAG
1201 CCAATGAGCAGAAAACCTGGAAAGAATTTCTGGACTTTAGCCCACCAGTTTGTCTGGTTGACTAACCTGCTGAGAGCTAA
1281 AATTGGCACCCATTGCCCCGTGCCTTCAGGCAGTCTCCTGGGGCAGAGTATGCCACCATCCGAATATCAGGCACTGAGTG
1361 GGATGTGGGTGATGCTCACATGACTGGCTAGAGCTTTGGGGGTGGGGTGGGGGTTAACTACTATTTTTTTGGCCATGATC
1441 TCTTTCCCCTTCCTTTTTTTTTTAATTAAATAAATGGATCAAATTAAATAATTCAAGCCCTGCCTTCAAAATGAAATTTT
1521 TTTTTTAGTATTATTTAGCAAAAACAATAAAACCCAAATTTTTTTAACCATCA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaCAAGGACG-ACUUGACUCGGu 5'
            |||  ||: || :|| |||| 
Target 5' caGTT--TGTATGTGCTCAGCCa 3'
1183 - 1203 124.00 -11.70
2
miRNA  3' gacAAGGACGA--CUU-----GACUCGGu 5'
             |||:||||  |||     : ||||| 
Target 5' agaTTCTTGCTGCGAACTTTGTAGAGCCa 3'
746 - 774 117.00 -20.30
3
miRNA  3' gacAAGGACGACUUGACUCGGu 5'
             ||:|||  || :| |||| 
Target 5' gaaTTTCTG--GACTTTAGCCc 3'
1224 - 1243 115.00 -12.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-24-3p :: LSM12    [ Functional MTI ]
Validation Method Microarray
Article - Lal, A. Navarro, F. Maher, C. A. et al.
- Mol Cell, 2009
miR-24, upregulated during terminal differentiation of multiple lineages, inhibits cell-cycle progression. Antagonizing miR-24 restores postmitotic cell proliferation and enhances fibroblast proliferation, whereas overexpressing miR-24 increases the G1 compartment. The 248 mRNAs downregulated upon miR-24 overexpression are highly enriched for DNA repair and cell-cycle regulatory genes that form a direct interaction network with prominent nodes at genes that enhance (MYC, E2F2, CCNB1, and CDC2) or inhibit (p27Kip1 and VHL) cell-cycle progression. miR-24 directly regulates MYC and E2F2 and some genes that they transactivate. Enhanced proliferation from antagonizing miR-24 is abrogated by knocking down E2F2, but not MYC, and cell proliferation, inhibited by miR-24 overexpression, is rescued by miR-24-insensitive E2F2. Therefore, E2F2 is a critical miR-24 target. The E2F2 3'UTR lacks a predicted miR-24 recognition element. In fact, miR-24 regulates expression of E2F2, MYC, AURKB, CCNA2, CDC2, CDK4, and FEN1 by recognizing seedless but highly complementary sequences.
LinkOut: [PMID: 19748357]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
803 hsa-miR-24-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000116 FEN1 flap structure-specific endonuclease 1 5 1
MIRT000117 CDK4 cyclin-dependent kinase 4 5 1
MIRT000119 CCNA2 cyclin A2 5 1
MIRT000120 AURKB aurora kinase B 5 1
MIRT000121 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 5 1
MIRT000122 E2F2 E2F transcription factor 2 5 1
MIRT001773 NOTCH1 notch 1 2 2
MIRT002018 DHFR dihydrofolate reductase 5 3
MIRT002950 MAPK14 mitogen-activated protein kinase 14 2 1
MIRT003354 TRIB3 tribbles homolog 3 (Drosophila) 5 4
MIRT003355 HNF4A hepatocyte nuclear factor 4, alpha 5 2
MIRT003830 ACVR1B activin A receptor, type IB 4 4
MIRT003889 MLEC malectin 3 2
MIRT004362 CDKN2A cyclin-dependent kinase inhibitor 2A 4 1
MIRT004836 BRCA1 breast cancer 1, early onset 5 2
MIRT004837 POLD1 polymerase (DNA directed), delta 1, catalytic subunit 5 1
MIRT005063 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 6 5
MIRT005397 KHSRP KH-type splicing regulatory protein 2 2
MIRT005398 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 2 2
MIRT005766 DND1 dead end homolog 1 (zebrafish) 3 1
MIRT005918 TGFB1 transforming growth factor, beta 1 4 1
MIRT005919 FURIN furin (paired basic amino acid cleaving enzyme) 4 2
MIRT006507 FAF1 Fas (TNFRSF6) associated factor 1 2 1
MIRT007012 ZNF217 zinc finger protein 217 2 2
MIRT007215 ST7L suppression of tumorigenicity 7 like 3 1
MIRT030361 VRK1 vaccinia related kinase 1 1 1
MIRT030362 NOP56 NOP56 ribonucleoprotein homolog (yeast) 1 1
MIRT030363 TBPL1 TBP-like 1 1 1
MIRT030364 TNPO3 transportin 3 2 3
MIRT030365 SNRPB2 small nuclear ribonucleoprotein polypeptide B 1 1
MIRT030366 DDHD2 DDHD domain containing 2 1 1
MIRT030367 THOP1 thimet oligopeptidase 1 1 1
MIRT030368 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT030369 UBE2C ubiquitin-conjugating enzyme E2C 1 1
MIRT030370 GNPAT glyceronephosphate O-acyltransferase 1 1
MIRT030371 METAP2 methionyl aminopeptidase 2 1 1
MIRT030372 KIAA0020 KIAA0020 1 1
MIRT030373 UGDH UDP-glucose 6-dehydrogenase 2 3
MIRT030374 URM1 ubiquitin related modifier 1 1 1
MIRT030375 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT030376 MED22 mediator complex subunit 22 1 1
MIRT030377 USP10 ubiquitin specific peptidase 10 1 1
MIRT030378 FKBP1B FK506 binding protein 1B, 12.6 kDa 1 1
MIRT030379 SCML1 sex comb on midleg-like 1 (Drosophila) 1 1
MIRT030380 CNDP2 CNDP dipeptidase 2 (metallopeptidase M20 family) 2 1
MIRT030381 MCM10 minichromosome maintenance complex component 10 2 1
MIRT030382 TOP1 topoisomerase (DNA) I 2 1
MIRT030383 H2AFX H2A histone family, member X 4 3
MIRT030384 TOMM22 translocase of outer mitochondrial membrane 22 homolog (yeast) 1 1
MIRT030385 HBQ1 hemoglobin, theta 1 1 1
MIRT030386 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT030387 PSMD1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 2 2
MIRT030388 AUNIP aurora kinase A and ninein interacting protein 1 1
MIRT030389 NARF nuclear prelamin A recognition factor 1 1
MIRT030390 MALSU1 mitochondrial assembly of ribosomal large subunit 1 1 1
MIRT030391 TCEA3 transcription elongation factor A (SII), 3 1 1
MIRT030392 ADRM1 adhesion regulating molecule 1 1 1
MIRT030393 AGFG1 ArfGAP with FG repeats 1 1 1
MIRT030394 ACD adrenocortical dysplasia homolog (mouse) 1 1
MIRT030395 RCE1 RCE1 homolog, prenyl protein protease (S. cerevisiae) 1 1
MIRT030396 SUMO3 SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae) 1 1
MIRT030397 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 2 2
MIRT030398 C18orf56 chromosome 18 open reading frame 56 1 1
MIRT030399 MIS18A MIS18 kinetochore protein homolog A (S. pombe) 1 1
MIRT030400 GLYR1 glyoxylate reductase 1 homolog (Arabidopsis) 1 1
MIRT030401 NAE1 NEDD8 activating enzyme E1 subunit 1 1 1
MIRT030402 ACTL6A actin-like 6A 1 1
MIRT030403 NCBP2 nuclear cap binding protein subunit 2, 20kDa 1 1
MIRT030404 SLC29A4 solute carrier family 29 (nucleoside transporters), member 4 1 1
MIRT030405 PHF16 PHD finger protein 16 1 1
MIRT030406 GYG2 glycogenin 2 1 1
MIRT030407 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 1
MIRT030408 EXOSC8 exosome component 8 1 1
MIRT030409 TDRP chromosome 8 open reading frame 42 1 1
MIRT030410 R3HDM4 R3H domain containing 4 1 1
MIRT030411 DCAF4 DDB1 and CUL4 associated factor 4 1 1
MIRT030412 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT030413 VPS25 vacuolar protein sorting 25 homolog (S. cerevisiae) 1 1
MIRT030414 NR0B2 nuclear receptor subfamily 0, group B, member 2 1 1
MIRT030415 NASP nuclear autoantigenic sperm protein (histone-binding) 1 1
MIRT030416 STRADB STE20-related kinase adaptor beta 1 1
MIRT030417 MTF2 metal response element binding transcription factor 2 1 1
MIRT030418 PHOSPHO2 phosphatase, orphan 2 1 1
MIRT030419 ATAD3A ATPase family, AAA domain containing 3A 1 1
MIRT030420 CCDC59 coiled-coil domain containing 59 2 2
MIRT030421 VPS35 vacuolar protein sorting 35 homolog (S. cerevisiae) 1 1
MIRT030422 PAF1 Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) 1 1
MIRT030423 CIRBP cold inducible RNA binding protein 1 1
MIRT030424 S100P S100 calcium binding protein P 1 1
MIRT030425 ARHGEF7 Rho guanine nucleotide exchange factor (GEF) 7 1 1
MIRT030426 PROSER1 proline and serine rich 1 1 1
MIRT030427 PDLIM7 PDZ and LIM domain 7 (enigma) 1 1
MIRT030428 KIAA0100 KIAA0100 1 1
MIRT030429 TOMM34 translocase of outer mitochondrial membrane 34 1 1
MIRT030430 CTCF CCCTC-binding factor (zinc finger protein) 1 1
MIRT030431 EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 1 1
MIRT030432 SLC52A2 solute carrier family 52, riboflavin transporter, member 2 1 1
MIRT030433 KHNYN KH and NYN domain containing 1 1
MIRT030434 ADD1 adducin 1 (alpha) 1 1
MIRT030435 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT030436 KLHL23 kelch-like 23 (Drosophila) 1 1
MIRT030437 SULT2A1 sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 1 1
MIRT030438 LSM12 LSM12 homolog (S. cerevisiae) 1 1
MIRT030439 PDPK1 3-phosphoinositide dependent protein kinase-1 2 2
MIRT030440 CARD10 caspase recruitment domain family, member 10 1 1
MIRT030441 PPM1F protein phosphatase, Mg2+/Mn2+ dependent, 1F 1 1
MIRT030442 NRIP1 nuclear receptor interacting protein 1 1 1
MIRT030443 ARHGEF18 Rho/Rac guanine nucleotide exchange factor (GEF) 18 1 1
MIRT030444 FNTB farnesyltransferase, CAAX box, beta 1 1
MIRT030445 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 3 3
MIRT030446 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT030447 BCL2L2 BCL2-like 2 1 1
MIRT030448 PSTPIP2 proline-serine-threonine phosphatase interacting protein 2 1 1
MIRT030449 ACACA acetyl-CoA carboxylase alpha 1 1
MIRT030450 MATR3 matrin 3 2 2
MIRT030451 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT030452 TSPAN14 tetraspanin 14 1 1
MIRT030453 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT030454 MIDN midnolin 1 1
MIRT030455 CCDC58 coiled-coil domain containing 58 1 1
MIRT030456 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT030457 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT030458 ZNF813 zinc finger protein 813 1 1
MIRT030459 MAGI1 membrane associated guanylate kinase, WW and PDZ domain containing 1 1 1
MIRT030460 ZCCHC14 zinc finger, CCHC domain containing 14 1 1
MIRT030461 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT030462 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT030463 DNAJB12 DnaJ (Hsp40) homolog, subfamily B, member 12 1 1
MIRT030464 NUP54 nucleoporin 54kDa 2 2
MIRT030465 SESN1 sestrin 1 2 2
MIRT030466 SLC35B2 solute carrier family 35, member B2 2 2
MIRT030467 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 2 2
MIRT030468 UBD ubiquitin D 2 1
MIRT030469 RRM2 ribonucleotide reductase M2 2 1
MIRT030470 BCL2L12 BCL2-like 12 (proline rich) 2 1
MIRT030471 MBD6 methyl-CpG binding domain protein 6 2 1
MIRT030472 OXSR1 oxidative-stress responsive 1 1 1
MIRT030473 PER2 period homolog 2 (Drosophila) 2 1
MIRT030474 UNG uracil-DNA glycosylase 1 1
MIRT030475 RRP12 ribosomal RNA processing 12 homolog (S. cerevisiae) 1 1
MIRT030476 CWC27 CWC27 spliceosome-associated protein homolog (S. cerevisiae) 1 1
MIRT030477 SRRT serrate RNA effector molecule homolog (Arabidopsis) 1 1
MIRT030478 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 1 1
MIRT030479 EXOSC3 exosome component 3 1 1
MIRT030480 ALG5 asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) 1 1
MIRT030481 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT030482 MRPS24 mitochondrial ribosomal protein S24 1 1
MIRT030483 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 3 3
MIRT030484 GTF3C2 general transcription factor IIIC, polypeptide 2, beta 110kDa 1 1
MIRT030485 FAH fumarylacetoacetate hydrolase (fumarylacetoacetase) 1 1
MIRT030486 ARL1 ADP-ribosylation factor-like 1 1 1
MIRT030487 MED16 mediator complex subunit 16 2 2
MIRT030488 MED24 mediator complex subunit 24 1 1
MIRT030489 CCAR1 cell division cycle and apoptosis regulator 1 1 1
MIRT030490 DUS1L dihydrouridine synthase 1-like (S. cerevisiae) 1 1
MIRT030491 BEX1 brain expressed, X-linked 1 1 1
MIRT030492 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT030493 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT030494 DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) 1 1
MIRT030495 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 1 1
MIRT030496 UBE3A ubiquitin protein ligase E3A 1 1
MIRT030497 TYW3 tRNA-yW synthesizing protein 3 homolog (S. cerevisiae) 1 1
MIRT030498 UQCC ubiquinol-cytochrome c reductase complex chaperone 1 1
MIRT030499 NKD1 naked cuticle homolog 1 (Drosophila) 1 1
MIRT030500 NFKBIA nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha 1 1
MIRT030501 AK3 adenylate kinase 3 1 1
MIRT030502 NSA2 NSA2 ribosome biogenesis homolog (S. cerevisiae) 1 1
MIRT030503 CDK1 cyclin-dependent kinase 1 5 1
MIRT030504 HSF2 heat shock transcription factor 2 1 1
MIRT030505 CDCA7 cell division cycle associated 7 1 1
MIRT030506 NCOA6 nuclear receptor coactivator 6 1 1
MIRT030507 TNIP2 TNFAIP3 interacting protein 2 1 1
MIRT030508 AKAP7 A kinase (PRKA) anchor protein 7 1 1
MIRT030509 TUBGCP2 tubulin, gamma complex associated protein 2 1 1
MIRT030510 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 2 2
MIRT030511 FBXO34 F-box protein 34 1 1
MIRT030512 STK35 serine/threonine kinase 35 1 1
MIRT030513 CTDSP2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 1 1
MIRT030514 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT030515 ZDHHC3 zinc finger, DHHC-type containing 3 1 1
MIRT030516 IQCB1 IQ motif containing B1 1 1
MIRT030517 RHOT2 ras homolog family member T2 1 1
MIRT030518 ALDH5A1 aldehyde dehydrogenase 5 family, member A1 1 1
MIRT030519 VHL von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase 1 1
MIRT030520 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT030521 GBAS glioblastoma amplified sequence 1 1
MIRT030522 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 1
MIRT030523 NEK6 NIMA (never in mitosis gene a)-related kinase 6 1 1
MIRT030524 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT030525 GGA2 golgi-associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT030526 ADPGK ADP-dependent glucokinase 1 1
MIRT030527 DSCR3 Down syndrome critical region gene 3 1 1
MIRT030528 FZD4 frizzled family receptor 4 1 1
MIRT030529 AAMP angio-associated, migratory cell protein 1 1
MIRT030530 PLIN3 perilipin 3 1 1
MIRT030531 LLGL1 lethal giant larvae homolog 1 (Drosophila) 2 3
MIRT030532 KLHDC3 kelch domain containing 3 1 1
MIRT030533 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT030534 MARCKSL1 MARCKS-like 1 2 2
MIRT030535 C1orf106 chromosome 1 open reading frame 106 2 2
MIRT030536 ADD3 adducin 3 (gamma) 1 1
MIRT030537 SNTB1 syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1) 1 1
MIRT030538 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT030539 TMTC4 transmembrane and tetratricopeptide repeat containing 4 1 1
MIRT030540 GLUL glutamate-ammonia ligase 1 1
MIRT030541 TMEM209 transmembrane protein 209 1 1
MIRT030542 LBR lamin B receptor 1 1
MIRT030543 LIMD1 LIM domains containing 1 1 1
MIRT030544 SPIN4 spindlin family, member 4 1 1
MIRT030545 ZNF264 zinc finger protein 264 1 3
MIRT030546 VGLL3 vestigial like 3 (Drosophila) 1 1
MIRT030547 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 6
MIRT030548 DEDD death effector domain containing 1 1
MIRT030549 CD34 CD34 molecule 1 1
MIRT030550 TMED7 transmembrane emp24 protein transport domain containing 7 1 1
MIRT030551 E2F3 E2F transcription factor 3 2 1
MIRT030552 ZNF317 zinc finger protein 317 2 1
MIRT030553 STX16 syntaxin 16 2 1
MIRT030554 DHFRP1 dihydrofolate reductase pseudogene 1 1 1
MIRT030555 CHEK1 checkpoint kinase 1 4 1
MIRT030556 NOTUM notum pectinacetylesterase homolog (Drosophila) 1 1
MIRT030557 ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 1 1
MIRT030558 CCL2 chemokine (C-C motif) ligand 2 1 1
MIRT030559 OARD1 O-acyl-ADP-ribose deacylase 1 1 1
MIRT030560 PCGF6 polycomb group ring finger 6 1 1
MIRT030561 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 18kDa 2 2
MIRT030562 CTDSP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 1 1
MIRT030563 MAK16 MAK16 homolog (S. cerevisiae) 1 1
MIRT030564 RNF144A ring finger protein 144A 1 1
MIRT030565 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT030566 C15orf57 chromosome 15 open reading frame 57 1 1
MIRT030567 COMMD9 COMM domain containing 9 1 1
MIRT030568 SLC25A15 solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 1 1
MIRT030569 NOP14 NOP14 nucleolar protein homolog (yeast) 1 1
MIRT030570 CHD8 chromodomain helicase DNA binding protein 8 1 1
MIRT030571 OGFR opioid growth factor receptor 1 1
MIRT030572 ALG1 asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT030573 PCK2 phosphoenolpyruvate carboxykinase 2 (mitochondrial) 1 1
MIRT030574 SERGEF secretion regulating guanine nucleotide exchange factor 1 1
MIRT030575 ANPEP alanyl (membrane) aminopeptidase 1 1
MIRT030576 ITFG3 integrin alpha FG-GAP repeat containing 3 1 1
MIRT030577 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 1 1
MIRT030578 PRKRIR protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) 1 1
MIRT030579 AP5M1 adaptor-related protein complex 5, mu 1 subunit 1 1
MIRT030580 HMGB2 high mobility group box 2 1 1
MIRT030581 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 1 1
MIRT030582 CSTF3 cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa 1 1
MIRT030583 FOXQ1 forkhead box Q1 1 1
MIRT030584 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT030585 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT030586 ZMYND19 zinc finger, MYND-type containing 19 1 1
MIRT030587 CHFR checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase 1 1
MIRT030588 CCNB1 cyclin B1 1 1
MIRT030589 ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 2 2
MIRT030590 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase 1 1
MIRT030591 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 2 2
MIRT030592 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 1 1
MIRT030593 MRPL27 mitochondrial ribosomal protein L27 1 1
MIRT030594 COPS7A COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) 1 1
MIRT030595 DSC2 desmocollin 2 1 1
MIRT030596 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT030597 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT030598 KIAA0195 KIAA0195 1 1
MIRT030599 KIAA1967 KIAA1967 1 1
MIRT030600 HIC2 hypermethylated in cancer 2 1 1
MIRT030601 DTL denticleless E3 ubiquitin protein ligase homolog (Drosophila) 1 1
MIRT030602 NUBPL nucleotide binding protein-like 1 1
MIRT030603 GMFB glia maturation factor, beta 1 1
MIRT030604 PLAGL2 pleiomorphic adenoma gene-like 2 2 2
MIRT030605 CMTM3 CKLF-like MARVEL transmembrane domain containing 3 1 1
MIRT030606 CSK c-src tyrosine kinase 1 1
MIRT030607 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 1 1
MIRT030608 MRPS22 mitochondrial ribosomal protein S22 1 1
MIRT030609 RFWD2 ring finger and WD repeat domain 2, E3 ubiquitin protein ligase 1 1
MIRT030610 NET1 neuroepithelial cell transforming 1 1 1
MIRT030611 GUCD1 chromosome 22 open reading frame 13 2 3
MIRT030612 RALA v-ral simian leukemia viral oncogene homolog A (ras related) 1 1
MIRT030613 AK4 adenylate kinase 4 1 1
MIRT030614 KCNJ14 potassium inwardly-rectifying channel, subfamily J, member 14 1 1
MIRT030615 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT030616 BRD8 bromodomain containing 8 1 1
MIRT030617 PIM2 pim-2 oncogene 1 1
MIRT030618 GFOD1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT030619 HDAC1 histone deacetylase 1 1 1
MIRT030620 WRB tryptophan rich basic protein 1 1
MIRT030621 TMEM194A transmembrane protein 194A 1 1
MIRT030622 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT030623 RNF11 ring finger protein 11 1 1
MIRT030624 RNF2 ring finger protein 2 1 2
MIRT030625 FZD5 frizzled family receptor 5 1 1
MIRT030626 E2F1 E2F transcription factor 1 1 1
MIRT030627 CORO1A coronin, actin binding protein, 1A 1 1
MIRT030628 UBC ubiquitin C 1 1
MIRT030629 MCM4 minichromosome maintenance complex component 4 2 1
MIRT030630 PDXK pyridoxal (pyridoxine, vitamin B6) kinase 2 2
MIRT030631 PCNA proliferating cell nuclear antigen 3 1
MIRT035526 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT035527 PTPRF protein tyrosine phosphatase, receptor type, F 1 1
MIRT035542 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT035543 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT050365 RPS7 ribosomal protein S7 1 1
MIRT050366 EXOSC1 exosome component 1 1 1
MIRT050367 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT050368 RANBP1 RAN binding protein 1 1 1
MIRT050369 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT050370 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT050371 RPS16 ribosomal protein S16 1 1
MIRT050372 DEPDC1 DEP domain containing 1 1 1
MIRT050373 DDX5 DEAD (Asp-Glu-Ala-Asp) box helicase 5 1 1
MIRT050374 BCL7A B-cell CLL/lymphoma 7A 1 1
MIRT050375 SNX12 sorting nexin 12 1 1
MIRT050376 GORASP2 golgi reassembly stacking protein 2, 55kDa 1 1
MIRT050377 RIF1 RAP1 interacting factor homolog (yeast) 1 2
MIRT050378 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT050379 CCNG1 cyclin G1 1 1
MIRT050380 IKBKAP inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein 1 1
MIRT050381 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT050382 GCLM glutamate-cysteine ligase, modifier subunit 1 1
MIRT050383 DCAF10 DDB1 and CUL4 associated factor 10 1 1
MIRT052941 Furin furin (paired basic amino acid cleaving enzyme) 2 1
MIRT052953 S100A8 S100 calcium binding protein A8 2 1
MIRT053042 MXI1 MAX interactor 1 3 1
MIRT053061 XIAP X-linked inhibitor of apoptosis 4 2
MIRT053134 NOS3 nitric oxide synthase 3 (endothelial cell) 3 1
MIRT053161 INSIG1 insulin induced gene 1 3 4
MIRT053238 CYP11B2 cytochrome P450, family 11, subfamily B, polypeptide 2 2 1
MIRT053779 REG4 regenerating islet-derived family, member 4 3 1
MIRT054288 MEN1 multiple endocrine neoplasia I 4 2
MIRT054320 LDHA lactate dehydrogenase A 3 2
MIRT054323 LDHB lactate dehydrogenase B 2 1
MIRT054386 JPH2 junctophilin 2 2 2
MIRT054393 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT054474 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 1
MIRT054710 SSSCA1 Sjogren syndrome/scleroderma autoantigen 1 3 1
MIRT054754 HMOX1 heme oxygenase (decycling) 1 2 1
MIRT054828 PSAP prosaposin 4 1
MIRT115232 ABHD2 abhydrolase domain containing 2 1 1
MIRT123977 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT196600 TAOK1 TAO kinase 1 1 1
MIRT249228 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT256046 UBE2K ubiquitin-conjugating enzyme E2K 1 2
MIRT324457 ASB6 ankyrin repeat and SOCS box containing 6 1 1
MIRT327634 ZXDB zinc finger, X-linked, duplicated B 1 3
MIRT352061 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT395244 MT1E metallothionein 1E 1 1
MIRT437500 MMP14 matrix metallopeptidase 14 (membrane-inserted) 1 1
MIRT437826 AGPAT2 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) 1 1
MIRT437970 IFNG interferon, gamma 3 1
MIRT438418 FGFR3 fibroblast growth factor receptor 3 4 1
MIRT438421 TACC3 transforming, acidic coiled-coil containing protein 3 4 1
MIRT438424 MAFB v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) 4 1
MIRT438427 CCND1 cyclin D1 4 1
MIRT438454 NCSTN nicastrin 1 1
MIRT438533 IFNR interferon production regulator 2 1
MIRT438608 WNT4 wingless-type MMTV integration site family, member 4 1 1
MIRT438644 NDST1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 3 1
MIRT447723 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT447760 TTLL7 tubulin tyrosine ligase-like family, member 7 1 1
MIRT455064 ARHGAP39 Rho GTPase activating protein 39 1 1
MIRT455750 YRDC yrdC domain containing (E. coli) 1 1
MIRT457051 NEGR1 neuronal growth regulator 1 1 2
MIRT458116 TMEM173 transmembrane protein 173 1 1
MIRT458530 HKR1 HKR1, GLI-Kruppel zinc finger family member 1 1
MIRT462325 SETX senataxin 1 1
MIRT464501 UCK2 uridine-cytidine kinase 2 1 1
MIRT465466 TOR2A torsin family 2, member A 1 1
MIRT471227 PHAX phosphorylated adaptor for RNA export 1 1
MIRT476066 GRINA glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) 1 1
MIRT476461 GBA2 glucosidase, beta (bile acid) 2 1 1
MIRT476706 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT476916 FBLIM1 filamin binding LIM protein 1 1 2
MIRT477425 EMP1 epithelial membrane protein 1 1 1
MIRT477908 DVL3 dishevelled, dsh homolog 3 (Drosophila) 1 2
MIRT478339 DDN dendrin 1 1
MIRT478801 CRTAP cartilage associated protein 1 2
MIRT479899 CCDC117 coiled-coil domain containing 117 1 1
MIRT480435 C17orf49 chromosome 17 open reading frame 49 1 1
MIRT481095 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 1
MIRT481990 AMOTL2 angiomotin like 2 1 1
MIRT486982 STEAP3 STEAP family member 3, metalloreductase 1 2
MIRT489236 CLN8 ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation) 1 2
MIRT490739 SRCIN1 SRC kinase signaling inhibitor 1 1 1
MIRT492019 UGCG UDP-glucose ceramide glucosyltransferase 1 1
MIRT493589 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 3
MIRT494058 DUSP7 dual specificity phosphatase 7 1 1
MIRT499970 NCOA5 nuclear receptor coactivator 5 1 1
MIRT501272 NHS Nance-Horan syndrome (congenital cataracts and dental anomalies) 1 2
MIRT501542 POGZ pogo transposable element with ZNF domain 1 1
MIRT527694 IL17REL interleukin 17 receptor E-like 1 1
MIRT527729 TMEM241 transmembrane protein 241 1 1
MIRT528420 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT528870 ATF3 activating transcription factor 3 1 1
MIRT530340 GABRB3 gamma-aminobutyric acid (GABA) A receptor, beta 3 1 1
MIRT540115 KLF17 Kruppel-like factor 17 1 1
MIRT540603 CD3D CD3d molecule, delta (CD3-TCR complex) 1 2
MIRT540636 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 1
MIRT541054 SEPHS1 selenophosphate synthetase 1 1 1
MIRT541713 TMEM33 transmembrane protein 33 1 1
MIRT541847 PLIN5 perilipin 5 1 1
MIRT541892 LY6G5B lymphocyte antigen 6 complex, locus G5B 1 1
MIRT542947 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT545431 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT549513 HDDC2 HD domain containing 2 1 1
MIRT556737 KLHL15 kelch-like 15 (Drosophila) 1 2
MIRT559280 AURKA aurora kinase A 1 1
MIRT564581 ZXDA zinc finger, X-linked, duplicated A 1 1
MIRT571909 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 2
MIRT575280 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT607045 IDS iduronate 2-sulfatase 1 1
MIRT607713 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT608083 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2 1 1
MIRT609645 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT610567 HIST3H2BB histone cluster 3, H2bb 1 1
MIRT611112 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 1
MIRT613671 KIAA1210 KIAA1210 1 1
MIRT615060 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT617926 ZNF783 zinc finger family member 783 1 1
MIRT618465 GPR55 G protein-coupled receptor 55 1 1
MIRT619409 NTPCR nucleoside-triphosphatase, cancer-related 1 1
MIRT620694 RFTN2 raftlin family member 2 1 1
MIRT620921 LRRTM2 leucine rich repeat transmembrane neuronal 2 1 1
MIRT621035 POLA2 polymerase (DNA directed), alpha 2, accessory subunit 1 1
MIRT622583 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT623371 LRIG2 leucine-rich repeats and immunoglobulin-like domains 2 1 1
MIRT623402 LEPROTL1 leptin receptor overlapping transcript-like 1 1 1
MIRT625024 ZNF730 zinc finger protein 730 1 1
MIRT625113 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 2
MIRT625326 TNFRSF13B tumor necrosis factor receptor superfamily, member 13B 1 1
MIRT625414 IMP4 IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) 1 1
MIRT625832 NXPE2 neurexophilin and PC-esterase domain family, member 2 1 1
MIRT625899 LINC00632 uncharacterized LOC286411 1 1
MIRT626169 DNAJB13 DnaJ (Hsp40) homolog, subfamily B, member 13 1 1
MIRT626607 ACAA2 acetyl-CoA acyltransferase 2 1 1
MIRT626675 CISD2 CDGSH iron sulfur domain 2 1 1
MIRT626815 PRR11 proline rich 11 1 1
MIRT626828 ZNF430 zinc finger protein 430 1 1
MIRT627784 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT628137 HM13 histocompatibility (minor) 13 1 1
MIRT628610 ZBTB3 zinc finger and BTB domain containing 3 1 1
MIRT628683 TRAF3IP1 TNF receptor-associated factor 3 interacting protein 1 1 1
MIRT628787 GSDMA gasdermin A 1 1
MIRT628858 KCNE4 potassium voltage-gated channel, Isk-related family, member 4 1 1
MIRT629019 OSBPL10 oxysterol binding protein-like 10 1 1
MIRT629125 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 2
MIRT629200 PAPOLA poly(A) polymerase alpha 1 1
MIRT629207 ZNF878 zinc finger protein 878 1 1
MIRT629234 CINP cyclin-dependent kinase 2 interacting protein 1 1
MIRT629398 CRCP CGRP receptor component 1 1
MIRT629517 ULBP3 UL16 binding protein 3 1 2
MIRT629559 EMP2 epithelial membrane protein 2 1 1
MIRT629570 PIGR polymeric immunoglobulin receptor 1 1
MIRT629748 SCD5 stearoyl-CoA desaturase 5 1 1
MIRT629797 GPR82 G protein-coupled receptor 82 1 1
MIRT629813 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa 1 1
MIRT629833 CCL16 chemokine (C-C motif) ligand 16 1 1
MIRT629907 SPATA5 spermatogenesis associated 5 1 1
MIRT629982 NARS asparaginyl-tRNA synthetase 1 1
MIRT630004 PDE6B phosphodiesterase 6B, cGMP-specific, rod, beta 1 1
MIRT630034 MTL5 metallothionein-like 5, testis-specific (tesmin) 1 1
MIRT630075 GRWD1 glutamate-rich WD repeat containing 1 1 1
MIRT630136 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT630208 SVIP small VCP/p97-interacting protein 1 1
MIRT630219 SORD sorbitol dehydrogenase 1 1
MIRT630250 SMTNL2 smoothelin-like 2 1 1
MIRT630295 PRICKLE1 prickle homolog 1 (Drosophila) 1 1
MIRT630400 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT630411 MOB1A MOB kinase activator 1A 1 1
MIRT630436 KIF1C kinesin family member 1C 1 1
MIRT630475 DTD2 D-tyrosyl-tRNA deacylase 2 (putative) 1 1
MIRT630517 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT630809 XPNPEP3 X-prolyl aminopeptidase (aminopeptidase P) 3, putative 1 1
MIRT630819 YTHDC1 YTH domain containing 1 1 1
MIRT630833 ZNF621 zinc finger protein 621 1 1
MIRT630913 ZMAT2 zinc finger, matrin-type 2 1 1
MIRT631166 APTX aprataxin 1 1
MIRT631210 DENND6B DENN/MADD domain containing 6B 1 1
MIRT631569 TRAF3IP2 TRAF3 interacting protein 2 1 1
MIRT631648 C19orf35 chromosome 19 open reading frame 35 1 1
MIRT631698 C1QTNF6 C1q and tumor necrosis factor related protein 6 1 1
MIRT631755 MINOS1 mitochondrial inner membrane organizing system 1 1 1
MIRT631997 POPDC2 popeye domain containing 2 1 1
MIRT632015 TAF1B TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa 1 1
MIRT632034 SPPL2A signal peptide peptidase like 2A 1 1
MIRT632219 YME1L1 YME1-like 1 (S. cerevisiae) 1 1
MIRT632351 STRN3 striatin, calmodulin binding protein 3 1 1
MIRT632358 SRRD SRR1 domain containing 1 1
MIRT632426 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT632456 SGTB small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta 1 1
MIRT632493 RBM3 RNA binding motif (RNP1, RRM) protein 3 1 1
MIRT632631 PARP2 poly (ADP-ribose) polymerase 2 1 1
MIRT632637 OSMR oncostatin M receptor 1 1
MIRT632718 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 1
MIRT632753 MED28 mediator complex subunit 28 1 1
MIRT632761 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT632841 IGF1 insulin-like growth factor 1 (somatomedin C) 1 1
MIRT633144 C4orf32 chromosome 4 open reading frame 32 1 1
MIRT633162 C11orf84 chromosome 11 open reading frame 84 1 1
MIRT633256 ZNF581 zinc finger protein 581 1 1
MIRT633260 ZNF556 zinc finger protein 556 1 1
MIRT633305 LINC00346 long intergenic non-protein coding RNA 346 1 1
MIRT633327 PRPF6 PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) 1 1
MIRT633336 GRK4 G protein-coupled receptor kinase 4 1 1
MIRT633354 TFDP2 transcription factor Dp-2 (E2F dimerization partner 2) 1 1
MIRT633460 DSN1 DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT633498 ERO1L ERO1-like (S. cerevisiae) 1 1
MIRT633534 PGBD5 piggyBac transposable element derived 5 1 1
MIRT633621 R3HDM2 R3H domain containing 2 1 1
MIRT633748 MCM9 minichromosome maintenance complex component 9 1 1
MIRT633874 ATP6V1A ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A 1 1
MIRT634001 SSR1 signal sequence receptor, alpha 1 1
MIRT634106 ZNF8 zinc finger protein 8 1 1
MIRT634121 ZMYM1 zinc finger, MYM-type 1 1 2
MIRT634135 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT634182 TXNDC16 thioredoxin domain containing 16 1 1
MIRT634205 TMEM192 transmembrane protein 192 1 1
MIRT634277 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT634308 SNTN sentan, cilia apical structure protein 1 1
MIRT634362 RASSF9 Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 1 1
MIRT634446 PDE7A phosphodiesterase 7A 1 1
MIRT634467 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 1
MIRT634482 OR7D2 olfactory receptor, family 7, subfamily D, member 2 1 1
MIRT634612 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 1
MIRT634627 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT635035 WWTR1 WW domain containing transcription regulator 1 1 1
MIRT635140 PLEKHA2 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 1 1
MIRT635801 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT636093 ZFP30 zinc finger protein 30 homolog (mouse) 1 1
MIRT636334 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 1
MIRT636711 ARSK arylsulfatase family, member K 1 2
MIRT636762 C17orf75 chromosome 17 open reading frame 75 1 1
MIRT636840 MBOAT1 membrane bound O-acyltransferase domain containing 1 1 2
MIRT636938 CCDC122 coiled-coil domain containing 122 1 1
MIRT637028 SPTLC3 serine palmitoyltransferase, long chain base subunit 3 1 1
MIRT637079 SELPLG selectin P ligand 1 1
MIRT637426 ZC3H12B zinc finger CCCH-type containing 12B 1 1
MIRT637959 NECAB3 N-terminal EF-hand calcium binding protein 3 1 1
MIRT638184 TLN1 talin 1 1 1
MIRT638344 RBMS2 RNA binding motif, single stranded interacting protein 2 1 2
MIRT638571 IER5 immediate early response 5 1 1
MIRT638607 HINT1 histidine triad nucleotide binding protein 1 1 1
MIRT638657 GGCX gamma-glutamyl carboxylase 1 1
MIRT638768 EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) 1 1
MIRT638773 EMC7 ER membrane protein complex subunit 7 1 1
MIRT639018 AAK1 AP2 associated kinase 1 1 1
MIRT639091 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT639575 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT639828 ZKSCAN1 zinc finger with KRAB and SCAN domains 1 1 1
MIRT640336 AP5B1 adaptor-related protein complex 5, beta 1 subunit 1 1
MIRT640568 CPE carboxypeptidase E 1 1
MIRT641826 TSC22D2 TSC22 domain family, member 2 1 1
MIRT642059 KCNK2 potassium channel, subfamily K, member 2 1 1
MIRT643080 PTPLAD2 protein tyrosine phosphatase-like A domain containing 2 1 1
MIRT643278 ZNF566 zinc finger protein 566 1 1
MIRT643443 LAX1 lymphocyte transmembrane adaptor 1 1 2
MIRT643866 COX20 COX20 Cox2 chaperone homolog (S. cerevisiae) 1 1
MIRT645034 ATAD3C ATPase family, AAA domain containing 3C 1 1
MIRT645089 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT645155 NOL9 nucleolar protein 9 1 1
MIRT645990 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646444 XRCC2 X-ray repair complementing defective repair in Chinese hamster cells 2 1 1
MIRT646505 FAM217B family with sequence similarity 217, member B 1 1
MIRT647713 NFX1 nuclear transcription factor, X-box binding 1 1 1
MIRT647978 PDE12 phosphodiesterase 12 1 1
MIRT648112 PTDSS2 phosphatidylserine synthase 2 1 1
MIRT649180 DNPEP aspartyl aminopeptidase 1 1
MIRT649311 IGSF6 immunoglobulin superfamily, member 6 1 1
MIRT649384 TMEM19 transmembrane protein 19 1 1
MIRT649625 EHD2 EH-domain containing 2 1 1
MIRT649716 TWSG1 twisted gastrulation homolog 1 (Drosophila) 1 1
MIRT649845 IRAK3 interleukin-1 receptor-associated kinase 3 1 1
MIRT650369 MOCS3 molybdenum cofactor synthesis 3 1 1
MIRT651349 ZBTB8B zinc finger and BTB domain containing 8B 1 2
MIRT651388 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT651610 WDFY2 WD repeat and FYVE domain containing 2 1 1
MIRT652860 TAB1 TGF-beta activated kinase 1/MAP3K7 binding protein 1 1 1
MIRT653271 SNAP29 synaptosomal-associated protein, 29kDa 1 1
MIRT653829 SHROOM3 shroom family member 3 1 1
MIRT654023 SAMD5 sterile alpha motif domain containing 5 1 1
MIRT654435 RASGRP3 RAS guanyl releasing protein 3 (calcium and DAG-regulated) 1 1
MIRT654489 RAD54L2 RAD54-like 2 (S. cerevisiae) 1 1
MIRT654642 PTAFR platelet-activating factor receptor 1 1
MIRT654712 PRR13 proline rich 13 1 1
MIRT655096 PHLDA3 pleckstrin homology-like domain, family A, member 3 1 1
MIRT655326 PCYOX1 prenylcysteine oxidase 1 1 1
MIRT655669 NUP43 nucleoporin 43kDa 1 1
MIRT655933 NDUFA4P1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa, pseudogene 1 1 1
MIRT657725 GPC4 glypican 4 1 1
MIRT658423 FAM177A1 family with sequence similarity 177, member A1 1 2
MIRT658703 EMC2 ER membrane protein complex subunit 2 1 1
MIRT658849 DUSP19 dual specificity phosphatase 19 1 1
MIRT658887 DRAXIN dorsal inhibitory axon guidance protein 1 1
MIRT659312 CSTF1 cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa 1 1
MIRT660234 BMP7 bone morphogenetic protein 7 1 1
MIRT661035 HIATL2 hippocampus abundant transcript-like 2 1 1
MIRT661045 RABAC1 Rab acceptor 1 (prenylated) 1 1
MIRT661236 ARL17B ADP-ribosylation factor-like 17B 1 1
MIRT661400 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT661501 EIF1AD eukaryotic translation initiation factor 1A domain containing 1 1
MIRT661659 ZNF623 zinc finger protein 623 1 1
MIRT661872 PDLIM5 PDZ and LIM domain 5 1 1
MIRT662783 CNNM3 cyclin M3 1 1
MIRT663096 THEM4 thioesterase superfamily member 4 1 1
MIRT663668 TMEM216 transmembrane protein 216 1 1
MIRT663971 ZNF786 zinc finger protein 786 1 1
MIRT664170 APOBEC3F apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F 1 1
MIRT664664 HEXA hexosaminidase A (alpha polypeptide) 1 1
MIRT664692 DBF4 DBF4 homolog (S. cerevisiae) 1 1
MIRT664759 MESDC2 mesoderm development candidate 2 1 1
MIRT664772 LIAS lipoic acid synthetase 1 1
MIRT664862 SLC19A3 solute carrier family 19, member 3 1 1
MIRT665091 CRIPT cysteine-rich PDZ-binding protein 1 1
MIRT665197 ESF1 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) 1 1
MIRT665344 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 1 1
MIRT665357 XKR4 XK, Kell blood group complex subunit-related family, member 4 1 1
MIRT665426 WDR55 WD repeat domain 55 1 1
MIRT665452 WDR17 WD repeat domain 17 1 1
MIRT665774 TMEM236 transmembrane protein 236 1 1
MIRT665902 TBCCD1 TBCC domain containing 1 1 1
MIRT666256 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 1
MIRT666709 RBL1 retinoblastoma-like 1 (p107) 1 1
MIRT667207 NIPAL1 NIPA-like domain containing 1 1 1
MIRT667223 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT667333 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like 1 1
MIRT667586 LONRF2 LON peptidase N-terminal domain and ring finger 2 1 1
MIRT667729 KIAA1456 KIAA1456 1 1
MIRT667907 ING1 inhibitor of growth family, member 1 1 1
MIRT667960 HEYL hairy/enhancer-of-split related with YRPW motif-like 1 1
MIRT668074 GMPS guanine monphosphate synthetase 1 1
MIRT668086 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668476 EXOSC2 exosome component 2 1 1
MIRT668507 ESYT2 extended synaptotagmin-like protein 2 1 1
MIRT668539 ERGIC1 endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 1 1
MIRT668639 DYNLL2 dynein, light chain, LC8-type 2 1 1
MIRT669319 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT669521 APOOL apolipoprotein O-like 1 1
MIRT669875 RAET1E retinoic acid early transcript 1E 1 1
MIRT669902 KIAA0754 KIAA0754 1 2
MIRT669986 SSR3 signal sequence receptor, gamma (translocon-associated protein gamma) 1 1
MIRT670217 BAZ2B bromodomain adjacent to zinc finger domain, 2B 1 1
MIRT670223 WIZ widely interspaced zinc finger motifs 1 1
MIRT670255 ZKSCAN3 zinc finger with KRAB and SCAN domains 3 1 1
MIRT670306 TAF8 TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa 1 1
MIRT670318 CEP57L1 centrosomal protein 57kDa-like 1 1 1
MIRT670394 KCNK5 potassium channel, subfamily K, member 5 1 1
MIRT670428 ELP2 elongator acetyltransferase complex subunit 2 1 1
MIRT670437 REPS2 RALBP1 associated Eps domain containing 2 1 1
MIRT670442 SYNRG synergin, gamma 1 1
MIRT670469 TMEM105 transmembrane protein 105 1 1
MIRT670504 LYRM4 LYR motif containing 4 1 1
MIRT670512 ZSCAN22 zinc finger and SCAN domain containing 22 1 1
MIRT670528 SLC9A7 solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7 1 1
MIRT670554 SHISA2 shisa homolog 2 (Xenopus laevis) 1 1
MIRT670638 BVES blood vessel epicardial substance 1 1
MIRT670656 STX4 syntaxin 4 1 1
MIRT670685 SUGT1 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) 1 2
MIRT670703 SLC16A13 solute carrier family 16, member 13 (monocarboxylic acid transporter 13) 1 1
MIRT670744 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT670798 UHRF1BP1L UHRF1 binding protein 1-like 1 1
MIRT670812 NICN1 nicolin 1 1 1
MIRT670843 SFT2D2 SFT2 domain containing 2 1 1
MIRT670976 MED17 mediator complex subunit 17 1 1
MIRT670996 PTGIS prostaglandin I2 (prostacyclin) synthase 1 1
MIRT671013 RBM22 RNA binding motif protein 22 1 1
MIRT671034 PCDHB2 protocadherin beta 2 1 1
MIRT671040 SS18 synovial sarcoma translocation, chromosome 18 1 1
MIRT671092 DNAJC3 DnaJ (Hsp40) homolog, subfamily C, member 3 1 1
MIRT671168 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 1 1
MIRT671222 CLSTN1 calsyntenin 1 1 1
MIRT671247 TMEM41B transmembrane protein 41B 1 1
MIRT671251 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT671287 RPL37A ribosomal protein L37a 1 1
MIRT671447 DNA2 DNA replication helicase 2 homolog (yeast) 1 2
MIRT671467 AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) 1 1
MIRT671574 FOSL2 FOS-like antigen 2 1 1
MIRT671595 CBY3 chibby homolog 3 (Drosophila) 1 1
MIRT671598 RILPL1 Rab interacting lysosomal protein-like 1 1 1
MIRT671609 C6orf25 chromosome 6 open reading frame 25 1 1
MIRT671637 FBXO36 F-box protein 36 1 1
MIRT671721 PMPCA peptidase (mitochondrial processing) alpha 1 1
MIRT671766 PLA2G4A phospholipase A2, group IVA (cytosolic, calcium-dependent) 1 1
MIRT671821 TRPM6 transient receptor potential cation channel, subfamily M, member 6 1 1
MIRT671831 STIL SCL/TAL1 interrupting locus 1 1
MIRT671853 APOL2 apolipoprotein L, 2 1 1
MIRT671888 MOB3A MOB kinase activator 3A 1 1
MIRT671912 PCDHB11 protocadherin beta 11 1 1
MIRT671922 PLEKHS1 pleckstrin homology domain containing, family S member 1 1 2
MIRT672028 ZNF70 zinc finger protein 70 1 1
MIRT672085 AEN apoptosis enhancing nuclease 1 1
MIRT672121 ATP6V0A2 ATPase, H+ transporting, lysosomal V0 subunit a2 1 1
MIRT672148 PLEKHH1 pleckstrin homology domain containing, family H (with MyTH4 domain) member 1 1 1
MIRT672168 FANCF Fanconi anemia, complementation group F 1 1
MIRT672205 ZNF490 zinc finger protein 490 1 1
MIRT672214 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672249 SIK2 salt-inducible kinase 2 1 1
MIRT672357 VPS8 vacuolar protein sorting 8 homolog (S. cerevisiae) 1 1
MIRT672365 PDE11A phosphodiesterase 11A 1 1
MIRT672455 POU2F3 POU class 2 homeobox 3 1 1
MIRT672519 CRX cone-rod homeobox 1 1
MIRT672544 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT672617 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT672722 S1PR2 sphingosine-1-phosphate receptor 2 1 1
MIRT672724 KIF18B kinesin family member 18B 1 1
MIRT672826 GJD3 gap junction protein, delta 3, 31.9kDa 1 1
MIRT672879 ZSCAN29 zinc finger and SCAN domain containing 29 1 1
MIRT672944 AKAP5 A kinase (PRKA) anchor protein 5 1 1
MIRT673004 TAF1 TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa 1 1
MIRT673027 RBBP4 retinoblastoma binding protein 4 1 1
MIRT673038 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT673070 AGO3 eukaryotic translation initiation factor 2C, 3 1 1
MIRT673383 ZNF124 zinc finger protein 124 1 1
MIRT673414 RBBP9 retinoblastoma binding protein 9 1 1
MIRT673420 RNF24 ring finger protein 24 1 1
MIRT673425 APAF1 apoptotic peptidase activating factor 1 1 1
MIRT673481 GTF3C6 general transcription factor IIIC, polypeptide 6, alpha 35kDa 1 1
MIRT673622 VCPIP1 valosin containing protein (p97)/p47 complex interacting protein 1 1 1
MIRT673629 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT673675 NUDCD2 NudC domain containing 2 1 1
MIRT673686 NDUFA7 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa 1 1
MIRT673709 SLU7 SLU7 splicing factor homolog (S. cerevisiae) 1 1
MIRT673735 TCF23 transcription factor 23 1 1
MIRT673786 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 1
MIRT673797 MALL mal, T-cell differentiation protein-like 1 1
MIRT673816 DARS aspartyl-tRNA synthetase 1 1
MIRT673969 INMT indolethylamine N-methyltransferase 1 1
MIRT674025 ANKRD9 ankyrin repeat domain 9 1 1
MIRT674257 ZNF284 zinc finger protein 284 1 1
MIRT674319 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 1
MIRT674456 ULK2 unc-51-like kinase 2 (C. elegans) 1 1
MIRT674549 GREB1 growth regulation by estrogen in breast cancer 1 1 1
MIRT674571 KIF3A kinesin family member 3A 1 1
MIRT674621 TRUB2 TruB pseudouridine (psi) synthase homolog 2 (E. coli) 1 1
MIRT674624 HECTD3 HECT domain containing E3 ubiquitin protein ligase 3 1 1
MIRT674837 GLRX2 glutaredoxin 2 1 1
MIRT674859 GINM1 glycoprotein integral membrane 1 1 1
MIRT674947 PEX2 peroxisomal biogenesis factor 2 1 1
MIRT675004 PPTC7 PTC7 protein phosphatase homolog (S. cerevisiae) 1 1
MIRT675028 SNX1 sorting nexin 1 1 1
MIRT675151 NDRG1 N-myc downstream regulated 1 1 1
MIRT675209 TTC9C tetratricopeptide repeat domain 9C 1 1
MIRT675427 CLEC7A C-type lectin domain family 7, member A 1 1
MIRT675450 SRP19 signal recognition particle 19kDa 1 1
MIRT675483 SLC1A2 solute carrier family 1 (glial high affinity glutamate transporter), member 2 1 2
MIRT675508 HSD17B12 hydroxysteroid (17-beta) dehydrogenase 12 1 1
MIRT675656 COL8A1 collagen, type VIII, alpha 1 1 1
MIRT675709 EMC3 ER membrane protein complex subunit 3 1 1
MIRT675759 RDH10 retinol dehydrogenase 10 (all-trans) 1 1
MIRT675872 ATP1B4 ATPase, Na+/K+ transporting, beta 4 polypeptide 1 1
MIRT675920 CYP51A1 cytochrome P450, family 51, subfamily A, polypeptide 1 1 1
MIRT675934 RAP2B RAP2B, member of RAS oncogene family 1 1
MIRT675945 NAV1 neuron navigator 1 1 1
MIRT676053 ATL3 atlastin GTPase 3 1 1
MIRT676277 ZNF260 zinc finger protein 260 1 1
MIRT676414 MRO maestro 1 1
MIRT676635 CDH7 cadherin 7, type 2 1 1
MIRT676822 TNFSF15 tumor necrosis factor (ligand) superfamily, member 15 1 1
MIRT676866 ZNF451 zinc finger protein 451 1 1
MIRT676985 ZNF708 zinc finger protein 708 1 1
MIRT677031 ZNF107 zinc finger protein 107 1 1
MIRT677310 CPSF2 cleavage and polyadenylation specific factor 2, 100kDa 1 1
MIRT677401 PCNP PEST proteolytic signal containing nuclear protein 1 1
MIRT677430 PDF peptide deformylase (mitochondrial) 1 1
MIRT677587 GATA6 GATA binding protein 6 1 1
MIRT677977 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 1 1
MIRT678135 KLLN killin, p53-regulated DNA replication inhibitor 1 1
MIRT678390 TMEM239 transmembrane protein 239 1 1
MIRT678398 MYPN myopalladin 1 1
MIRT678593 ANAPC16 anaphase promoting complex subunit 16 1 1
MIRT678675 SCUBE3 signal peptide, CUB domain, EGF-like 3 1 1
MIRT679058 RMDN1 family with sequence similarity 82, member B 1 1
MIRT679472 RHOF ras homolog family member F (in filopodia) 1 1
MIRT679591 HUS1 HUS1 checkpoint homolog (S. pombe) 1 1
MIRT680041 OSBPL2 oxysterol binding protein-like 2 1 1
MIRT680163 ZDHHC20 zinc finger, DHHC-type containing 20 1 1
MIRT680290 AKIP1 A kinase (PRKA) interacting protein 1 1 1
MIRT680342 ZNF281 zinc finger protein 281 1 1
MIRT681090 GSTO2 glutathione S-transferase omega 2 1 1
MIRT686602 TMEM70 transmembrane protein 70 1 1
MIRT687128 QPCTL glutaminyl-peptide cyclotransferase-like 1 1
MIRT687298 OTUD7B OTU domain containing 7B 1 1
MIRT689577 NUDT7 nudix (nucleoside diphosphate linked moiety X)-type motif 7 1 1
MIRT689820 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT695082 ZNF17 zinc finger protein 17 1 1
MIRT696483 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT697374 ZNF286B zinc finger protein 286B 1 1
MIRT698752 STK4 serine/threonine kinase 4 1 2
MIRT699564 SIT1 signaling threshold regulating transmembrane adaptor 1 1 1
MIRT700607 PRKCA protein kinase C, alpha 1 1
MIRT703925 EPG5 ectopic P-granules autophagy protein 5 homolog (C. elegans) 1 1
MIRT704352 DBR1 debranching enzyme homolog 1 (S. cerevisiae) 1 1
MIRT705787 ALDH6A1 aldehyde dehydrogenase 6 family, member A1 1 1
MIRT705927 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT710028 POLL polymerase (DNA directed), lambda 1 1
MIRT710253 LRRC10 leucine rich repeat containing 10 1 1
MIRT711298 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
MIRT711504 ESCO1 establishment of cohesion 1 homolog 1 (S. cerevisiae) 1 1
MIRT711640 LIPG lipase, endothelial 1 1
MIRT716157 RBM48 RNA binding motif protein 48 1 1
MIRT719195 CASP10 caspase 10, apoptosis-related cysteine peptidase 1 1
MIRT720517 KIAA0101 KIAA0101 1 1
MIRT722377 KAZALD1 Kazal-type serine peptidase inhibitor domain 1 1 1
MIRT723133 YPEL1 yippee-like 1 (Drosophila) 1 1
MIRT725288 NT5C1A 5'-nucleotidase, cytosolic IA 1 1
MIRT725568 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*