Accession ID: MIRT030439 [miRNA, hsa-miR-24-3p :: PDPK1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-24-1LinkOut: [miRBase ]
Synonyms MIR189, MIRN24-1, miR-24-1, miRNA24-1, MIR24-1
Description Homo sapiens miR-24-1 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-24-3p
Evidence Experimental
Experiments Cloned
Putative hsa-miR-24-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol PDPK1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms PDK1, PRO0461
Description 3-phosphoinositide dependent protein kinase-1
Transcript NM_002613    LinkOut: [ RefSeq ]
Other Transcripts NM_031268   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on PDPK1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of PDPK1
(miRNA target sites are highlighted)
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            ||||||||    |||:||| 
Target 5' tgGTTCCTGC----CTGGGCCt 3'
1696 - 1713 150.00 -22.60
             | || ||| | |||:||| 
1158 - 1179 147.00 -17.70
miRNA  3' gacaaggaCGACUUGACUCGGu 5'
                  | |||:|||:||| 
Target 5' tgagctggGGTGAGCTGGGCCg 3'
1755 - 1776 142.00 -23.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-24-3p :: PDPK1    [ Functional MTI ]
Validation Method Microarray
Article - Lal, A. Navarro, F. Maher, C. A. et al.
- Mol Cell, 2009
miR-24, upregulated during terminal differentiation of multiple lineages, inhibits cell-cycle progression. Antagonizing miR-24 restores postmitotic cell proliferation and enhances fibroblast proliferation, whereas overexpressing miR-24 increases the G1 compartment. The 248 mRNAs downregulated upon miR-24 overexpression are highly enriched for DNA repair and cell-cycle regulatory genes that form a direct interaction network with prominent nodes at genes that enhance (MYC, E2F2, CCNB1, and CDC2) or inhibit (p27Kip1 and VHL) cell-cycle progression. miR-24 directly regulates MYC and E2F2 and some genes that they transactivate. Enhanced proliferation from antagonizing miR-24 is abrogated by knocking down E2F2, but not MYC, and cell proliferation, inhibited by miR-24 overexpression, is rescued by miR-24-insensitive E2F2. Therefore, E2F2 is a critical miR-24 target. The E2F2 3'UTR lacks a predicted miR-24 recognition element. In fact, miR-24 regulates expression of E2F2, MYC, AURKB, CCNA2, CDC2, CDK4, and FEN1 by recognizing seedless but highly complementary sequences.
LinkOut: [PMID: 19748357]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-24-3p :: PDPK1    [ Functional MTI ]
Validation Method
Article - Karginov, F. V. Hannon, G. J.
- Genes Dev, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084046
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000282077.3 | 3UTR | CUCUGAAAGUGCUGGGAUUACAGGCGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile:

MiRNA-Target Expression Profile(TCGA):

MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
803 hsa-miR-24-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000116 FEN1 flap structure-specific endonuclease 1 5 1
MIRT000117 CDK4 cyclin-dependent kinase 4 5 1
MIRT000119 CCNA2 cyclin A2 5 1
MIRT000120 AURKB aurora kinase B 5 1
MIRT000121 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 5 1
MIRT000122 E2F2 E2F transcription factor 2 5 1
MIRT001773 NOTCH1 notch 1 2 2
MIRT002018 DHFR dihydrofolate reductase 5 3
MIRT002950 MAPK14 mitogen-activated protein kinase 14 2 1
MIRT003354 TRIB3 tribbles homolog 3 (Drosophila) 5 4
MIRT003355 HNF4A hepatocyte nuclear factor 4, alpha 5 2
MIRT003830 ACVR1B activin A receptor, type IB 4 4
MIRT003889 MLEC malectin 3 2
MIRT004362 CDKN2A cyclin-dependent kinase inhibitor 2A 4 1
MIRT004836 BRCA1 breast cancer 1, early onset 5 2
MIRT004837 POLD1 polymerase (DNA directed), delta 1, catalytic subunit 5 1
MIRT005063 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 6 5
MIRT005397 KHSRP KH-type splicing regulatory protein 2 2
MIRT005398 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 2 2
MIRT005766 DND1 dead end homolog 1 (zebrafish) 3 1
MIRT005918 TGFB1 transforming growth factor, beta 1 4 1
MIRT005919 FURIN furin (paired basic amino acid cleaving enzyme) 4 2
MIRT006507 FAF1 Fas (TNFRSF6) associated factor 1 2 1
MIRT007012 ZNF217 zinc finger protein 217 2 2
MIRT007215 ST7L suppression of tumorigenicity 7 like 3 1
MIRT030361 VRK1 vaccinia related kinase 1 1 1
MIRT030362 NOP56 NOP56 ribonucleoprotein homolog (yeast) 1 1
MIRT030363 TBPL1 TBP-like 1 1 1
MIRT030364 TNPO3 transportin 3 2 3
MIRT030365 SNRPB2 small nuclear ribonucleoprotein polypeptide B 1 1
MIRT030366 DDHD2 DDHD domain containing 2 1 1
MIRT030367 THOP1 thimet oligopeptidase 1 1 1
MIRT030368 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT030369 UBE2C ubiquitin-conjugating enzyme E2C 1 1
MIRT030370 GNPAT glyceronephosphate O-acyltransferase 1 1
MIRT030371 METAP2 methionyl aminopeptidase 2 1 1
MIRT030372 KIAA0020 KIAA0020 1 1
MIRT030373 UGDH UDP-glucose 6-dehydrogenase 2 3
MIRT030374 URM1 ubiquitin related modifier 1 1 1
MIRT030375 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT030376 MED22 mediator complex subunit 22 1 1
MIRT030377 USP10 ubiquitin specific peptidase 10 1 1
MIRT030378 FKBP1B FK506 binding protein 1B, 12.6 kDa 1 1
MIRT030379 SCML1 sex comb on midleg-like 1 (Drosophila) 1 1
MIRT030380 CNDP2 CNDP dipeptidase 2 (metallopeptidase M20 family) 2 1
MIRT030381 MCM10 minichromosome maintenance complex component 10 2 1
MIRT030382 TOP1 topoisomerase (DNA) I 2 1
MIRT030383 H2AFX H2A histone family, member X 4 3
MIRT030384 TOMM22 translocase of outer mitochondrial membrane 22 homolog (yeast) 1 1
MIRT030385 HBQ1 hemoglobin, theta 1 1 1
MIRT030386 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT030387 PSMD1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 2 2
MIRT030388 AUNIP aurora kinase A and ninein interacting protein 1 1
MIRT030389 NARF nuclear prelamin A recognition factor 1 1
MIRT030390 MALSU1 mitochondrial assembly of ribosomal large subunit 1 1 1
MIRT030391 TCEA3 transcription elongation factor A (SII), 3 1 1
MIRT030392 ADRM1 adhesion regulating molecule 1 1 1
MIRT030393 AGFG1 ArfGAP with FG repeats 1 1 1
MIRT030394 ACD adrenocortical dysplasia homolog (mouse) 1 1
MIRT030395 RCE1 RCE1 homolog, prenyl protein protease (S. cerevisiae) 1 1
MIRT030396 SUMO3 SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae) 1 1
MIRT030397 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 2 2
MIRT030398 C18orf56 chromosome 18 open reading frame 56 1 1
MIRT030399 MIS18A MIS18 kinetochore protein homolog A (S. pombe) 1 1
MIRT030400 GLYR1 glyoxylate reductase 1 homolog (Arabidopsis) 1 1
MIRT030401 NAE1 NEDD8 activating enzyme E1 subunit 1 1 1
MIRT030402 ACTL6A actin-like 6A 1 1
MIRT030403 NCBP2 nuclear cap binding protein subunit 2, 20kDa 1 1
MIRT030404 SLC29A4 solute carrier family 29 (nucleoside transporters), member 4 1 1
MIRT030405 PHF16 PHD finger protein 16 1 1
MIRT030406 GYG2 glycogenin 2 1 1
MIRT030407 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 1
MIRT030408 EXOSC8 exosome component 8 1 1
MIRT030409 TDRP chromosome 8 open reading frame 42 1 1
MIRT030410 R3HDM4 R3H domain containing 4 1 1
MIRT030411 DCAF4 DDB1 and CUL4 associated factor 4 1 1
MIRT030412 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT030413 VPS25 vacuolar protein sorting 25 homolog (S. cerevisiae) 1 1
MIRT030414 NR0B2 nuclear receptor subfamily 0, group B, member 2 1 1
MIRT030415 NASP nuclear autoantigenic sperm protein (histone-binding) 1 1
MIRT030416 STRADB STE20-related kinase adaptor beta 1 1
MIRT030417 MTF2 metal response element binding transcription factor 2 1 1
MIRT030418 PHOSPHO2 phosphatase, orphan 2 1 1
MIRT030419 ATAD3A ATPase family, AAA domain containing 3A 1 1
MIRT030420 CCDC59 coiled-coil domain containing 59 2 2
MIRT030421 VPS35 vacuolar protein sorting 35 homolog (S. cerevisiae) 1 1
MIRT030422 PAF1 Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) 1 1
MIRT030423 CIRBP cold inducible RNA binding protein 1 1
MIRT030424 S100P S100 calcium binding protein P 1 1
MIRT030425 ARHGEF7 Rho guanine nucleotide exchange factor (GEF) 7 1 1
MIRT030426 PROSER1 proline and serine rich 1 1 1
MIRT030427 PDLIM7 PDZ and LIM domain 7 (enigma) 1 1
MIRT030428 KIAA0100 KIAA0100 1 1
MIRT030429 TOMM34 translocase of outer mitochondrial membrane 34 1 1
MIRT030430 CTCF CCCTC-binding factor (zinc finger protein) 1 1
MIRT030431 EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 1 1
MIRT030432 SLC52A2 solute carrier family 52, riboflavin transporter, member 2 1 1
MIRT030433 KHNYN KH and NYN domain containing 1 1
MIRT030434 ADD1 adducin 1 (alpha) 1 1
MIRT030435 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT030436 KLHL23 kelch-like 23 (Drosophila) 1 1
MIRT030437 SULT2A1 sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 1 1
MIRT030438 LSM12 LSM12 homolog (S. cerevisiae) 1 1
MIRT030439 PDPK1 3-phosphoinositide dependent protein kinase-1 2 2
MIRT030440 CARD10 caspase recruitment domain family, member 10 1 1
MIRT030441 PPM1F protein phosphatase, Mg2+/Mn2+ dependent, 1F 1 1
MIRT030442 NRIP1 nuclear receptor interacting protein 1 1 1
MIRT030443 ARHGEF18 Rho/Rac guanine nucleotide exchange factor (GEF) 18 1 1
MIRT030444 FNTB farnesyltransferase, CAAX box, beta 1 1
MIRT030445 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 3 3
MIRT030446 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT030447 BCL2L2 BCL2-like 2 1 1
MIRT030448 PSTPIP2 proline-serine-threonine phosphatase interacting protein 2 1 1
MIRT030449 ACACA acetyl-CoA carboxylase alpha 1 1
MIRT030450 MATR3 matrin 3 2 2
MIRT030451 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT030452 TSPAN14 tetraspanin 14 1 1
MIRT030453 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT030454 MIDN midnolin 1 1
MIRT030455 CCDC58 coiled-coil domain containing 58 1 1
MIRT030456 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT030457 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT030458 ZNF813 zinc finger protein 813 1 1
MIRT030459 MAGI1 membrane associated guanylate kinase, WW and PDZ domain containing 1 1 1
MIRT030460 ZCCHC14 zinc finger, CCHC domain containing 14 1 1
MIRT030461 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT030462 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT030463 DNAJB12 DnaJ (Hsp40) homolog, subfamily B, member 12 1 1
MIRT030464 NUP54 nucleoporin 54kDa 2 2
MIRT030465 SESN1 sestrin 1 2 2
MIRT030466 SLC35B2 solute carrier family 35, member B2 2 2
MIRT030467 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 2 2
MIRT030468 UBD ubiquitin D 2 1
MIRT030469 RRM2 ribonucleotide reductase M2 2 1
MIRT030470 BCL2L12 BCL2-like 12 (proline rich) 2 1
MIRT030471 MBD6 methyl-CpG binding domain protein 6 2 1
MIRT030472 OXSR1 oxidative-stress responsive 1 1 1
MIRT030473 PER2 period homolog 2 (Drosophila) 2 1
MIRT030474 UNG uracil-DNA glycosylase 1 1
MIRT030475 RRP12 ribosomal RNA processing 12 homolog (S. cerevisiae) 1 1
MIRT030476 CWC27 CWC27 spliceosome-associated protein homolog (S. cerevisiae) 1 1
MIRT030477 SRRT serrate RNA effector molecule homolog (Arabidopsis) 1 1
MIRT030478 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 1 1
MIRT030479 EXOSC3 exosome component 3 1 1
MIRT030480 ALG5 asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) 1 1
MIRT030481 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT030482 MRPS24 mitochondrial ribosomal protein S24 1 1
MIRT030483 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 3 3
MIRT030484 GTF3C2 general transcription factor IIIC, polypeptide 2, beta 110kDa 1 1
MIRT030485 FAH fumarylacetoacetate hydrolase (fumarylacetoacetase) 1 1
MIRT030486 ARL1 ADP-ribosylation factor-like 1 1 1
MIRT030487 MED16 mediator complex subunit 16 2 2
MIRT030488 MED24 mediator complex subunit 24 1 1
MIRT030489 CCAR1 cell division cycle and apoptosis regulator 1 1 1
MIRT030490 DUS1L dihydrouridine synthase 1-like (S. cerevisiae) 1 1
MIRT030491 BEX1 brain expressed, X-linked 1 1 1
MIRT030492 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT030493 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT030494 DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) 1 1
MIRT030495 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 1 1
MIRT030496 UBE3A ubiquitin protein ligase E3A 1 1
MIRT030497 TYW3 tRNA-yW synthesizing protein 3 homolog (S. cerevisiae) 1 1
MIRT030498 UQCC ubiquinol-cytochrome c reductase complex chaperone 1 1
MIRT030499 NKD1 naked cuticle homolog 1 (Drosophila) 1 1
MIRT030500 NFKBIA nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha 1 1
MIRT030501 AK3 adenylate kinase 3 1 1
MIRT030502 NSA2 NSA2 ribosome biogenesis homolog (S. cerevisiae) 1 1
MIRT030503 CDK1 cyclin-dependent kinase 1 5 1
MIRT030504 HSF2 heat shock transcription factor 2 1 1
MIRT030505 CDCA7 cell division cycle associated 7 1 1
MIRT030506 NCOA6 nuclear receptor coactivator 6 1 1
MIRT030507 TNIP2 TNFAIP3 interacting protein 2 1 1
MIRT030508 AKAP7 A kinase (PRKA) anchor protein 7 1 1
MIRT030509 TUBGCP2 tubulin, gamma complex associated protein 2 1 1
MIRT030510 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 2 2
MIRT030511 FBXO34 F-box protein 34 1 1
MIRT030512 STK35 serine/threonine kinase 35 1 1
MIRT030513 CTDSP2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 1 1
MIRT030514 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT030515 ZDHHC3 zinc finger, DHHC-type containing 3 1 1
MIRT030516 IQCB1 IQ motif containing B1 1 1
MIRT030517 RHOT2 ras homolog family member T2 1 1
MIRT030518 ALDH5A1 aldehyde dehydrogenase 5 family, member A1 1 1
MIRT030519 VHL von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase 1 1
MIRT030520 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT030521 GBAS glioblastoma amplified sequence 1 1
MIRT030522 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 1
MIRT030523 NEK6 NIMA (never in mitosis gene a)-related kinase 6 1 1
MIRT030524 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT030525 GGA2 golgi-associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT030526 ADPGK ADP-dependent glucokinase 1 1
MIRT030527 DSCR3 Down syndrome critical region gene 3 1 1
MIRT030528 FZD4 frizzled family receptor 4 1 1
MIRT030529 AAMP angio-associated, migratory cell protein 1 1
MIRT030530 PLIN3 perilipin 3 1 1
MIRT030531 LLGL1 lethal giant larvae homolog 1 (Drosophila) 2 3
MIRT030532 KLHDC3 kelch domain containing 3 1 1
MIRT030533 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT030534 MARCKSL1 MARCKS-like 1 2 2
MIRT030535 C1orf106 chromosome 1 open reading frame 106 2 2
MIRT030536 ADD3 adducin 3 (gamma) 1 1
MIRT030537 SNTB1 syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1) 1 1
MIRT030538 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT030539 TMTC4 transmembrane and tetratricopeptide repeat containing 4 1 1
MIRT030540 GLUL glutamate-ammonia ligase 1 1
MIRT030541 TMEM209 transmembrane protein 209 1 1
MIRT030542 LBR lamin B receptor 1 1
MIRT030543 LIMD1 LIM domains containing 1 1 1
MIRT030544 SPIN4 spindlin family, member 4 1 1
MIRT030545 ZNF264 zinc finger protein 264 1 3
MIRT030546 VGLL3 vestigial like 3 (Drosophila) 1 1
MIRT030547 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 6
MIRT030548 DEDD death effector domain containing 1 1
MIRT030549 CD34 CD34 molecule 1 1
MIRT030550 TMED7 transmembrane emp24 protein transport domain containing 7 1 1
MIRT030551 E2F3 E2F transcription factor 3 2 1
MIRT030552 ZNF317 zinc finger protein 317 2 1
MIRT030553 STX16 syntaxin 16 2 1
MIRT030554 DHFRP1 dihydrofolate reductase pseudogene 1 1 1
MIRT030555 CHEK1 checkpoint kinase 1 4 1
MIRT030556 NOTUM notum pectinacetylesterase homolog (Drosophila) 1 1
MIRT030557 ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 1 1
MIRT030558 CCL2 chemokine (C-C motif) ligand 2 1 1
MIRT030559 OARD1 O-acyl-ADP-ribose deacylase 1 1 1
MIRT030560 PCGF6 polycomb group ring finger 6 1 1
MIRT030561 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 18kDa 2 2
MIRT030562 CTDSP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 1 1
MIRT030563 MAK16 MAK16 homolog (S. cerevisiae) 1 1
MIRT030564 RNF144A ring finger protein 144A 1 1
MIRT030565 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT030566 C15orf57 chromosome 15 open reading frame 57 1 1
MIRT030567 COMMD9 COMM domain containing 9 1 1
MIRT030568 SLC25A15 solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 1 1
MIRT030569 NOP14 NOP14 nucleolar protein homolog (yeast) 1 1
MIRT030570 CHD8 chromodomain helicase DNA binding protein 8 1 1
MIRT030571 OGFR opioid growth factor receptor 1 1
MIRT030572 ALG1 asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT030573 PCK2 phosphoenolpyruvate carboxykinase 2 (mitochondrial) 1 1
MIRT030574 SERGEF secretion regulating guanine nucleotide exchange factor 1 1
MIRT030575 ANPEP alanyl (membrane) aminopeptidase 1 1
MIRT030576 ITFG3 integrin alpha FG-GAP repeat containing 3 1 1
MIRT030577 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 1 1
MIRT030578 PRKRIR protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) 1 1
MIRT030579 AP5M1 adaptor-related protein complex 5, mu 1 subunit 1 1
MIRT030580 HMGB2 high mobility group box 2 1 1
MIRT030581 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 1 1
MIRT030582 CSTF3 cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa 1 1
MIRT030583 FOXQ1 forkhead box Q1 1 1
MIRT030584 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT030585 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT030586 ZMYND19 zinc finger, MYND-type containing 19 1 1
MIRT030587 CHFR checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase 1 1
MIRT030588 CCNB1 cyclin B1 1 1
MIRT030589 ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 2 2
MIRT030590 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase 1 1
MIRT030591 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 2 2
MIRT030592 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 1 1
MIRT030593 MRPL27 mitochondrial ribosomal protein L27 1 1
MIRT030594 COPS7A COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) 1 1
MIRT030595 DSC2 desmocollin 2 1 1
MIRT030596 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT030597 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT030598 KIAA0195 KIAA0195 1 1
MIRT030599 KIAA1967 KIAA1967 1 1
MIRT030600 HIC2 hypermethylated in cancer 2 1 1
MIRT030601 DTL denticleless E3 ubiquitin protein ligase homolog (Drosophila) 1 1
MIRT030602 NUBPL nucleotide binding protein-like 1 1
MIRT030603 GMFB glia maturation factor, beta 1 1
MIRT030604 PLAGL2 pleiomorphic adenoma gene-like 2 2 2
MIRT030605 CMTM3 CKLF-like MARVEL transmembrane domain containing 3 1 1
MIRT030606 CSK c-src tyrosine kinase 1 1
MIRT030607 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 1 1
MIRT030608 MRPS22 mitochondrial ribosomal protein S22 1 1
MIRT030609 RFWD2 ring finger and WD repeat domain 2, E3 ubiquitin protein ligase 1 1
MIRT030610 NET1 neuroepithelial cell transforming 1 1 1
MIRT030611 GUCD1 chromosome 22 open reading frame 13 2 3
MIRT030612 RALA v-ral simian leukemia viral oncogene homolog A (ras related) 1 1
MIRT030613 AK4 adenylate kinase 4 1 1
MIRT030614 KCNJ14 potassium inwardly-rectifying channel, subfamily J, member 14 1 1
MIRT030615 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT030616 BRD8 bromodomain containing 8 1 1
MIRT030617 PIM2 pim-2 oncogene 1 1
MIRT030618 GFOD1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT030619 HDAC1 histone deacetylase 1 1 1
MIRT030620 WRB tryptophan rich basic protein 1 1
MIRT030621 TMEM194A transmembrane protein 194A 1 1
MIRT030622 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT030623 RNF11 ring finger protein 11 1 1
MIRT030624 RNF2 ring finger protein 2 1 2
MIRT030625 FZD5 frizzled family receptor 5 1 1
MIRT030626 E2F1 E2F transcription factor 1 1 1
MIRT030627 CORO1A coronin, actin binding protein, 1A 1 1
MIRT030628 UBC ubiquitin C 1 1
MIRT030629 MCM4 minichromosome maintenance complex component 4 2 1
MIRT030630 PDXK pyridoxal (pyridoxine, vitamin B6) kinase 2 2
MIRT030631 PCNA proliferating cell nuclear antigen 3 1
MIRT035526 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT035527 PTPRF protein tyrosine phosphatase, receptor type, F 1 1
MIRT035542 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT035543 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT050365 RPS7 ribosomal protein S7 1 1
MIRT050366 EXOSC1 exosome component 1 1 1
MIRT050367 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT050368 RANBP1 RAN binding protein 1 1 1
MIRT050369 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT050370 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT050371 RPS16 ribosomal protein S16 1 1
MIRT050372 DEPDC1 DEP domain containing 1 1 1
MIRT050373 DDX5 DEAD (Asp-Glu-Ala-Asp) box helicase 5 1 1
MIRT050374 BCL7A B-cell CLL/lymphoma 7A 1 1
MIRT050375 SNX12 sorting nexin 12 1 1
MIRT050376 GORASP2 golgi reassembly stacking protein 2, 55kDa 1 1
MIRT050377 RIF1 RAP1 interacting factor homolog (yeast) 1 2
MIRT050378 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT050379 CCNG1 cyclin G1 1 1
MIRT050380 IKBKAP inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein 1 1
MIRT050381 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT050382 GCLM glutamate-cysteine ligase, modifier subunit 1 1
MIRT050383 DCAF10 DDB1 and CUL4 associated factor 10 1 1
MIRT052941 Furin furin (paired basic amino acid cleaving enzyme) 2 1
MIRT052953 S100A8 S100 calcium binding protein A8 2 1
MIRT053042 MXI1 MAX interactor 1 3 1
MIRT053061 XIAP X-linked inhibitor of apoptosis 4 2
MIRT053134 NOS3 nitric oxide synthase 3 (endothelial cell) 3 1
MIRT053161 INSIG1 insulin induced gene 1 3 4
MIRT053238 CYP11B2 cytochrome P450, family 11, subfamily B, polypeptide 2 2 1
MIRT053779 REG4 regenerating islet-derived family, member 4 3 1
MIRT054288 MEN1 multiple endocrine neoplasia I 4 2
MIRT054320 LDHA lactate dehydrogenase A 3 2
MIRT054323 LDHB lactate dehydrogenase B 2 1
MIRT054386 JPH2 junctophilin 2 2 2
MIRT054393 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT054474 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 1
MIRT054710 SSSCA1 Sjogren syndrome/scleroderma autoantigen 1 3 1
MIRT054754 HMOX1 heme oxygenase (decycling) 1 2 1
MIRT054828 PSAP prosaposin 4 1
MIRT115232 ABHD2 abhydrolase domain containing 2 1 1
MIRT123977 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT196600 TAOK1 TAO kinase 1 1 1
MIRT249228 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT256046 UBE2K ubiquitin-conjugating enzyme E2K 1 2
MIRT324457 ASB6 ankyrin repeat and SOCS box containing 6 1 1
MIRT327634 ZXDB zinc finger, X-linked, duplicated B 1 3
MIRT352061 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT395244 MT1E metallothionein 1E 1 1
MIRT437500 MMP14 matrix metallopeptidase 14 (membrane-inserted) 1 1
MIRT437826 AGPAT2 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) 1 1
MIRT437970 IFNG interferon, gamma 3 1
MIRT438418 FGFR3 fibroblast growth factor receptor 3 4 1
MIRT438421 TACC3 transforming, acidic coiled-coil containing protein 3 4 1
MIRT438424 MAFB v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) 4 1
MIRT438427 CCND1 cyclin D1 4 1
MIRT438454 NCSTN nicastrin 1 1
MIRT438533 IFNR interferon production regulator 2 1
MIRT438608 WNT4 wingless-type MMTV integration site family, member 4 1 1
MIRT438644 NDST1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 3 1
MIRT447723 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT447760 TTLL7 tubulin tyrosine ligase-like family, member 7 1 1
MIRT455064 ARHGAP39 Rho GTPase activating protein 39 1 1
MIRT455750 YRDC yrdC domain containing (E. coli) 1 1
MIRT457051 NEGR1 neuronal growth regulator 1 1 2
MIRT458116 TMEM173 transmembrane protein 173 1 1
MIRT458530 HKR1 HKR1, GLI-Kruppel zinc finger family member 1 1
MIRT462325 SETX senataxin 1 1
MIRT464501 UCK2 uridine-cytidine kinase 2 1 1
MIRT465466 TOR2A torsin family 2, member A 1 1
MIRT471227 PHAX phosphorylated adaptor for RNA export 1 1
MIRT476066 GRINA glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) 1 1
MIRT476461 GBA2 glucosidase, beta (bile acid) 2 1 1
MIRT476706 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT476916 FBLIM1 filamin binding LIM protein 1 1 2
MIRT477425 EMP1 epithelial membrane protein 1 1 1
MIRT477908 DVL3 dishevelled, dsh homolog 3 (Drosophila) 1 2
MIRT478339 DDN dendrin 1 1
MIRT478801 CRTAP cartilage associated protein 1 2
MIRT479899 CCDC117 coiled-coil domain containing 117 1 1
MIRT480435 C17orf49 chromosome 17 open reading frame 49 1 1
MIRT481095 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 1
MIRT481990 AMOTL2 angiomotin like 2 1 1
MIRT486982 STEAP3 STEAP family member 3, metalloreductase 1 2
MIRT489236 CLN8 ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation) 1 2
MIRT490739 SRCIN1 SRC kinase signaling inhibitor 1 1 1
MIRT492019 UGCG UDP-glucose ceramide glucosyltransferase 1 1
MIRT493589 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 3
MIRT494058 DUSP7 dual specificity phosphatase 7 1 1
MIRT499970 NCOA5 nuclear receptor coactivator 5 1 1
MIRT501272 NHS Nance-Horan syndrome (congenital cataracts and dental anomalies) 1 2
MIRT501542 POGZ pogo transposable element with ZNF domain 1 1
MIRT527694 IL17REL interleukin 17 receptor E-like 1 1
MIRT527729 TMEM241 transmembrane protein 241 1 1
MIRT528420 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT528870 ATF3 activating transcription factor 3 1 1
MIRT530340 GABRB3 gamma-aminobutyric acid (GABA) A receptor, beta 3 1 1
MIRT540115 KLF17 Kruppel-like factor 17 1 1
MIRT540603 CD3D CD3d molecule, delta (CD3-TCR complex) 1 2
MIRT540636 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 1
MIRT541054 SEPHS1 selenophosphate synthetase 1 1 1
MIRT541713 TMEM33 transmembrane protein 33 1 1
MIRT541847 PLIN5 perilipin 5 1 1
MIRT541892 LY6G5B lymphocyte antigen 6 complex, locus G5B 1 1
MIRT542947 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT545431 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT549513 HDDC2 HD domain containing 2 1 1
MIRT556737 KLHL15 kelch-like 15 (Drosophila) 1 2
MIRT559280 AURKA aurora kinase A 1 1
MIRT564581 ZXDA zinc finger, X-linked, duplicated A 1 1
MIRT571909 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 2
MIRT575280 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT607045 IDS iduronate 2-sulfatase 1 1
MIRT607713 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT608083 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2 1 1
MIRT609645 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT610567 HIST3H2BB histone cluster 3, H2bb 1 1
MIRT611112 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 1
MIRT613671 KIAA1210 KIAA1210 1 1
MIRT615060 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT617926 ZNF783 zinc finger family member 783 1 1
MIRT618465 GPR55 G protein-coupled receptor 55 1 1
MIRT619409 NTPCR nucleoside-triphosphatase, cancer-related 1 1
MIRT620694 RFTN2 raftlin family member 2 1 1
MIRT620921 LRRTM2 leucine rich repeat transmembrane neuronal 2 1 1
MIRT621035 POLA2 polymerase (DNA directed), alpha 2, accessory subunit 1 1
MIRT622583 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT623371 LRIG2 leucine-rich repeats and immunoglobulin-like domains 2 1 1
MIRT623402 LEPROTL1 leptin receptor overlapping transcript-like 1 1 1
MIRT625024 ZNF730 zinc finger protein 730 1 1
MIRT625113 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 2
MIRT625326 TNFRSF13B tumor necrosis factor receptor superfamily, member 13B 1 1
MIRT625414 IMP4 IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) 1 1
MIRT625832 NXPE2 neurexophilin and PC-esterase domain family, member 2 1 1
MIRT625899 LINC00632 uncharacterized LOC286411 1 1
MIRT626169 DNAJB13 DnaJ (Hsp40) homolog, subfamily B, member 13 1 1
MIRT626607 ACAA2 acetyl-CoA acyltransferase 2 1 1
MIRT626675 CISD2 CDGSH iron sulfur domain 2 1 1
MIRT626815 PRR11 proline rich 11 1 1
MIRT626828 ZNF430 zinc finger protein 430 1 1
MIRT627784 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT628137 HM13 histocompatibility (minor) 13 1 1
MIRT628610 ZBTB3 zinc finger and BTB domain containing 3 1 1
MIRT628683 TRAF3IP1 TNF receptor-associated factor 3 interacting protein 1 1 1
MIRT628787 GSDMA gasdermin A 1 1
MIRT628858 KCNE4 potassium voltage-gated channel, Isk-related family, member 4 1 1
MIRT629019 OSBPL10 oxysterol binding protein-like 10 1 1
MIRT629125 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 2
MIRT629200 PAPOLA poly(A) polymerase alpha 1 1
MIRT629207 ZNF878 zinc finger protein 878 1 1
MIRT629234 CINP cyclin-dependent kinase 2 interacting protein 1 1
MIRT629398 CRCP CGRP receptor component 1 1
MIRT629517 ULBP3 UL16 binding protein 3 1 2
MIRT629559 EMP2 epithelial membrane protein 2 1 1
MIRT629570 PIGR polymeric immunoglobulin receptor 1 1
MIRT629748 SCD5 stearoyl-CoA desaturase 5 1 1
MIRT629797 GPR82 G protein-coupled receptor 82 1 1
MIRT629813 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa 1 1
MIRT629833 CCL16 chemokine (C-C motif) ligand 16 1 1
MIRT629907 SPATA5 spermatogenesis associated 5 1 1
MIRT629982 NARS asparaginyl-tRNA synthetase 1 1
MIRT630004 PDE6B phosphodiesterase 6B, cGMP-specific, rod, beta 1 1
MIRT630034 MTL5 metallothionein-like 5, testis-specific (tesmin) 1 1
MIRT630075 GRWD1 glutamate-rich WD repeat containing 1 1 1
MIRT630136 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT630208 SVIP small VCP/p97-interacting protein 1 1
MIRT630219 SORD sorbitol dehydrogenase 1 1
MIRT630250 SMTNL2 smoothelin-like 2 1 1
MIRT630295 PRICKLE1 prickle homolog 1 (Drosophila) 1 1
MIRT630400 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT630411 MOB1A MOB kinase activator 1A 1 1
MIRT630436 KIF1C kinesin family member 1C 1 1
MIRT630475 DTD2 D-tyrosyl-tRNA deacylase 2 (putative) 1 1
MIRT630517 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT630809 XPNPEP3 X-prolyl aminopeptidase (aminopeptidase P) 3, putative 1 1
MIRT630819 YTHDC1 YTH domain containing 1 1 1
MIRT630833 ZNF621 zinc finger protein 621 1 1
MIRT630913 ZMAT2 zinc finger, matrin-type 2 1 1
MIRT631166 APTX aprataxin 1 1
MIRT631210 DENND6B DENN/MADD domain containing 6B 1 1
MIRT631569 TRAF3IP2 TRAF3 interacting protein 2 1 1
MIRT631648 C19orf35 chromosome 19 open reading frame 35 1 1
MIRT631698 C1QTNF6 C1q and tumor necrosis factor related protein 6 1 1
MIRT631755 MINOS1 mitochondrial inner membrane organizing system 1 1 1
MIRT631997 POPDC2 popeye domain containing 2 1 1
MIRT632015 TAF1B TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa 1 1
MIRT632034 SPPL2A signal peptide peptidase like 2A 1 1
MIRT632219 YME1L1 YME1-like 1 (S. cerevisiae) 1 1
MIRT632351 STRN3 striatin, calmodulin binding protein 3 1 1
MIRT632358 SRRD SRR1 domain containing 1 1
MIRT632426 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT632456 SGTB small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta 1 1
MIRT632493 RBM3 RNA binding motif (RNP1, RRM) protein 3 1 1
MIRT632631 PARP2 poly (ADP-ribose) polymerase 2 1 1
MIRT632637 OSMR oncostatin M receptor 1 1
MIRT632718 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 1
MIRT632753 MED28 mediator complex subunit 28 1 1
MIRT632761 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT632841 IGF1 insulin-like growth factor 1 (somatomedin C) 1 1
MIRT633144 C4orf32 chromosome 4 open reading frame 32 1 1
MIRT633162 C11orf84 chromosome 11 open reading frame 84 1 1
MIRT633256 ZNF581 zinc finger protein 581 1 1
MIRT633260 ZNF556 zinc finger protein 556 1 1
MIRT633305 LINC00346 long intergenic non-protein coding RNA 346 1 1
MIRT633327 PRPF6 PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) 1 1
MIRT633336 GRK4 G protein-coupled receptor kinase 4 1 1
MIRT633354 TFDP2 transcription factor Dp-2 (E2F dimerization partner 2) 1 1
MIRT633460 DSN1 DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT633498 ERO1L ERO1-like (S. cerevisiae) 1 1
MIRT633534 PGBD5 piggyBac transposable element derived 5 1 1
MIRT633621 R3HDM2 R3H domain containing 2 1 1
MIRT633748 MCM9 minichromosome maintenance complex component 9 1 1
MIRT633874 ATP6V1A ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A 1 1
MIRT634001 SSR1 signal sequence receptor, alpha 1 1
MIRT634106 ZNF8 zinc finger protein 8 1 1
MIRT634121 ZMYM1 zinc finger, MYM-type 1 1 2
MIRT634135 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT634182 TXNDC16 thioredoxin domain containing 16 1 1
MIRT634205 TMEM192 transmembrane protein 192 1 1
MIRT634277 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT634308 SNTN sentan, cilia apical structure protein 1 1
MIRT634362 RASSF9 Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 1 1
MIRT634446 PDE7A phosphodiesterase 7A 1 1
MIRT634467 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 1
MIRT634482 OR7D2 olfactory receptor, family 7, subfamily D, member 2 1 1
MIRT634612 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 1
MIRT634627 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT635035 WWTR1 WW domain containing transcription regulator 1 1 1
MIRT635140 PLEKHA2 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 1 1
MIRT635801 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT636093 ZFP30 zinc finger protein 30 homolog (mouse) 1 1
MIRT636334 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 1
MIRT636711 ARSK arylsulfatase family, member K 1 2
MIRT636762 C17orf75 chromosome 17 open reading frame 75 1 1
MIRT636840 MBOAT1 membrane bound O-acyltransferase domain containing 1 1 2
MIRT636938 CCDC122 coiled-coil domain containing 122 1 1
MIRT637028 SPTLC3 serine palmitoyltransferase, long chain base subunit 3 1 1
MIRT637079 SELPLG selectin P ligand 1 1
MIRT637426 ZC3H12B zinc finger CCCH-type containing 12B 1 1
MIRT637959 NECAB3 N-terminal EF-hand calcium binding protein 3 1 1
MIRT638184 TLN1 talin 1 1 1
MIRT638344 RBMS2 RNA binding motif, single stranded interacting protein 2 1 2
MIRT638571 IER5 immediate early response 5 1 1
MIRT638607 HINT1 histidine triad nucleotide binding protein 1 1 1
MIRT638657 GGCX gamma-glutamyl carboxylase 1 1
MIRT638768 EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) 1 1
MIRT638773 EMC7 ER membrane protein complex subunit 7 1 1
MIRT639018 AAK1 AP2 associated kinase 1 1 1
MIRT639091 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT639575 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT639828 ZKSCAN1 zinc finger with KRAB and SCAN domains 1 1 1
MIRT640336 AP5B1 adaptor-related protein complex 5, beta 1 subunit 1 1
MIRT640568 CPE carboxypeptidase E 1 1
MIRT641826 TSC22D2 TSC22 domain family, member 2 1 1
MIRT642059 KCNK2 potassium channel, subfamily K, member 2 1 1
MIRT643080 PTPLAD2 protein tyrosine phosphatase-like A domain containing 2 1 1
MIRT643278 ZNF566 zinc finger protein 566 1 1
MIRT643443 LAX1 lymphocyte transmembrane adaptor 1 1 2
MIRT643866 COX20 COX20 Cox2 chaperone homolog (S. cerevisiae) 1 1
MIRT645034 ATAD3C ATPase family, AAA domain containing 3C 1 1
MIRT645089 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT645155 NOL9 nucleolar protein 9 1 1
MIRT645990 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646444 XRCC2 X-ray repair complementing defective repair in Chinese hamster cells 2 1 1
MIRT646505 FAM217B family with sequence similarity 217, member B 1 1
MIRT647713 NFX1 nuclear transcription factor, X-box binding 1 1 1
MIRT647978 PDE12 phosphodiesterase 12 1 1
MIRT648112 PTDSS2 phosphatidylserine synthase 2 1 1
MIRT649180 DNPEP aspartyl aminopeptidase 1 1
MIRT649311 IGSF6 immunoglobulin superfamily, member 6 1 1
MIRT649384 TMEM19 transmembrane protein 19 1 1
MIRT649625 EHD2 EH-domain containing 2 1 1
MIRT649716 TWSG1 twisted gastrulation homolog 1 (Drosophila) 1 1
MIRT649845 IRAK3 interleukin-1 receptor-associated kinase 3 1 1
MIRT650369 MOCS3 molybdenum cofactor synthesis 3 1 1
MIRT651349 ZBTB8B zinc finger and BTB domain containing 8B 1 2
MIRT651388 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT651610 WDFY2 WD repeat and FYVE domain containing 2 1 1
MIRT652860 TAB1 TGF-beta activated kinase 1/MAP3K7 binding protein 1 1 1
MIRT653271 SNAP29 synaptosomal-associated protein, 29kDa 1 1
MIRT653829 SHROOM3 shroom family member 3 1 1
MIRT654023 SAMD5 sterile alpha motif domain containing 5 1 1
MIRT654435 RASGRP3 RAS guanyl releasing protein 3 (calcium and DAG-regulated) 1 1
MIRT654489 RAD54L2 RAD54-like 2 (S. cerevisiae) 1 1
MIRT654642 PTAFR platelet-activating factor receptor 1 1
MIRT654712 PRR13 proline rich 13 1 1
MIRT655096 PHLDA3 pleckstrin homology-like domain, family A, member 3 1 1
MIRT655326 PCYOX1 prenylcysteine oxidase 1 1 1
MIRT655669 NUP43 nucleoporin 43kDa 1 1
MIRT655933 NDUFA4P1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa, pseudogene 1 1 1
MIRT657725 GPC4 glypican 4 1 1
MIRT658423 FAM177A1 family with sequence similarity 177, member A1 1 2
MIRT658703 EMC2 ER membrane protein complex subunit 2 1 1
MIRT658849 DUSP19 dual specificity phosphatase 19 1 1
MIRT658887 DRAXIN dorsal inhibitory axon guidance protein 1 1
MIRT659312 CSTF1 cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa 1 1
MIRT660234 BMP7 bone morphogenetic protein 7 1 1
MIRT661035 HIATL2 hippocampus abundant transcript-like 2 1 1
MIRT661045 RABAC1 Rab acceptor 1 (prenylated) 1 1
MIRT661236 ARL17B ADP-ribosylation factor-like 17B 1 1
MIRT661400 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT661501 EIF1AD eukaryotic translation initiation factor 1A domain containing 1 1
MIRT661659 ZNF623 zinc finger protein 623 1 1
MIRT661872 PDLIM5 PDZ and LIM domain 5 1 1
MIRT662783 CNNM3 cyclin M3 1 1
MIRT663096 THEM4 thioesterase superfamily member 4 1 1
MIRT663668 TMEM216 transmembrane protein 216 1 1
MIRT663971 ZNF786 zinc finger protein 786 1 1
MIRT664170 APOBEC3F apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F 1 1
MIRT664664 HEXA hexosaminidase A (alpha polypeptide) 1 1
MIRT664692 DBF4 DBF4 homolog (S. cerevisiae) 1 1
MIRT664759 MESDC2 mesoderm development candidate 2 1 1
MIRT664772 LIAS lipoic acid synthetase 1 1
MIRT664862 SLC19A3 solute carrier family 19, member 3 1 1
MIRT665091 CRIPT cysteine-rich PDZ-binding protein 1 1
MIRT665197 ESF1 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) 1 1
MIRT665344 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 1 1
MIRT665357 XKR4 XK, Kell blood group complex subunit-related family, member 4 1 1
MIRT665426 WDR55 WD repeat domain 55 1 1
MIRT665452 WDR17 WD repeat domain 17 1 1
MIRT665774 TMEM236 transmembrane protein 236 1 1
MIRT665902 TBCCD1 TBCC domain containing 1 1 1
MIRT666256 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 1
MIRT666709 RBL1 retinoblastoma-like 1 (p107) 1 1
MIRT667207 NIPAL1 NIPA-like domain containing 1 1 1
MIRT667223 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT667333 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like 1 1
MIRT667586 LONRF2 LON peptidase N-terminal domain and ring finger 2 1 1
MIRT667729 KIAA1456 KIAA1456 1 1
MIRT667907 ING1 inhibitor of growth family, member 1 1 1
MIRT667960 HEYL hairy/enhancer-of-split related with YRPW motif-like 1 1
MIRT668074 GMPS guanine monphosphate synthetase 1 1
MIRT668086 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668476 EXOSC2 exosome component 2 1 1
MIRT668507 ESYT2 extended synaptotagmin-like protein 2 1 1
MIRT668539 ERGIC1 endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 1 1
MIRT668639 DYNLL2 dynein, light chain, LC8-type 2 1 1
MIRT669319 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT669521 APOOL apolipoprotein O-like 1 1
MIRT669875 RAET1E retinoic acid early transcript 1E 1 1
MIRT669902 KIAA0754 KIAA0754 1 2
MIRT669986 SSR3 signal sequence receptor, gamma (translocon-associated protein gamma) 1 1
MIRT670217 BAZ2B bromodomain adjacent to zinc finger domain, 2B 1 1
MIRT670223 WIZ widely interspaced zinc finger motifs 1 1
MIRT670255 ZKSCAN3 zinc finger with KRAB and SCAN domains 3 1 1
MIRT670306 TAF8 TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa 1 1
MIRT670318 CEP57L1 centrosomal protein 57kDa-like 1 1 1
MIRT670394 KCNK5 potassium channel, subfamily K, member 5 1 1
MIRT670428 ELP2 elongator acetyltransferase complex subunit 2 1 1
MIRT670437 REPS2 RALBP1 associated Eps domain containing 2 1 1
MIRT670442 SYNRG synergin, gamma 1 1
MIRT670469 TMEM105 transmembrane protein 105 1 1
MIRT670504 LYRM4 LYR motif containing 4 1 1
MIRT670512 ZSCAN22 zinc finger and SCAN domain containing 22 1 1
MIRT670528 SLC9A7 solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7 1 1
MIRT670554 SHISA2 shisa homolog 2 (Xenopus laevis) 1 1
MIRT670638 BVES blood vessel epicardial substance 1 1
MIRT670656 STX4 syntaxin 4 1 1
MIRT670685 SUGT1 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) 1 2
MIRT670703 SLC16A13 solute carrier family 16, member 13 (monocarboxylic acid transporter 13) 1 1
MIRT670744 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT670798 UHRF1BP1L UHRF1 binding protein 1-like 1 1
MIRT670812 NICN1 nicolin 1 1 1
MIRT670843 SFT2D2 SFT2 domain containing 2 1 1
MIRT670976 MED17 mediator complex subunit 17 1 1
MIRT670996 PTGIS prostaglandin I2 (prostacyclin) synthase 1 1
MIRT671013 RBM22 RNA binding motif protein 22 1 1
MIRT671034 PCDHB2 protocadherin beta 2 1 1
MIRT671040 SS18 synovial sarcoma translocation, chromosome 18 1 1
MIRT671092 DNAJC3 DnaJ (Hsp40) homolog, subfamily C, member 3 1 1
MIRT671168 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 1 1
MIRT671222 CLSTN1 calsyntenin 1 1 1
MIRT671247 TMEM41B transmembrane protein 41B 1 1
MIRT671251 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT671287 RPL37A ribosomal protein L37a 1 1
MIRT671447 DNA2 DNA replication helicase 2 homolog (yeast) 1 2
MIRT671467 AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) 1 1
MIRT671574 FOSL2 FOS-like antigen 2 1 1
MIRT671595 CBY3 chibby homolog 3 (Drosophila) 1 1
MIRT671598 RILPL1 Rab interacting lysosomal protein-like 1 1 1
MIRT671609 C6orf25 chromosome 6 open reading frame 25 1 1
MIRT671637 FBXO36 F-box protein 36 1 1
MIRT671721 PMPCA peptidase (mitochondrial processing) alpha 1 1
MIRT671766 PLA2G4A phospholipase A2, group IVA (cytosolic, calcium-dependent) 1 1
MIRT671821 TRPM6 transient receptor potential cation channel, subfamily M, member 6 1 1
MIRT671831 STIL SCL/TAL1 interrupting locus 1 1
MIRT671853 APOL2 apolipoprotein L, 2 1 1
MIRT671888 MOB3A MOB kinase activator 3A 1 1
MIRT671912 PCDHB11 protocadherin beta 11 1 1
MIRT671922 PLEKHS1 pleckstrin homology domain containing, family S member 1 1 2
MIRT672028 ZNF70 zinc finger protein 70 1 1
MIRT672085 AEN apoptosis enhancing nuclease 1 1
MIRT672121 ATP6V0A2 ATPase, H+ transporting, lysosomal V0 subunit a2 1 1
MIRT672148 PLEKHH1 pleckstrin homology domain containing, family H (with MyTH4 domain) member 1 1 1
MIRT672168 FANCF Fanconi anemia, complementation group F 1 1
MIRT672205 ZNF490 zinc finger protein 490 1 1
MIRT672214 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672249 SIK2 salt-inducible kinase 2 1 1
MIRT672357 VPS8 vacuolar protein sorting 8 homolog (S. cerevisiae) 1 1
MIRT672365 PDE11A phosphodiesterase 11A 1 1
MIRT672455 POU2F3 POU class 2 homeobox 3 1 1
MIRT672519 CRX cone-rod homeobox 1 1
MIRT672544 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT672617 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT672722 S1PR2 sphingosine-1-phosphate receptor 2 1 1
MIRT672724 KIF18B kinesin family member 18B 1 1
MIRT672826 GJD3 gap junction protein, delta 3, 31.9kDa 1 1
MIRT672879 ZSCAN29 zinc finger and SCAN domain containing 29 1 1
MIRT672944 AKAP5 A kinase (PRKA) anchor protein 5 1 1
MIRT673004 TAF1 TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa 1 1
MIRT673027 RBBP4 retinoblastoma binding protein 4 1 1
MIRT673038 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT673070 AGO3 eukaryotic translation initiation factor 2C, 3 1 1
MIRT673383 ZNF124 zinc finger protein 124 1 1
MIRT673414 RBBP9 retinoblastoma binding protein 9 1 1
MIRT673420 RNF24 ring finger protein 24 1 1
MIRT673425 APAF1 apoptotic peptidase activating factor 1 1 1
MIRT673481 GTF3C6 general transcription factor IIIC, polypeptide 6, alpha 35kDa 1 1
MIRT673622 VCPIP1 valosin containing protein (p97)/p47 complex interacting protein 1 1 1
MIRT673629 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT673675 NUDCD2 NudC domain containing 2 1 1
MIRT673686 NDUFA7 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa 1 1
MIRT673709 SLU7 SLU7 splicing factor homolog (S. cerevisiae) 1 1
MIRT673735 TCF23 transcription factor 23 1 1
MIRT673786 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 1
MIRT673797 MALL mal, T-cell differentiation protein-like 1 1
MIRT673816 DARS aspartyl-tRNA synthetase 1 1
MIRT673969 INMT indolethylamine N-methyltransferase 1 1
MIRT674025 ANKRD9 ankyrin repeat domain 9 1 1
MIRT674257 ZNF284 zinc finger protein 284 1 1
MIRT674319 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 1
MIRT674456 ULK2 unc-51-like kinase 2 (C. elegans) 1 1
MIRT674549 GREB1 growth regulation by estrogen in breast cancer 1 1 1
MIRT674571 KIF3A kinesin family member 3A 1 1
MIRT674621 TRUB2 TruB pseudouridine (psi) synthase homolog 2 (E. coli) 1 1
MIRT674624 HECTD3 HECT domain containing E3 ubiquitin protein ligase 3 1 1
MIRT674837 GLRX2 glutaredoxin 2 1 1
MIRT674859 GINM1 glycoprotein integral membrane 1 1 1
MIRT674947 PEX2 peroxisomal biogenesis factor 2 1 1
MIRT675004 PPTC7 PTC7 protein phosphatase homolog (S. cerevisiae) 1 1
MIRT675028 SNX1 sorting nexin 1 1 1
MIRT675151 NDRG1 N-myc downstream regulated 1 1 1
MIRT675209 TTC9C tetratricopeptide repeat domain 9C 1 1
MIRT675427 CLEC7A C-type lectin domain family 7, member A 1 1
MIRT675450 SRP19 signal recognition particle 19kDa 1 1
MIRT675483 SLC1A2 solute carrier family 1 (glial high affinity glutamate transporter), member 2 1 2
MIRT675508 HSD17B12 hydroxysteroid (17-beta) dehydrogenase 12 1 1
MIRT675656 COL8A1 collagen, type VIII, alpha 1 1 1
MIRT675709 EMC3 ER membrane protein complex subunit 3 1 1
MIRT675759 RDH10 retinol dehydrogenase 10 (all-trans) 1 1
MIRT675872 ATP1B4 ATPase, Na+/K+ transporting, beta 4 polypeptide 1 1
MIRT675920 CYP51A1 cytochrome P450, family 51, subfamily A, polypeptide 1 1 1
MIRT675934 RAP2B RAP2B, member of RAS oncogene family 1 1
MIRT675945 NAV1 neuron navigator 1 1 1
MIRT676053 ATL3 atlastin GTPase 3 1 1
MIRT676277 ZNF260 zinc finger protein 260 1 1
MIRT676414 MRO maestro 1 1
MIRT676635 CDH7 cadherin 7, type 2 1 1
MIRT676822 TNFSF15 tumor necrosis factor (ligand) superfamily, member 15 1 1
MIRT676866 ZNF451 zinc finger protein 451 1 1
MIRT676985 ZNF708 zinc finger protein 708 1 1
MIRT677031 ZNF107 zinc finger protein 107 1 1
MIRT677310 CPSF2 cleavage and polyadenylation specific factor 2, 100kDa 1 1
MIRT677401 PCNP PEST proteolytic signal containing nuclear protein 1 1
MIRT677430 PDF peptide deformylase (mitochondrial) 1 1
MIRT677587 GATA6 GATA binding protein 6 1 1
MIRT677977 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 1 1
MIRT678135 KLLN killin, p53-regulated DNA replication inhibitor 1 1
MIRT678390 TMEM239 transmembrane protein 239 1 1
MIRT678398 MYPN myopalladin 1 1
MIRT678593 ANAPC16 anaphase promoting complex subunit 16 1 1
MIRT678675 SCUBE3 signal peptide, CUB domain, EGF-like 3 1 1
MIRT679058 RMDN1 family with sequence similarity 82, member B 1 1
MIRT679472 RHOF ras homolog family member F (in filopodia) 1 1
MIRT679591 HUS1 HUS1 checkpoint homolog (S. pombe) 1 1
MIRT680041 OSBPL2 oxysterol binding protein-like 2 1 1
MIRT680163 ZDHHC20 zinc finger, DHHC-type containing 20 1 1
MIRT680290 AKIP1 A kinase (PRKA) interacting protein 1 1 1
MIRT680342 ZNF281 zinc finger protein 281 1 1
MIRT681090 GSTO2 glutathione S-transferase omega 2 1 1
MIRT686602 TMEM70 transmembrane protein 70 1 1
MIRT687128 QPCTL glutaminyl-peptide cyclotransferase-like 1 1
MIRT687298 OTUD7B OTU domain containing 7B 1 1
MIRT689577 NUDT7 nudix (nucleoside diphosphate linked moiety X)-type motif 7 1 1
MIRT689820 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT695082 ZNF17 zinc finger protein 17 1 1
MIRT696483 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT697374 ZNF286B zinc finger protein 286B 1 1
MIRT698752 STK4 serine/threonine kinase 4 1 2
MIRT699564 SIT1 signaling threshold regulating transmembrane adaptor 1 1 1
MIRT700607 PRKCA protein kinase C, alpha 1 1
MIRT703925 EPG5 ectopic P-granules autophagy protein 5 homolog (C. elegans) 1 1
MIRT704352 DBR1 debranching enzyme homolog 1 (S. cerevisiae) 1 1
MIRT705787 ALDH6A1 aldehyde dehydrogenase 6 family, member A1 1 1
MIRT705927 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT710028 POLL polymerase (DNA directed), lambda 1 1
MIRT710253 LRRC10 leucine rich repeat containing 10 1 1
MIRT711298 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
MIRT711504 ESCO1 establishment of cohesion 1 homolog 1 (S. cerevisiae) 1 1
MIRT711640 LIPG lipase, endothelial 1 1
MIRT716157 RBM48 RNA binding motif protein 48 1 1
MIRT719195 CASP10 caspase 10, apoptosis-related cysteine peptidase 1 1
MIRT720517 KIAA0101 KIAA0101 1 1
MIRT722377 KAZALD1 Kazal-type serine peptidase inhibitor domain 1 1 1
MIRT723133 YPEL1 yippee-like 1 (Drosophila) 1 1
MIRT725288 NT5C1A 5'-nucleotidase, cytosolic IA 1 1
MIRT725568 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
Error report submission
Your e-Mail*