Accession ID: MIRT035538 [miRNA, hsa-miR-181a-5p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-181a-2LinkOut: [miRBase ]
Synonyms MIRN181A, MIRN181A2, MIR181A2, MIR181A2HG
Description Homo sapiens miR-181a-2 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-181a-5p
Mature Sequence 39| AACAUUCAACGCUGUCGGUGAGU |61
Evidence Experimental
Experiments Cloned
Putative hsa-miR-181a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description Notch homolog 1, translocation-associated (Drosophila)
Transcript NM_0176    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_0176|3'UTR
   1 TAAACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCC
  81 GACCAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTAT
 161 GTACTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCT
 241 ATTCTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATAT
 321 AAACAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGA
 401 AGGGAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCA
 481 AGCCAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCT
 561 CACCTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTT
 641 AGATGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCAT
 721 GAATCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCC
 801 CCCTGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACA
 881 CGGAGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACA
 961 GTGTCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTC
1041 CCGTGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCC
1121 CGCAGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTT
1201 GGGAGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTT
1281 TGTTTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCC
1361 TTAGCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGG
1441 CCGCGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTG
1521 TAGTTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACT
1601 GATTTGCAATAAAAATGATACTGATGGTGAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugaguggcUGUCGCA--ACUUACaa 5'
                  | | | |  ||||||  
Target 5' tgtttaaaAAATCTTAATGAATGag 3'
1281 - 1305 121.00 -5.90
2
miRNA  3' ugaGUGGCUGUC-GCAAC-UUACAa 5'
             | |:| | | : ||| ||||| 
Target 5' gccCCCTGCCCGTTCTTGAAATGTa 3'
798 - 822 120.00 -6.20
3
miRNA  3' ugaGUGGCUGUCG----CA--ACUUACAa 5'
             |||| |::|:     |  ||||| | 
Target 5' gtgCACCCATGGTACCAATCATGAATCTt 3'
699 - 727 116.00 -9.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181a-5p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions C2C12 , DP
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... we show that both miR-1 and miR-133 reduce Cyclin D1 expression and repress myoblast proliferation by inducing G1 phase arrest. Furthermore, we demonstrate that miR-133 inhibits mitotic progression by targeting Sp1. Finally, we demonstrate that mir-181a-1/b-1, but not mir-181a-2b-2 and mir-181-c/d, controls the development of normal thymic T cells and leukemia cells. Together, these results illustrate that NOTCH oncogene activity in tumor development can be selectively inhibited by targeting the molecular networks controlled by mir-181a-1/b-1progression by targeting Sp1. ...

- Fragoso, R. Mao, T. Wang, S. Schaffert, S. et al., 2012, PLoS Genet.

Article - Fragoso, R. Mao, T. Wang, S. Schaffert, S. et al.
- PLoS Genet, 2012
Oncogenes, which are essential for tumor initiation, development, and maintenance, are valuable targets for cancer therapy. However, it remains a challenge to effectively inhibit oncogene activity by targeting their downstream pathways without causing significant toxicity to normal tissues. Here we show that deletion of mir-181a-1/b-1 expression inhibits the development of Notch1 oncogene-induced T cell acute lymphoblastic leukemia (T-ALL). mir-181a-1/b-1 controls the strength and threshold of Notch activity in tumorigenesis in part by dampening multiple negative feedback regulators downstream of NOTCH and pre-T cell receptor (TCR) signaling pathways. Importantly, although Notch oncogenes utilize normal thymic progenitor cell genetic programs for tumor transformation, comparative analyses of mir-181a-1/b-1 function in normal thymocyte and tumor development demonstrate that mir-181a-1/b-1 can be specifically targeted to inhibit tumor development with little toxicity to normal development. Finally, we demonstrate that mir-181a-1/b-1, but not mir-181a-2b-2 and mir-181-c/d, controls the development of normal thymic T cells and leukemia cells. Together, these results illustrate that NOTCH oncogene activity in tumor development can be selectively inhibited by targeting the molecular networks controlled by mir-181a-1/b-1.
LinkOut: [PMID: 22916024]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
241 hsa-miR-181a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000242 BDNF brain-derived neurotrophic factor 1 1
MIRT000243 NLK nemo-like kinase 2 1
MIRT000244 GATA6 GATA binding protein 6 3 2
MIRT000245 CDX2 caudal type homeobox 2 2 1
MIRT000698 PLAG1 pleiomorphic adenoma gene 1 4 1
MIRT002870 HOXA11 homeobox A11 1 1
MIRT003501 BCL2 B-cell CLL/lymphoma 2 4 6
MIRT003630 PROX1 prospero homeobox 1 4 1
MIRT004327 KAT2B K(lysine) acetyltransferase 2B 3 1
MIRT004554 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 5 2
MIRT005544 ZNF763 zinc finger protein 763 4 1
MIRT005575 DDIT4 DNA-damage-inducible transcript 4 3 1
MIRT005576 ATM ataxia telangiectasia mutated 3 1
MIRT005577 HIPK2 homeodomain interacting protein kinase 2 3 1
MIRT005767 BCL2L11 BCL2-like 11 (apoptosis facilitator) 3 1
MIRT005880 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 3 1
MIRT006166 RNF2 ring finger protein 2 4 1
MIRT006194 RALA v-ral simian leukemia viral oncogene homolog A (ras related) 4 1
MIRT006213 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 2 2
MIRT006395 PRAP1 proline-rich acidic protein 1 1 1
MIRT006481 DUSP6 dual specificity phosphatase 6 2 1
MIRT006482 PTPN11 protein tyrosine phosphatase, non-receptor type 11 2 1
MIRT006483 DUSP5 dual specificity phosphatase 5 2 1
MIRT006484 PTPN22 protein tyrosine phosphatase, non-receptor type 22 (lymphoid) 2 1
MIRT006851 FOS FBJ murine osteosarcoma viral oncogene homolog 1 1
MIRT006871 MTMR3 myotubularin related protein 3 1 1
MIRT006939 KLF6 Kruppel-like factor 6 3 1
MIRT006949 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT006950 XIAP X-linked inhibitor of apoptosis 1 1
MIRT007058 GPR78 G protein-coupled receptor 78 1 1
MIRT025038 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 1 1
MIRT025039 LRRC17 leucine rich repeat containing 17 1 1
MIRT025040 CHRFAM7A CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion 1 1
MIRT025041 CD46 CD46 molecule, complement regulatory protein 1 1
MIRT025042 RASSF6 Ras association (RalGDS/AF-6) domain family member 6 1 1
MIRT025043 FXYD6 FXYD domain containing ion transport regulator 6 1 1
MIRT025044 KCTD3 potassium channel tetramerisation domain containing 3 1 1
MIRT025045 TSHR thyroid stimulating hormone receptor 1 1
MIRT025046 ZNF558 zinc finger protein 558 1 1
MIRT025047 C8A complement component 8, alpha polypeptide 1 1
MIRT025048 ARL6IP6 ADP-ribosylation-like factor 6 interacting protein 6 1 1
MIRT025049 ZNF426 zinc finger protein 426 1 1
MIRT025050 ESR1 estrogen receptor 1 1 1
MIRT025051 ATF7IP2 activating transcription factor 7 interacting protein 2 1 1
MIRT025052 PRR4 proline rich 4 (lacrimal) 1 1
MIRT025053 TCF21 transcription factor 21 1 1
MIRT025054 PHOX2A paired-like homeobox 2a 1 1
MIRT025055 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT025056 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT025057 GSTM2 glutathione S-transferase mu 2 (muscle) 1 1
MIRT025058 FSIP1 fibrous sheath interacting protein 1 1 1
MIRT025059 KBTBD3 kelch repeat and BTB (POZ) domain containing 3 1 1
MIRT025060 PTPRZ1 protein tyrosine phosphatase, receptor-type, Z polypeptide 1 1 1
MIRT025061 WNT3A wingless-type MMTV integration site family, member 3A 1 1
MIRT025062 TUSC1 tumor suppressor candidate 1 1 1
MIRT025063 LRRN3 leucine rich repeat neuronal 3 1 1
MIRT025064 TMEM45A transmembrane protein 45A 1 1
MIRT025065 ARF6 ADP-ribosylation factor 6 1 1
MIRT025066 C1orf109 chromosome 1 open reading frame 109 1 1
MIRT025067 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT025068 PLXDC2 plexin domain containing 2 1 1
MIRT025069 NMRK2 integrin beta 1 binding protein 3 1 1
MIRT025070 WNT2 wingless-type MMTV integration site family member 2 1 1
MIRT025071 ATG10 ATG10 autophagy related 10 homolog (S. cerevisiae) 1 1
MIRT025072 PRDX3 peroxiredoxin 3 1 1
MIRT025073 ZNF652 zinc finger protein 652 1 1
MIRT025075 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 1 1
MIRT025076 PCDHB8 protocadherin beta 8 1 1
MIRT025077 ENAH enabled homolog (Drosophila) 1 1
MIRT025078 ZNF25 zinc finger protein 25 1 1
MIRT025079 TAF6L TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT025080 S100A1 S100 calcium binding protein A1 1 1
MIRT025081 PLA2G4C phospholipase A2, group IVC (cytosolic, calcium-independent) 1 1
MIRT025082 NOL4 nucleolar protein 4 1 1
MIRT025083 SIX6 SIX homeobox 6 1 1
MIRT025084 FKBP10 FK506 binding protein 10, 65 kDa 1 1
MIRT025085 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT025086 OR11A1 olfactory receptor, family 11, subfamily A, member 1 1 1
MIRT025087 INCENP inner centromere protein antigens 135/155kDa 1 1
MIRT025088 LPGAT1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT025089 CLUAP1 clusterin associated protein 1 1 1
MIRT025090 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 1
MIRT025091 CCDC6 coiled-coil domain containing 6 1 1
MIRT025092 BAG2 BCL2-associated athanogene 2 1 1
MIRT025093 GPR83 G protein-coupled receptor 83 1 1
MIRT025094 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1 1
MIRT025095 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT025096 RLF rearranged L-myc fusion 1 1
MIRT025097 FBXO28 F-box protein 28 1 1
MIRT025098 ZNF350 zinc finger protein 350 1 1
MIRT025099 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT025100 RNF34 ring finger protein 34 1 1
MIRT025101 LCLAT1 lysocardiolipin acyltransferase 1 1 1
MIRT025102 KIAA1462 KIAA1462 1 1
MIRT025103 ZNF35 zinc finger protein 35 1 1
MIRT025104 PITPNB phosphatidylinositol transfer protein, beta 1 1
MIRT025105 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT025106 H3F3B H3 histone, family 3B (H3.3B) 1 1
MIRT025107 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT025108 LGALSL galectin-related protein 1 1
MIRT025109 TGIF2 TGFB-induced factor homeobox 2 1 1
MIRT025110 MOB1A MOB1, Mps One Binder kinase activator-like 1B (yeast) 1 1
MIRT025111 SLC35B4 solute carrier family 35, member B4 1 1
MIRT025112 FAM160A2 family with sequence similarity 160, member A2 1 1
MIRT025113 NUPL1 nucleoporin like 1 1 1
MIRT025114 GPRIN3 GPRIN family member 3 1 1
MIRT025115 H1F0 H1 histone family, member 0 1 1
MIRT025116 ARHGAP12 Rho GTPase activating protein 12 1 1
MIRT025117 SPRY2 sprouty homolog 2 (Drosophila) 1 1
MIRT025118 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT025119 TMED4 transmembrane emp24 protein transport domain containing 4 1 1
MIRT025120 MAP2K1 mitogen-activated protein kinase kinase 1 1 1
MIRT025121 PUM1 pumilio homolog 1 (Drosophila) 1 1
MIRT025122 TRIM2 tripartite motif-containing 2 1 1
MIRT025123 FBXO33 F-box protein 33 1 1
MIRT025124 NRP1 neuropilin 1 2 2
MIRT025125 FAM47B family with sequence similarity 47, member B 1 1
MIRT025126 CCNG1 cyclin G1 1 1
MIRT025127 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT025128 OTUD1 OTU domain containing 1 1 1
MIRT025129 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT025130 WNT16 wingless-type MMTV integration site family, member 16 1 1
MIRT025131 CST5 cystatin D 1 1
MIRT025132 SH3BGRL SH3 domain binding glutamic acid-rich protein like 1 1
MIRT025133 GPR137B G protein-coupled receptor 137B 1 1
MIRT025134 OFCC1 orofacial cleft 1 candidate 1 1 1
MIRT025135 IQCG IQ motif containing G 1 1
MIRT025136 NKX3-2 NK3 homeobox 2 1 1
MIRT025137 OTX2 orthodenticle homeobox 2 1 1
MIRT025138 ROPN1L ropporin 1-like 1 1
MIRT025139 TMEM14A transmembrane protein 14A 1 1
MIRT025140 TAF2 TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa 1 1
MIRT025141 IDS iduronate 2-sulfatase 1 1
MIRT025142 FRA10AC1 fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1 1 1
MIRT025143 COL27A1 collagen, type XXVII, alpha 1 1 1
MIRT025144 EPHA5 EPH receptor A5 1 1
MIRT025145 DCST1 DC-STAMP domain containing 1 1 1
MIRT025146 ZNF562 zinc finger protein 562 1 1
MIRT025147 EYA4 eyes absent homolog 4 (Drosophila) 1 1
MIRT025148 CHL1 cell adhesion molecule with homology to L1CAM (close homolog of L1) 1 1
MIRT025149 TAAR6 trace amine associated receptor 6 1 1
MIRT025150 SLCO2A1 solute carrier organic anion transporter family, member 2A1 1 1
MIRT025151 TMEM257 chromosome X open reading frame 1 1 1
MIRT025152 HMGB2 high-mobility group box 2 1 1
MIRT025153 HERC3 hect domain and RLD 3 1 1
MIRT025154 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT025155 SRPK2 SFRS protein kinase 2 1 1
MIRT025156 DNAJC7 DnaJ (Hsp40) homolog, subfamily C, member 7 1 1
MIRT025157 ANKRD1 ankyrin repeat domain 1 (cardiac muscle) 1 1
MIRT025158 CFI complement factor I 1 1
MIRT025159 MRPS14 mitochondrial ribosomal protein S14 1 1
MIRT025160 HEY2 hairy/enhancer-of-split related with YRPW motif 2 1 1
MIRT025161 MTMR12 myotubularin related protein 12 1 1
MIRT025162 ACOT12 acyl-CoA thioesterase 12 1 1
MIRT025163 KIAA0101 KIAA0101 1 1
MIRT025164 USP28 ubiquitin specific peptidase 28 1 1
MIRT025165 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 1 1
MIRT025166 BPGM 2,3-bisphosphoglycerate mutase 1 1
MIRT025167 DSCR8 Down syndrome critical region gene 8 1 1
MIRT025168 UGT3A1 UDP glycosyltransferase 3 family, polypeptide A1 1 1
MIRT025169 HSD17B3 hydroxysteroid (17-beta) dehydrogenase 3 1 1
MIRT025170 GADD45G growth arrest and DNA-damage-inducible, gamma 1 1
MIRT025171 FBXO34 F-box protein 34 1 1
MIRT025172 C1QTNF9 C1q and tumor necrosis factor related protein 9 1 1
MIRT025173 KLRC4 killer cell lectin-like receptor subfamily C, member 4 1 1
MIRT025174 MOB3B MOB1, Mps One Binder kinase activator-like 2B (yeast) 1 1
MIRT025175 FKBP7 FK506 binding protein 7 1 1
MIRT025176 TBX4 T-box 4 1 1
MIRT025177 TMPRSS11A transmembrane protease, serine 11A 1 1
MIRT025178 SNAI2 snail homolog 2 (Drosophila) 1 1
MIRT025179 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 1 1
MIRT025180 NUDT12 nudix (nucleoside diphosphate linked moiety X)-type motif 12 1 1
MIRT025181 COPS2 COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) 1 1
MIRT025182 ZNF12 zinc finger protein 12 1 1
MIRT025183 PRLR prolactin receptor 1 1
MIRT025184 PLCL2 phospholipase C-like 2 1 1
MIRT025185 ZNF594 zinc finger protein 594 1 1
MIRT025186 METAP1 methionyl aminopeptidase 1 1 1
MIRT025187 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT025188 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT025189 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT025190 SLC37A3 solute carrier family 37 (glycerol-3-phosphate transporter), member 3 1 1
MIRT025191 FBXO11 F-box protein 11 1 1
MIRT025192 ZNF445 zinc finger protein 445 1 1
MIRT025193 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT025194 ATP8A1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 1 1
MIRT025195 TMEM64 transmembrane protein 64 1 1
MIRT025196 MOB1B MOB1, Mps One Binder kinase activator-like 1A (yeast) 1 1
MIRT025197 GNAI3 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 1 1
MIRT025198 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT025199 SRSF7 splicing factor, arginine/serine-rich 7, 35kDa 1 1
MIRT025200 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 2
MIRT025201 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 1 1
MIRT025202 LBR lamin B receptor 1 1
MIRT025203 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT025204 KLHL42 kelch domain containing 5 1 1
MIRT025205 TMEM132B transmembrane protein 132B 1 1
MIRT025206 AFTPH aftiphilin 1 1
MIRT025207 ZNF148 zinc finger protein 148 1 1
MIRT025208 NOTCH2 Notch homolog 2 (Drosophila) 1 1
MIRT025209 NFYB nuclear transcription factor Y, beta 1 1
MIRT035538 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 2 1
MIRT047302 SIK2 salt-inducible kinase 2 1 1
MIRT047303 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT047304 FAM222B chromosome 17 open reading frame 63 1 1
MIRT047305 RPS8 ribosomal protein S8 1 1
MIRT047306 STAG2 stromal antigen 2 1 1
MIRT047307 SMG1 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT047308 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT047309 ZEB2 zinc finger E-box binding homeobox 2 1 1
MIRT047310 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT047311 RPL14 ribosomal protein L14 1 1
MIRT047312 KCTD2 potassium channel tetramerisation domain containing 2 1 1
MIRT047313 UBA2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT047314 DDX27 DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 1 1
MIRT047315 FAT1 FAT tumor suppressor homolog 1 (Drosophila) 1 1
MIRT047316 HDAC6 histone deacetylase 6 1 1
MIRT047317 TMEM192 transmembrane protein 192 1 1
MIRT047318 LAMA3 laminin, alpha 3 1 1
MIRT047319 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT047320 ND2 MTND2 1 1
MIRT047321 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT047322 OCA2 oculocutaneous albinism II 1 1
MIRT047323 AP1M1 adaptor-related protein complex 1, mu 1 subunit 1 1
MIRT047324 UCHL1 ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) 1 1
MIRT047325 PGD phosphogluconate dehydrogenase 1 1
MIRT047326 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 1
MIRT047327 AKAP12 A kinase (PRKA) anchor protein 12 1 1
MIRT047328 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT047329 GANAB glucosidase, alpha; neutral AB 1 1
MIRT047330 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT047331 H2AFY H2A histone family, member Y 1 1
MIRT047332 TEAD4 TEA domain family member 4 1 1
MIRT047333 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT047334 PRRC2B HLA-B associated transcript 2-like 1 1 1
MIRT047335 BRCA1 breast cancer 1, early onset 1 1
MIRT047336 SOGA2 KIAA0802 1 1
MIRT047337 KIAA0100 KIAA0100 1 1
MIRT047338 PPP1R9A protein phosphatase 1, regulatory (inhibitor) subunit 9A 1 1
MIRT047339 MGAT5 mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase 1 1
MIRT047340 TNIP1 TNFAIP3 interacting protein 1 1 1