Accession ID: MIRT035538 [miRNA, hsa-miR-181a-5p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-181a-2LinkOut: [miRBase ]
Synonyms MIRN181A, MIRN181A2, MIR181A2, MIR181A2HG
Description Homo sapiens miR-181a-2 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-181a-5p
Mature Sequence 39| AACAUUCAACGCUGUCGGUGAGU |61
Evidence Experimental
Experiments Cloned
Putative hsa-miR-181a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description notch 1
Transcript NM_017617    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_017617|3'UTR
   1 ACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCCGAC
  81 CAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTATGTA
 161 CTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCTATT
 241 CTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATATAAA
 321 CAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGAAGG
 401 GAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCAAGC
 481 CAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCTCAC
 561 CTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTTAGA
 641 TGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCATGAA
 721 TCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCCCCC
 801 TGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACACGG
 881 AGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACAGTG
 961 TCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTCCCG
1041 TGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCCCGC
1121 AGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTTGGG
1201 AGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTTTGT
1281 TTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCCTTA
1361 GCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGGCCG
1441 CGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTGTAG
1521 TTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACTGAT
1601 TTGCAATAAAAATGATACTGATGGTGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugaguggcUGUCGCA--ACUUACaa 5'
                  | | | |  ||||||  
Target 5' tgtttaaaAAATCTTAATGAATGag 3'
1278 - 1302 121.00 -5.90
2
miRNA  3' ugaGUGGCUGUC-GCAAC-UUACAa 5'
             | |:| | | : ||| ||||| 
Target 5' gccCCCTGCCCGTTCTTGAAATGTa 3'
795 - 819 120.00 -6.20
3
miRNA  3' ugaGUGGCUGUCG----CA--ACUUACAa 5'
             |||| |::|:     |  ||||| | 
Target 5' gtgCACCCATGGTACCAATCATGAATCTt 3'
696 - 724 116.00 -9.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181a-5p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions C2C12 , DP
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... we show that both miR-1 and miR-133 reduce Cyclin D1 expression and repress myoblast proliferation by inducing G1 phase arrest. Furthermore, we demonstrate that miR-133 inhibits mitotic progression by targeting Sp1. Finally, we demonstrate that mir-181a-1/b-1, but not mir-181a-2b-2 and mir-181-c/d, controls the development of normal thymic T cells and leukemia cells. Together, these results illustrate that NOTCH oncogene activity in tumor development can be selectively inhibited by targeting the molecular networks controlled by mir-181a-1/b-1progression by targeting Sp1. ...

- Fragoso, R. Mao, T. Wang, S. Schaffert, S. et al., 2012, PLoS Genet.

Article - Fragoso, R. Mao, T. Wang, S. Schaffert, S. et al.
- PLoS Genet, 2012
Oncogenes, which are essential for tumor initiation, development, and maintenance, are valuable targets for cancer therapy. However, it remains a challenge to effectively inhibit oncogene activity by targeting their downstream pathways without causing significant toxicity to normal tissues. Here we show that deletion of mir-181a-1/b-1 expression inhibits the development of Notch1 oncogene-induced T cell acute lymphoblastic leukemia (T-ALL). mir-181a-1/b-1 controls the strength and threshold of Notch activity in tumorigenesis in part by dampening multiple negative feedback regulators downstream of NOTCH and pre-T cell receptor (TCR) signaling pathways. Importantly, although Notch oncogenes utilize normal thymic progenitor cell genetic programs for tumor transformation, comparative analyses of mir-181a-1/b-1 function in normal thymocyte and tumor development demonstrate that mir-181a-1/b-1 can be specifically targeted to inhibit tumor development with little toxicity to normal development. Finally, we demonstrate that mir-181a-1/b-1, but not mir-181a-2b-2 and mir-181-c/d, controls the development of normal thymic T cells and leukemia cells. Together, these results illustrate that NOTCH oncogene activity in tumor development can be selectively inhibited by targeting the molecular networks controlled by mir-181a-1/b-1.
LinkOut: [PMID: 22916024]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
529 hsa-miR-181a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000242 BDNF brain-derived neurotrophic factor 1 1
MIRT000243 NLK nemo-like kinase 2 1
MIRT000244 GATA6 GATA binding protein 6 3 2
MIRT000245 CDX2 caudal type homeobox 2 2 1
MIRT000698 PLAG1 pleiomorphic adenoma gene 1 4 1
MIRT002870 HOXA11 homeobox A11 1 1
MIRT003501 BCL2 B-cell CLL/lymphoma 2 4 8
MIRT003630 PROX1 prospero homeobox 1 4 1
MIRT004327 KAT2B K(lysine) acetyltransferase 2B 3 1
MIRT004554 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 5 2
MIRT005544 ZNF763 zinc finger protein 763 4 1
MIRT005575 DDIT4 DNA-damage-inducible transcript 4 4 2
MIRT005576 ATM ataxia telangiectasia mutated 5 5
MIRT005577 HIPK2 homeodomain interacting protein kinase 2 3 1
MIRT005767 BCL2L11 BCL2-like 11 (apoptosis facilitator) 3 2
MIRT005880 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 3 1
MIRT006166 RNF2 ring finger protein 2 4 1
MIRT006194 RALA v-ral simian leukemia viral oncogene homolog A (ras related) 4 2
MIRT006213 SIRT1 sirtuin 1 2 2
MIRT006395 PRAP1 proline-rich acidic protein 1 1 1
MIRT006481 DUSP6 dual specificity phosphatase 6 2 1
MIRT006482 PTPN11 protein tyrosine phosphatase, non-receptor type 11 2 1
MIRT006483 DUSP5 dual specificity phosphatase 5 3 2
MIRT006484 PTPN22 protein tyrosine phosphatase, non-receptor type 22 (lymphoid) 2 1
MIRT006851 FOS FBJ murine osteosarcoma viral oncogene homolog 1 1
MIRT006871 MTMR3 myotubularin related protein 3 1 1
MIRT006939 KLF6 Kruppel-like factor 6 3 2
MIRT006949 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT006950 XIAP X-linked inhibitor of apoptosis 1 1
MIRT007058 GPR78 G protein-coupled receptor 78 1 1
MIRT025038 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 1 1
MIRT025039 LRRC17 leucine rich repeat containing 17 1 1
MIRT025040 CHRFAM7A CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion 1 1
MIRT025041 CD46 CD46 molecule, complement regulatory protein 1 1
MIRT025042 RASSF6 Ras association (RalGDS/AF-6) domain family member 6 1 1
MIRT025043 FXYD6 FXYD domain containing ion transport regulator 6 1 1
MIRT025044 KCTD3 potassium channel tetramerisation domain containing 3 1 1
MIRT025045 TSHR thyroid stimulating hormone receptor 1 1
MIRT025046 ZNF558 zinc finger protein 558 1 1
MIRT025047 C8A complement component 8, alpha polypeptide 1 1
MIRT025048 ARL6IP6 ADP-ribosylation-like factor 6 interacting protein 6 1 1
MIRT025049 ZNF426 zinc finger protein 426 1 1
MIRT025050 ESR1 estrogen receptor 1 1 1
MIRT025051 ATF7IP2 activating transcription factor 7 interacting protein 2 1 1
MIRT025052 PRR4 proline rich 4 (lacrimal) 1 1
MIRT025053 TCF21 transcription factor 21 1 1
MIRT025054 PHOX2A paired-like homeobox 2a 1 1
MIRT025055 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT025056 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT025057 GSTM2 glutathione S-transferase mu 2 (muscle) 1 1
MIRT025058 FSIP1 fibrous sheath interacting protein 1 1 1
MIRT025059 KBTBD3 kelch repeat and BTB (POZ) domain containing 3 1 1
MIRT025060 PTPRZ1 protein tyrosine phosphatase, receptor-type, Z polypeptide 1 1 1
MIRT025061 WNT3A wingless-type MMTV integration site family, member 3A 1 1
MIRT025062 TUSC1 tumor suppressor candidate 1 1 1
MIRT025063 LRRN3 leucine rich repeat neuronal 3 1 1
MIRT025064 TMEM45A transmembrane protein 45A 1 1
MIRT025065 ARF6 ADP-ribosylation factor 6 2 2
MIRT025066 C1orf109 chromosome 1 open reading frame 109 1 1
MIRT025067 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT025068 PLXDC2 plexin domain containing 2 1 1
MIRT025069 NMRK2 nicotinamide riboside kinase 2 1 1
MIRT025070 WNT2 wingless-type MMTV integration site family member 2 1 1
MIRT025071 ATG10 autophagy related 10 1 1
MIRT025072 PRDX3 peroxiredoxin 3 1 1
MIRT025073 ZNF652 zinc finger protein 652 1 1
MIRT025074 RTEL1-TNFRSF6B RTEL1-TNFRSF6B readthrough (non-protein coding) 1 1
MIRT025075 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 1 1
MIRT025076 PCDHB8 protocadherin beta 8 1 1
MIRT025077 ENAH enabled homolog (Drosophila) 1 1
MIRT025078 ZNF25 zinc finger protein 25 1 1
MIRT025079 TAF6L TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT025080 S100A1 S100 calcium binding protein A1 1 1
MIRT025081 PLA2G4C phospholipase A2, group IVC (cytosolic, calcium-independent) 1 1
MIRT025082 NOL4 nucleolar protein 4 1 1
MIRT025083 SIX6 SIX homeobox 6 1 1
MIRT025084 FKBP10 FK506 binding protein 10, 65 kDa 1 1
MIRT025085 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT025086 OR11A1 olfactory receptor, family 11, subfamily A, member 1 1 1
MIRT025087 INCENP inner centromere protein antigens 135/155kDa 2 2
MIRT025088 LPGAT1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT025089 CLUAP1 clusterin associated protein 1 1 1
MIRT025090 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 1
MIRT025091 CCDC6 coiled-coil domain containing 6 1 1
MIRT025092 BAG2 BCL2-associated athanogene 2 1 1
MIRT025093 GPR83 G protein-coupled receptor 83 1 1
MIRT025094 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1 1
MIRT025095 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT025096 RLF rearranged L-myc fusion 2 2
MIRT025097 FBXO28 F-box protein 28 1 1
MIRT025098 ZNF350 zinc finger protein 350 1 1
MIRT025099 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT025100 RNF34 ring finger protein 34, E3 ubiquitin protein ligase 1 1
MIRT025101 LCLAT1 lysocardiolipin acyltransferase 1 1 2
MIRT025102 KIAA1462 KIAA1462 1 1
MIRT025103 ZNF35 zinc finger protein 35 1 1
MIRT025104 PITPNB phosphatidylinositol transfer protein, beta 1 1
MIRT025105 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 3
MIRT025106 H3F3B H3 histone, family 3B (H3.3B) 1 1
MIRT025107 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT025108 LGALSL lectin, galactoside-binding-like 1 1
MIRT025109 TGIF2 TGFB-induced factor homeobox 2 1 1
MIRT025110 MOB1A MOB kinase activator 1A 1 1
MIRT025111 SLC35B4 solute carrier family 35, member B4 1 1
MIRT025112 FAM160A2 family with sequence similarity 160, member A2 1 2
MIRT025113 NUPL1 nucleoporin like 1 1 1
MIRT025114 GPRIN3 GPRIN family member 3 1 1
MIRT025115 H1F0 H1 histone family, member 0 1 1
MIRT025116 ARHGAP12 Rho GTPase activating protein 12 1 1
MIRT025117 SPRY2 sprouty homolog 2 (Drosophila) 1 1
MIRT025118 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT025119 TMED4 transmembrane emp24 protein transport domain containing 4 1 1
MIRT025120 MAP2K1 mitogen-activated protein kinase kinase 1 5 2
MIRT025121 PUM1 pumilio homolog 1 (Drosophila) 1 1
MIRT025122 TRIM2 tripartite motif containing 2 1 1
MIRT025123 FBXO33 F-box protein 33 1 1
MIRT025124 NRP1 neuropilin 1 2 2
MIRT025125 FAM47B family with sequence similarity 47, member B 1 1
MIRT025126 CCNG1 cyclin G1 2 2
MIRT025127 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT025128 OTUD1 OTU domain containing 1 2 2
MIRT025129 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT025130 WNT16 wingless-type MMTV integration site family, member 16 1 1
MIRT025131 CST5 cystatin D 1 1
MIRT025132 SH3BGRL SH3 domain binding glutamic acid-rich protein like 1 1
MIRT025133 GPR137B G protein-coupled receptor 137B 1 1
MIRT025134 OFCC1 orofacial cleft 1 candidate 1 1 1
MIRT025135 IQCG IQ motif containing G 2 2
MIRT025136 NKX3-2 NK3 homeobox 2 1 1
MIRT025137 OTX2 orthodenticle homeobox 2 1 1
MIRT025138 ROPN1L rhophilin associated tail protein 1-like 1 1
MIRT025139 TMEM14A transmembrane protein 14A 1 1
MIRT025140 TAF2 TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa 1 1
MIRT025141 IDS iduronate 2-sulfatase 1 1
MIRT025142 FRA10AC1 fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1 1 1
MIRT025143 COL27A1 collagen, type XXVII, alpha 1 1 1
MIRT025144 EPHA5 EPH receptor A5 1 1
MIRT025145 DCST1 DC-STAMP domain containing 1 1 1
MIRT025146 ZNF562 zinc finger protein 562 1 1
MIRT025147 EYA4 eyes absent homolog 4 (Drosophila) 1 1
MIRT025148 CHL1 cell adhesion molecule with homology to L1CAM (close homolog of L1) 1 1
MIRT025149 TAAR6 trace amine associated receptor 6 1 1
MIRT025150 SLCO2A1 solute carrier organic anion transporter family, member 2A1 1 1
MIRT025151 TMEM257 chromosome X open reading frame 1 1 1
MIRT025152 HMGB2 high mobility group box 2 1 1
MIRT025153 HERC3 HECT and RLD domain containing E3 ubiquitin protein ligase 3 1 1
MIRT025154 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT025155 SRPK2 SRSF protein kinase 2 1 1
MIRT025156 DNAJC7 DnaJ (Hsp40) homolog, subfamily C, member 7 1 1
MIRT025157 ANKRD1 ankyrin repeat domain 1 (cardiac muscle) 1 1
MIRT025158 CFI complement factor I 1 1
MIRT025159 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT025160 HEY2 hairy/enhancer-of-split related with YRPW motif 2 1 1
MIRT025161 MTMR12 myotubularin related protein 12 1 1
MIRT025162 ACOT12 acyl-CoA thioesterase 12 1 1
MIRT025163 KIAA0101 KIAA0101 1 1
MIRT025164 USP28 ubiquitin specific peptidase 28 1 1
MIRT025165 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 1 1
MIRT025166 BPGM 2,3-bisphosphoglycerate mutase 1 1
MIRT025167 DSCR8 Down syndrome critical region gene 8 1 1
MIRT025168 UGT3A1 UDP glycosyltransferase 3 family, polypeptide A1 1 1
MIRT025169 HSD17B3 hydroxysteroid (17-beta) dehydrogenase 3 1 1
MIRT025170 GADD45G growth arrest and DNA-damage-inducible, gamma 1 1
MIRT025171 FBXO34 F-box protein 34 1 1
MIRT025172 C1QTNF9 C1q and tumor necrosis factor related protein 9 1 1
MIRT025173 KLRC4 killer cell lectin-like receptor subfamily C, member 4 1 1
MIRT025174 MOB3B MOB kinase activator 3B 1 1
MIRT025175 FKBP7 FK506 binding protein 7 1 1
MIRT025176 TBX4 T-box 4 1 1
MIRT025177 TMPRSS11A transmembrane protease, serine 11A 1 1
MIRT025178 SNAI2 snail homolog 2 (Drosophila) 1 1
MIRT025179 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 1
MIRT025180 NUDT12 nudix (nucleoside diphosphate linked moiety X)-type motif 12 1 1
MIRT025181 COPS2 COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) 1 1
MIRT025182 ZNF12 zinc finger protein 12 1 1
MIRT025183 PRLR prolactin receptor 1 1
MIRT025184 PLCL2 phospholipase C-like 2 1 1
MIRT025185 ZNF594 zinc finger protein 594 1 1
MIRT025186 METAP1 methionyl aminopeptidase 1 1 1
MIRT025187 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT025188 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 3
MIRT025189 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT025190 SLC37A3 solute carrier family 37 (glycerol-3-phosphate transporter), member 3 1 1
MIRT025191 FBXO11 F-box protein 11 1 2
MIRT025192 ZNF445 zinc finger protein 445 1 1
MIRT025193 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT025194 ATP8A1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 1 1
MIRT025195 TMEM64 transmembrane protein 64 1 1
MIRT025196 MOB1B MOB kinase activator 1B 1 1
MIRT025197 GNAI3 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 1 1
MIRT025198 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT025199 SRSF7 serine/arginine-rich splicing factor 7 1 1
MIRT025200 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 4 5
MIRT025201 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 4 2
MIRT025202 LBR lamin B receptor 1 2
MIRT025203 GIGYF1 GRB10 interacting GYF protein 1 1 4
MIRT025204 KLHL42 kelch domain containing 5 1 1
MIRT025205 TMEM132B transmembrane protein 132B 1 1
MIRT025206 AFTPH aftiphilin 1 1
MIRT025207 ZNF148 zinc finger protein 148 1 1
MIRT025208 NOTCH2 notch 2 2 2
MIRT025209 NFYB nuclear transcription factor Y, beta 1 1
MIRT035538 NOTCH1 notch 1 2 1
MIRT047302 SIK2 salt-inducible kinase 2 1 1
MIRT047303 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT047304 FAM222B family with sequence similarity 222, member B 1 1
MIRT047305 RPS8 ribosomal protein S8 1 1
MIRT047306 STAG2 stromal antigen 2 1 1
MIRT047307 SMG1 smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT047308 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT047309 ZEB2 zinc finger E-box binding homeobox 2 1 1
MIRT047310 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT047311 RPL14 ribosomal protein L14 1 1
MIRT047312 KCTD2 potassium channel tetramerisation domain containing 2 1 1
MIRT047313 UBA2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT047314 DDX27 DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 1 1
MIRT047315 FAT1 FAT tumor suppressor homolog 1 (Drosophila) 1 1
MIRT047316 HDAC6 histone deacetylase 6 1 1
MIRT047317 TMEM192 transmembrane protein 192 1 1
MIRT047318 LAMA3 laminin, alpha 3 1 1
MIRT047319 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT047320 ND2 MTND2 1 1
MIRT047321 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT047322 OCA2 oculocutaneous albinism II 1 1
MIRT047323 AP1M1 adaptor-related protein complex 1, mu 1 subunit 1 1
MIRT047324 UCHL1 ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) 1 1
MIRT047325 PGD phosphogluconate dehydrogenase 1 1
MIRT047326 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 2
MIRT047327 AKAP12 A kinase (PRKA) anchor protein 12 1 1
MIRT047328 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT047329 GANAB glucosidase, alpha; neutral AB 1 1
MIRT047330 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT047331 H2AFY H2A histone family, member Y 1 1
MIRT047332 TEAD4 TEA domain family member 4 1 1
MIRT047333 KLHL15 kelch-like 15 (Drosophila) 1 2
MIRT047334 PRRC2B proline-rich coiled-coil 2B 1 1
MIRT047335 BRCA1 breast cancer 1, early onset 1 1
MIRT047336 SOGA2 SOGA family member 2 1 1
MIRT047337 KIAA0100 KIAA0100 1 1
MIRT047338 PPP1R9A protein phosphatase 1, regulatory subunit 9A 1 1
MIRT047339 MGAT5 mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase 1 1
MIRT047340 TNIP1 TNFAIP3 interacting protein 1 1 1
MIRT052976 PBX3 pre-B-cell leukemia homeobox 3 3 1
MIRT052992 TIMP1 TIMP metallopeptidase inhibitor 1 3 1
MIRT052993 PGR progesterone receptor 3 1
MIRT053039 COL16A1 collagen, type XVI, alpha 1 3 1
MIRT053196 PPP3CA protein phosphatase 3, catalytic subunit, alpha isozyme 1 1
MIRT053197 ATG5 autophagy related 5 2 1
MIRT053201 CD4 CD4 molecule 2 1
MIRT053662 TGFBRAP1 transforming growth factor, beta receptor associated protein 1 4 2
MIRT053663 TGFBR1 transforming growth factor, beta receptor 1 4 2
MIRT053664 TNFRSF11B tumor necrosis factor receptor superfamily, member 11b 1 1
MIRT053665 PCDHAC1 protocadherin alpha subfamily C, 1 1 1
MIRT053666 PCDHAC2 protocadherin alpha subfamily C, 2 1 1
MIRT053667 PCDHA1 protocadherin alpha 1 1 1
MIRT053668 PCDHA10 protocadherin alpha 10 1 1
MIRT053669 PCDHA11 protocadherin alpha 11 1 1
MIRT053670 PCDHA12 protocadherin alpha 12 1 1
MIRT053671 PCDHA13 protocadherin alpha 13 1 1
MIRT053672 PCDHA2 protocadherin alpha 2 1 1
MIRT053673 PCDHA3 protocadherin alpha 3 1 1
MIRT053674 PCDHA4 protocadherin alpha 4 1 1
MIRT053675 PCDHA5 protocadherin alpha 5 1 1
MIRT053676 PCDHA6 protocadherin alpha 6 1 1
MIRT053677 PCDHA7 protocadherin alpha 7 1 1
MIRT053678 PCDHA8 protocadherin alpha 8 1 1
MIRT053679 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 1 1
MIRT053680 BMP3 bone morphogenetic protein 3 1 1
MIRT053681 SOX5 SRY (sex determining region Y)-box 5 1 1
MIRT053682 MAP3K3 mitogen-activated protein kinase kinase kinase 3 2 2
MIRT053683 TAB3 TGF-beta activated kinase 1/MAP3K7 binding protein 3 1 1
MIRT053684 PDAP1 PDGFA associated protein 1 1 1
MIRT053685 MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1-like 1 1
MIRT053686 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 2 2
MIRT053687 SMAD2 SMAD family member 2 1 1
MIRT053688 MADD MAP-kinase activating death domain 1 1
MIRT053689 CDH13 cadherin 13, H-cadherin (heart) 1 1
MIRT053690 ACAN aggrecan 1 1
MIRT053691 MAP3K10 mitogen-activated protein kinase kinase kinase 10 1 1
MIRT053692 PCDHB6 protocadherin beta 6 1 1
MIRT053693 MAP4K4 mitogen-activated protein kinase kinase kinase kinase 4 1 1
MIRT053694 MMP14 matrix metallopeptidase 14 (membrane-inserted) 1 1
MIRT054422 E2F5 E2F transcription factor 5, p130-binding 3 1
MIRT054562 RAP1B RAP1B, member of RAS oncogene family 3 1
MIRT067357 C12ORF29 chromosome 12 open reading frame 29 2 1
MIRT068600 NHLRC3 NHL repeat containing 3 1 1
MIRT071713 CCNK cyclin K 1 2
MIRT074780 PAPD5 PAP associated domain containing 5 1 1
MIRT081041 CARM1 coactivator-associated arginine methyltransferase 1 1 1
MIRT081140 LDLR low density lipoprotein receptor 1 1
MIRT086584 C2ORF69 chromosome 2 open reading frame 69 1 1
MIRT088064 SEPT2 septin 2 1 2
MIRT097056 TNPO1 transportin 1 1 1
MIRT106868 PTBP3 polypyrimidine tract binding protein 3 1 1
MIRT128339 CUL5 cullin 5 1 1
MIRT131427 PRRC2C proline-rich coiled-coil 2C 1 1
MIRT133211 PEBP1 phosphatidylethanolamine binding protein 1 1 1
MIRT134656 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT137301 IPO5 importin 5 1 1
MIRT137700 RCOR1 REST corepressor 1 1 1
MIRT138427 KIF2C kinesin family member 2C 1 2
MIRT143445 CHD9 chromodomain helicase DNA binding protein 9 1 2
MIRT149117 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT149977 ZNF136 zinc finger protein 136 1 1
MIRT152745 KIF3B kinesin family member 3B 1 1
MIRT153572 TTPAL tocopherol (alpha) transfer protein-like 1 1
MIRT153852 NCOA3 nuclear receptor coactivator 3 1 1
MIRT161695 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT163342 PRKCD protein kinase C, delta 5 3
MIRT172788 SLC25A37 solute carrier family 25 (mitochondrial iron transporter), member 37 1 1
MIRT172871 CHCHD7 coiled-coil-helix-coiled-coil-helix domain containing 7 1 1
MIRT175455 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT182137 ADRBK1 adrenergic, beta, receptor kinase 1 1 1
MIRT183809 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 1
MIRT184927 ZNF268 zinc finger protein 268 1 1
MIRT194174 ZFAND6 zinc finger, AN1-type domain 6 1 3
MIRT199130 LMAN1 lectin, mannose-binding, 1 1 1
MIRT199773 MRPL34 mitochondrial ribosomal protein L34 1 1
MIRT202709 PDIA6 protein disulfide isomerase family A, member 6 1 1
MIRT210750 CHMP2B charged multivesicular body protein 2B 1 1
MIRT231560 DRAM1 DNA-damage regulated autophagy modulator 1 1 1
MIRT234620 KIAA0195 KIAA0195 1 1
MIRT234945 ZNF440 zinc finger protein 440 1 2
MIRT234951 ZNF439 zinc finger protein 439 1 1
MIRT237875 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 2
MIRT247903 KIAA1551 KIAA1551 1 1
MIRT252248 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT253450 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT256742 HIGD2A HIG1 hypoxia inducible domain family, member 2A 1 1
MIRT257371 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT273444 DAZAP2 DAZ associated protein 2 1 1
MIRT279875 ZFP36L1 zinc finger protein 36, C3H type-like 1 1 1
MIRT305128 SLC35G2 solute carrier family 35, member G2 1 1
MIRT314550 MTX3 metaxin 3 1 1
MIRT437399 ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 4 1
MIRT437649 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437650 SASH1 SAM and SH3 domain containing 1 2 1
MIRT437651 PHLDA1 pleckstrin homology-like domain, family A, member 1 2 1
MIRT437652 MOSPD1 motile sperm domain containing 1 2 1
MIRT437653 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 1
MIRT437654 UBL3 ubiquitin-like 3 2 1
MIRT437655 PHACTR4 phosphatase and actin regulator 4 2 1
MIRT437656 EREG epiregulin 2 1
MIRT437924 TERT telomerase reverse transcriptase 2 1
MIRT437942 RGS5 regulator of G-protein signaling 5 3 1
MIRT437969 IFNG interferon, gamma 3 1
MIRT438216 AHR aryl hydrocarbon receptor 2 1
MIRT438217 STAT3 signal transducer and activator of transcription 3 (acute-phase response factor) 2 1
MIRT438437 WIF1 WNT inhibitory factor 1 4 1
MIRT438509 TWIST1 twist homolog 1 (Drosophila) 1 1
MIRT438857 MAPK1 mitogen-activated protein kinase 1 4 1
MIRT445123 DCAF4 DDB1 and CUL4 associated factor 4 1 1
MIRT447015 RSF1 remodeling and spacing factor 1 1 1
MIRT451642 FAM96A family with sequence similarity 96, member A 1 1
MIRT467860 SLC25A25 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 1 1
MIRT470383 PPP2R5E protein phosphatase 2, regulatory subunit B', epsilon isoform 1 1
MIRT477002 FAM73B family with sequence similarity 73, member B 1 1
MIRT479955 CBX4 chromobox homolog 4 1 3
MIRT480026 CAPRIN2 caprin family member 2 1 2
MIRT498152 FKBP1C FK506 binding protein 1C 1 2
MIRT498526 ZNF83 zinc finger protein 83 1 4
MIRT499144 HSPA1B heat shock 70kDa protein 1B 1 4
MIRT499474 ZNF669 zinc finger protein 669 1 4
MIRT500270 ZNF788 zinc finger family member 788 1 3
MIRT500279 ZNF781 zinc finger protein 781 1 3
MIRT500299 ZNF667 zinc finger protein 667 1 4
MIRT500335 ZNF487P zinc finger protein 487, pseudogene 1 3
MIRT502621 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 1 3
MIRT507379 EPS8 epidermal growth factor receptor pathway substrate 8 1 2
MIRT513011 MAN1A2 mannosidase, alpha, class 1A, member 2 1 1
MIRT513569 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT519607 ZNF791 zinc finger protein 791 1 3
MIRT519846 ZFP69B zinc finger protein 643 1 2
MIRT520651 NPM3 nucleophosmin/nucleoplasmin 3 1 3
MIRT523128 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 2
MIRT526145 GJB7 gap junction protein, beta 7, 25kDa 1 1
MIRT528359 ZDHHC15 zinc finger, DHHC-type containing 15 1 1
MIRT529134 XPNPEP3 X-prolyl aminopeptidase (aminopeptidase P) 3, putative 1 1
MIRT532856 ZNF699 zinc finger protein 699 1 1
MIRT535284 PHOX2B paired-like homeobox 2b 1 1
MIRT535319 PHC3 polyhomeotic homolog 3 (Drosophila) 1 2
MIRT536908 HEPHL1 hephaestin-like 1 1 1
MIRT539055 ATP8B1 ATPase, aminophospholipid transporter, class I, type 8B, member 1 1 1
MIRT542777 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT543609 ZNF844 zinc finger protein 844 1 2
MIRT543636 ZNF780B zinc finger protein 780B 1 1
MIRT543952 NCOA7 nuclear receptor coactivator 7 1 1
MIRT544390 ZNF266 zinc finger protein 266 1 1
MIRT544463 KRBOX4 zinc finger family member 673 1 1
MIRT545438 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT546317 TMCC1 transmembrane and coiled-coil domain family 1 1 2
MIRT548177 FOXL1 forkhead box L1 1 2
MIRT551119 ZNF107 zinc finger protein 107 1 1
MIRT554022 SPIRE1 spire homolog 1 (Drosophila) 1 1
MIRT554674 RNF6 ring finger protein (C3H2C3 type) 6 1 2
MIRT555162 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT557276 HMGA2 high mobility group AT-hook 2 1 1
MIRT558550 CSNK1A1 casein kinase 1, alpha 1 1 1
MIRT559453 ARSJ arylsulfatase family, member J 1 1
MIRT559797 ZNF415 zinc finger protein 415 1 1
MIRT560747 ZNF616 zinc finger protein 616 1 1
MIRT560844 SUV39H2 suppressor of variegation 3-9 homolog 2 (Drosophila) 1 1
MIRT562334 FAM3C family with sequence similarity 3, member C 1 1
MIRT562767 ZNF846 zinc finger protein 846 1 1
MIRT564741 ZNF23 zinc finger protein 23 1 1
MIRT565163 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT567388 GTPBP3 GTP binding protein 3 (mitochondrial) 1 1
MIRT568682 IRAK1BP1 interleukin-1 receptor-associated kinase 1 binding protein 1 1 1
MIRT575088 Ddit4 DNA-damage-inducible transcript 4 1 1
MIRT575950 Unc5b unc-5 homolog B (C. elegans) 1 1
MIRT611626 SLC35G3 solute carrier family 35, member G3 1 1
MIRT613091 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 1 2
MIRT614684 UNC5B unc-5 homolog B (C. elegans) 1 2
MIRT620870 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT622409 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT624717 AP5M1 adaptor-related protein complex 5, mu 1 subunit 1 2
MIRT631079 ZNF829 zinc finger protein 829 1 1
MIRT633493 WDR72 WD repeat domain 72 1 1
MIRT635716 HFM1 HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae) 1 1
MIRT637039 SPTLC3 serine palmitoyltransferase, long chain base subunit 3 1 1
MIRT639503 SCN8A sodium channel, voltage gated, type VIII, alpha subunit 1 1
MIRT641325 ATXN7 ataxin 7 1 1
MIRT646844 TLDC1 KIAA1609 1 1
MIRT649738 RBM25 RNA binding motif protein 25 1 1
MIRT651418 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT660606 AP3M2 adaptor-related protein complex 3, mu 2 subunit 1 1
MIRT669768 ZNF556 zinc finger protein 556 1 1
MIRT683299 ZNF253 zinc finger protein 253 1 1
MIRT698129 TOPBP1 topoisomerase (DNA) II binding protein 1 1 1
MIRT698676 TEF thyrotrophic embryonic factor 1 1
MIRT702063 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT705938 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT707909 RSBN1L round spermatid basic protein 1-like 1 1
MIRT708830 KLHL24 kelch-like 24 (Drosophila) 1 1
MIRT708958 PDK3 pyruvate dehydrogenase kinase, isozyme 3 1 1
MIRT711041 RNF187 ring finger protein 187 1 1
MIRT711103 ZNF597 zinc finger protein 597 1 1
MIRT712563 CENPO centromere protein O 1 1
MIRT713217 FAM13A family with sequence similarity 13, member A 1 1
MIRT714106 RLIM ring finger protein, LIM domain interacting 1 1
MIRT715363 VCAM1 vascular cell adhesion molecule 1 1 1
MIRT716288 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT720070 ZNF449 zinc finger protein 449 1 1
MIRT722502 PNKD paroxysmal nonkinesigenic dyskinesia 1 1
MIRT725542 EN2 engrailed homeobox 2 1 1
MIRT726025 ZNF664 zinc finger protein 664 1 1
MIRT726057 ZNF121 zinc finger protein 121 1 1
MIRT726088 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT726178 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT726218 TUBB tubulin, beta class I 1 1
MIRT726225 TSG101 tumor susceptibility gene 101 1 1
MIRT726256 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT726274 TMF1 TATA element modulatory factor 1 1 1
MIRT726294 TMEM30A transmembrane protein 30A 1 1
MIRT726333 TFRC transferrin receptor (p90, CD71) 1 1
MIRT726352 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT726364 TBC1D7 TBC1 domain family, member 7 1 1
MIRT726375 TBC1D13 TBC1 domain family, member 13 1 1
MIRT726418 STX2 syntaxin 2 1 1
MIRT726436 STAG1 stromal antigen 1 1 1
MIRT726441 SSX2IP synovial sarcoma, X breakpoint 2 interacting protein 1 1
MIRT726459 SRGN serglycin 1 1
MIRT726474 SORT1 sortilin 1 1 1
MIRT726490 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 1
MIRT726518 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT726539 SLC38A2 solute carrier family 38, member 2 1 1
MIRT726557 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 1 1
MIRT726566 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT726571 SIPA1L1 signal-induced proliferation-associated 1 like 1 1 1
MIRT726581 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT726709 RP2 retinitis pigmentosa 2 (X-linked recessive) 1 1
MIRT726743 RHOG ras homolog family member G 1 1
MIRT726747 RGS16 regulator of G-protein signaling 16 1 1
MIRT726793 RAN RAN, member RAS oncogene family 1 1
MIRT726822 RAB2B RAB2B, member RAS oncogene family 1 1
MIRT726829 PURB purine-rich element binding protein B 1 1
MIRT726971 PGAP1 post-GPI attachment to proteins 1 1 1
MIRT726984 PER2 period homolog 2 (Drosophila) 1 1
MIRT727004 PBRM1 polybromo 1 1 1
MIRT727043 OSBPL3 oxysterol binding protein-like 3 1 1
MIRT727078 NMT2 N-myristoyltransferase 2 1 1
MIRT727081 FAM192A family with sequence similarity 192, member A 1 1
MIRT727086 NIN ninein (GSK3B interacting protein) 1 1
MIRT727100 NCAPG non-SMC condensin I complex, subunit G 1 1
MIRT727112 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT727132 MTUS1 microtubule associated tumor suppressor 1 1 1
MIRT727160 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT727181 KMT2E myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) 1 1
MIRT727287 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT727291 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT727332 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 1
MIRT727374 EFCAB14 KIAA0494 1 1
MIRT727382 KIAA0196 KIAA0196 1 1
MIRT727404 KDM5A lysine (K)-specific demethylase 5A 1 1
MIRT727450 INO80D INO80 complex subunit D 1 1
MIRT727459 IL1A interleukin 1, alpha 1 1
MIRT727494 HIST1H3D histone cluster 1, H3d 1 1
MIRT727507 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT727537 GOT1 glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) 1 1
MIRT727542 GOLGA8B golgin A8 family, member B 1 1
MIRT727551 GOLGA1 golgin A1 1 1
MIRT727558 GNS glucosamine (N-acetyl)-6-sulfatase 1 1
MIRT727578 GK5 glycerol kinase 5 (putative) 1 1
MIRT727625 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT727644 FSD1L fibronectin type III and SPRY domain containing 1-like 1 1
MIRT727705 FAM58A family with sequence similarity 58, member A 1 1
MIRT727757 EPS15 epidermal growth factor receptor pathway substrate 15 1 1
MIRT727802 EED embryonic ectoderm development 1 1
MIRT727835 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT727892 DDX52 DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 1 1
MIRT727945 CPOX coproporphyrinogen oxidase 1 1
MIRT727964 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT727984 CLCC1 chloride channel CLIC-like 1 1 1
MIRT728032 CCL22 chemokine (C-C motif) ligand 22 1 1
MIRT728039 CCDC88C coiled-coil domain containing 88C 1 1
MIRT728138 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 1
MIRT728158 GSKIP GSK3B interacting protein 1 1
MIRT728166 C11orf30 chromosome 11 open reading frame 30 1 1
MIRT728200 BLOC1S2 biogenesis of lysosomal organelles complex-1, subunit 2 1 1
MIRT728224 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT728256 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
MIRT728278 ATG2B autophagy related 2B 1 1
MIRT728296 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT728301 ARRDC3 arrestin domain containing 3 1 1
MIRT728304 ARRB2 arrestin, beta 2 1 1
MIRT728326 APOL6 apolipoprotein L, 6 1 1
MIRT728361 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT728380 AFF4 AF4/FMR2 family, member 4 1 1
MIRT728392 ACYP1 acylphosphatase 1, erythrocyte (common) type 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*