Accession ID: MIRT035924 [miRNA, hsa-miR-1180-3p :: TBX1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-1180LinkOut: [miRBase ]
Synonyms MIRN1180, hsa-mir-1180, MIR1180
Description Homo sapiens miR-1180 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-1180-3p
Mature Sequence 41| UUUCCGGCUCGCGUGGGUGUGU |62
Evidence Experimental
Experiments Cloned
Putative hsa-miR-1180-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TBX1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CAFS, CTHM, DGCR, DGS, DORV, TBX1C, TGA, VCFS
Description T-box 1
Transcript NM_0806    LinkOut: [ RefSeq ]
Other Transcripts NM_0806 , NM_0059   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TBX1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TBX1
(miRNA target sites are highlighted)
>TBX1|NM_0806|3'UTR
   1 TAACACGGGCCCTGTCGCGCTCCCGCCCCGGTCCTGCACAGCCCCGAAGTTCGCCGGGCCCGGCCACCCTGCCCCAAGGG
  81 CAAGCAAGGAATACGTTCCCCCAGCCCCAGGGGCCACCGCGGCTCTCCCCTTCCCCAGCCTCGAAGCCATGGGGGCCCCC
 161 TCGCCACCCCCAGCCCCTTGGGCTATCGAAGTATCCGGTTCCCCAGTCCCTGGAGCCACCGCGGGTCCTTCCCCGGCCCC
 241 GAGGGCCAAGGGGGTCCCCGCCCGCCAGTGCCAAAGCGCCCGGTCGGAGGCGGAAGGAAGTGATATTTATTGTTCTCCCC
 321 GAGACCGCGTCGCCCGCGGCCCGGCCGGCAGTTGCAGTGTAGACAGCCCGAGAGCCCCGCCTGCAGGCGGTGTAGATACA
 401 TGTAGATACTGTAGATACTGTAGATACCGCCCCGGCGCCGACTTGATAAACGGTTTCGCCTCTTTTGG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugUGUGGGU--GCGCUCGGCCUUu 5'
            :|:|||:  || ||| ||||| 
Target 5' aaGCGCCCGGTCG-GAGGCGGAAg 3'
274 - 296 133.00 -25.80
2
miRNA  3' uguGUGGGUGC--GCUCGGCCUUu 5'
             |:|||:||  | :||||| | 
Target 5' cgtCGCCCGCGGCCCGGCCGGCAg 3'
328 - 351 133.00 -25.72
3
miRNA  3' ugUGU--GGG-UGCGCUCGGCCUuu 5'
            |||  ||| | |:  |||||:  
Target 5' gcACAGCCCCGAAGTTCGCCGGGcc 3'
36 - 60 118.00 -21.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1180-3p :: TBX1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' tgtgtgggtgcgcTCGGCCTTt 5'
                       |||| ||: 
Target 5' ---------agacAGCCCGAGa 3'
1 - 13
2
miRNA  3' tgtgtGGGTGCGC-TCGGCCTTT-- 5'
               |||:| :| || ||| :   
Target 5' agagcCCCGCCTGCAGGCGGTGTAG 3'
11 - 35
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
48 hsa-miR-1180-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT035908 FAM200B family with sequence similarity 200, member B 1 1
MIRT035910 SYNRG synergin, gamma 1 1
MIRT035911 KLC4 kinesin light chain 4 1 1
MIRT035912 FUT7 fucosyltransferase 7 (alpha (1,3) fucosyltransferase) 1 1
MIRT035913 TRAP1 TNF receptor-associated protein 1 1 1
MIRT035914 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT035915 STIP1 stress-induced-phosphoprotein 1 1 1
MIRT035916 C16orf62 chromosome 16 open reading frame 62 1 1
MIRT035917 THOC2 THO complex 2 1 1
MIRT035918 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT035919 HPS4 Hermansky-Pudlak syndrome 4 1 1
MIRT035920 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT035921 PSMD1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 1 1
MIRT035922 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 1 1
MIRT035923 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT035924 TBX1 T-box 1 1 1
MIRT035925 EZR ezrin 1 1
MIRT035926 USP9X ubiquitin specific peptidase 9, X-linked 1 1
MIRT035927 TAF3 TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa 1 1
MIRT035928 CSK c-src tyrosine kinase 1 1
MIRT035929 TPR translocated promoter region (to activated MET oncogene) 1 1
MIRT035930 TUBB tubulin, beta 1 1
MIRT035931 MCM6 minichromosome maintenance complex component 6 1 1
MIRT035932 RPL35 ribosomal protein L35 1 1
MIRT035933 HIST1H1E histone cluster 1, H1e 1 1
MIRT035934 ZMIZ1 zinc finger, MIZ-type containing 1 1 1
MIRT035935 ATIC 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase 1 1
MIRT035936 PRRC2A HLA-B associated transcript 2 1 1
MIRT035937 PCBP1 poly(rC) binding protein 1 1 1
MIRT035938 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT035939 GRHPR glyoxylate reductase/hydroxypyruvate reductase 1 1
MIRT035940 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT035941 GPI glucose-6-phosphate isomerase 1 1
MIRT035942 RPL27A ribosomal protein L27a 1 1
MIRT035943 RPL4 ribosomal protein L4 1 1
MIRT035944 RPLP1 ribosomal protein, large, P1 1 1
MIRT035945 DHX8 DEAH (Asp-Glu-Ala-His) box polypeptide 8 1 1
MIRT035946 TSPAN9 tetraspanin 9 1 1
MIRT035947 C6orf62 chromosome 6 open reading frame 62 1 1
MIRT035948 KHSRP KH-type splicing regulatory protein 1 1
MIRT035949 USP5 ubiquitin specific peptidase 5 (isopeptidase T) 1 1
MIRT035950 RPL19 ribosomal protein L19 1 1
MIRT035951 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT035952 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT035953 ACTG1 actin, gamma 1 1 1
MIRT035954 SRSF4 splicing factor, arginine/serine-rich 4 1 1
MIRT035955 POLR2I polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa 1 1
MIRT035956 ZCCHC14 zinc finger, CCHC domain containing 14 1 1