Accession ID: MIRT036107 [miRNA, hsa-miR-1296-5p :: CTSA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-1296LinkOut: [miRBase ]
Synonyms MIRN1296, hsa-mir-1296, MIR1296
Description Homo sapiens miR-1296 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-1296-5p
Mature Sequence 16| UUAGGGCCCUGGCUCCAUCUCC |37
Evidence Experimental
Experiments Solexa
Putative hsa-miR-1296-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CTSA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GLB2, GSL, NGBE, PPCA, PPGB
Description cathepsin A
Transcript NM_0011675    LinkOut: [ RefSeq ]
Other Transcripts NM_0011276 , NM_0003   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTSA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTSA
(miRNA target sites are highlighted)
>CTSA|NM_0011675|3'UTR
   1 CAGCCATACTGATGACCACAGCAACCAGCTCCACGGCCTGATGCAGCCCCTCCCAGCCTCTCCCGCTAGGAGAGTCCTCT
  81 TCTAAGCAAAGTGCCCCTGCAGGCCGGGTTCTGCCGCCAGGACTGCCCCCTTCCCAGAGCCCTGTACATCCCAGACTGGG
 161 CCCAGGGTCTCCCATAGACAGCCTGGGGGCAAGTTAGCACTTTATTCCCGCAGCAGTTCCTGAATGGGGTGGCCTGGCCC
 241 CTTCTCTGCTTAAAGAATGCCCTTTATGATGCACTGATTCCATCCCAGGAACCCAACAGAGCTCAGGACAGCCCACAGGG
 321 AGGTGGTGGACGGACTGTAATTGATAGATTGATTATGGAATTAAATTGGGTACAGCTTCAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ccucUACCUCG--GUCCCGGGauu 5'
              ||||:|:  |  |||||   
Target 5' ctgaATGGGGTGGCCTGGCCCctt 3'
220 - 243 116.00 -20.80
2
miRNA  3' ccucuaccUCGGUCCCGGGauu 5'
                  || | ||||||   
Target 5' tacatcccAGACTGGGCCCagg 3'
145 - 166 114.00 -15.84
3
miRNA  3' ccucuACCUCGGUCCCGGGAUu 5'
               || || | |||::||: 
Target 5' gccccTGCAGGCCGGGTTCTGc 3'
93 - 114 113.00 -15.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1296-5p :: CTSA    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' cctctaccTCGGTCCCGGGatt 5'
                  || | ||||||   
Target 5' ---atcccAGACTGGGCCCagg 3'
1 - 19
2
miRNA  3' ccTCTACCTCGG--TCCCGggatt 5'
            |||   ||||  :||||     
Target 5' atAGA--CAGCCTGGGGGCaagtt 3'
27 - 48
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
88 hsa-miR-1296-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000473 MCM2 minichromosome maintenance complex component 2 3 1
MIRT036068 C1orf112 chromosome 1 open reading frame 112 1 1
MIRT036069 TAF1D TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa 1 1
MIRT036070 BRAP BRCA1 associated protein 1 1
MIRT036071 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like 1 1
MIRT036072 CHD3 chromodomain helicase DNA binding protein 3 1 1
MIRT036073 GOLGA5 golgin A5 1 1
MIRT036074 NUDT21 nudix (nucleoside diphosphate linked moiety X)-type motif 21 1 1
MIRT036075 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT036076 BCL2L2 BCL2-like 2 1 1
MIRT036077 BRD7 bromodomain containing 7 1 1
MIRT036078 YBX1 Y box binding protein 1 1 1
MIRT036079 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT036080 POLR2F polymerase (RNA) II (DNA directed) polypeptide F 1 1
MIRT036081 AKT2 v-akt murine thymoma viral oncogene homolog 2 1 1
MIRT036082 CAPRIN1 cell cycle associated protein 1 1 1
MIRT036083 SHISA5 shisa homolog 5 (Xenopus laevis) 1 1
MIRT036084 TMPO thymopoietin 1 1
MIRT036085 SIGMAR1 sigma non-opioid intracellular receptor 1 1 1
MIRT036086 SMU1 smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) 1 1
MIRT036087 HYOU1 hypoxia up-regulated 1 1 1
MIRT036088 RPS16 ribosomal protein S16 1 1
MIRT036089 HCFC1 host cell factor C1 (VP16-accessory protein) 1 1
MIRT036090 RPS10 ribosomal protein S10 1 1
MIRT036091 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT036092 IPO5 importin 5 1 1
MIRT036093 GPI glucose-6-phosphate isomerase 1 1
MIRT036094 OVCH2 ovochymase 2 (gene/pseudogene) 1 1
MIRT036095 HOXA3 homeobox A3 1 1
MIRT036096 TBC1D25 TBC1 domain family, member 25 1 1
MIRT036097 YKT6 YKT6 v-SNARE homolog (S. cerevisiae) 1 1
MIRT036098 TNFAIP1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 1 1
MIRT036099 C9orf78 chromosome 9 open reading frame 78 1 1
MIRT036100 DCTN1 dynactin 1 (p150, glued homolog, Drosophila) 1 1
MIRT036101 GANAB glucosidase, alpha; neutral AB 1 1
MIRT036102 RPS6KB2 ribosomal protein S6 kinase, 70kDa, polypeptide 2 1 1
MIRT036103 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT036104 TNKS1BP1 tankyrase 1 binding protein 1, 182kDa 1 1
MIRT036105 DLX2 distal-less homeobox 2 1 1
MIRT036106 ADCY3 adenylate cyclase 3 1 1
MIRT036107 CTSA cathepsin A 1 1
MIRT036108 CHD8 chromodomain helicase DNA binding protein 8 1 1
MIRT036109 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT036110 MPRIP myosin phosphatase Rho interacting protein 1 1
MIRT036111 PPP6R1 SAPS domain family, member 1 1 1
MIRT036112 RNF20 ring finger protein 20 1 1
MIRT036113 NTN1 netrin 1 1 1
MIRT036114 MED29 mediator complex subunit 29 1 1
MIRT036115 FUS fused in sarcoma 1 1
MIRT036116 PAF1 Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) 1 1
MIRT036117 HK1 hexokinase 1 1 1
MIRT036118 AGAP4 ArfGAP with GTPase domain, ankyrin repeat and PH domain 4 1 1
MIRT036119 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT036120 RPL3 ribosomal protein L3 1 1
MIRT036121 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) 1 1
MIRT036122 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT036123 COPG1 coatomer protein complex, subunit gamma 1 1
MIRT036124 RPS9 ribosomal protein S9 1 1
MIRT036125 RTKN rhotekin 1 1
MIRT036126 PCBP1 poly(rC) binding protein 1 1 1
MIRT036127 MTUS1 microtubule associated tumor suppressor 1 1 1
MIRT036128 BMS1 BMS1 homolog, ribosome assembly protein (yeast) 1 1
MIRT036129 VCP valosin-containing protein 1 1
MIRT036130 TTYH3 tweety homolog 3 (Drosophila) 1 1
MIRT036131 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT036132 ZNF549 zinc finger protein 549 1 1
MIRT036133 ZNF792 zinc finger protein 792 1 1
MIRT036134 CRTAP cartilage associated protein 1 1
MIRT036135 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT036136 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 1 1
MIRT036137 CRYZ crystallin, zeta (quinone reductase) 1 1
MIRT036138 PNP purine nucleoside phosphorylase 1 1
MIRT036139 UST uronyl-2-sulfotransferase 1 1
MIRT036140 DAP3 death associated protein 3 1 1
MIRT036141 TIMM13 translocase of inner mitochondrial membrane 13 homolog (yeast) 1 1
MIRT036142 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT036143 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT036144 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT036145 RNPS1 RNA binding protein S1, serine-rich domain 1 1
MIRT036146 NDUFS5 NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) 1 1
MIRT036147 KPNB1 karyopherin (importin) beta 1 1 1
MIRT036148 AAAS achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A) 1 1
MIRT036149 C20orf96 chromosome 20 open reading frame 96 1 1
MIRT036150 DPP3 dipeptidyl-peptidase 3 1 1
MIRT036151 WIZ widely interspaced zinc finger motifs 1 1
MIRT036152 UQCRC1 ubiquinol-cytochrome c reductase core protein I 1 1
MIRT036153 CECR2 cat eye syndrome chromosome region, candidate 2 1 1
MIRT036154 IFNGR2 interferon gamma receptor 2 (interferon gamma transducer 1) 1 1