Accession ID: MIRT036268 [miRNA, hsa-miR-1229-3p :: CPT1B, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-1229LinkOut: [miRBase ]
Synonyms MIRN1229, hsa-mir-1229, MIR1229
Description Homo sapiens miR-1229 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-1229-3p
Mature Sequence 47| CUCUCACCACUGCCCUCCCACAG |69
Evidence Experimental
Experiments Cloned
Putative hsa-miR-1229-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CPT1B LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CPT1-M, CPT1M, CPTI, FLJ55729, FLJ58750, KIAA1670, M-CPT1, MCCPT1, MCPT1
Description carnitine palmitoyltransferase 1B (muscle)
Transcript NM_1522    LinkOut: [ RefSeq ]
Other Transcripts NM_0011451 , NM_0011451 , NM_0011451 , NM_0011451 , NM_0043 , NM_1522   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CPT1B LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CPT1B
(miRNA target sites are highlighted)
>CPT1B|NM_1522|3'UTR
   1 TGAAGGTTGGAGAAATGCCAGCTGCCCTTTCGTCCCCACACTGTGGAGGAAGGGACCTGTGGCAGCTCACAGGCATGAGG
  81 GGTGGCCGTGCACAGGTGCCCAGGCTCCAAGGACAGCTCCGGCAGCAGGTCCTCGCTGGGCAGATGCTGCTCCCTGAGGG
 161 CCCAGGTGGTGGAGGTGGGGTTGGAGCAGGAAGGGAATTTTGATTTTTTTTTTTCTTGATAGATACTAATAAAAATAAGG
 241 CTGTGTAATTTTCTCTCAGCCCTTAGGTACCTGTGTTTTGTTTGGGAACTCGGAGGCCCTCCCCCTCCCCCAGCTCAGAC
 321 CACAGAGGTGGCAAGAGAAGGGCTGAAGCTGGAAGACTGTTCATGAGGGACTTGTGTGACCTGCTTTGAAATGTGTGACT
 401 CTGCTGAGTGACGTAGGCTCTGAGATAGCTGTCCACGCCCACGTGTTTGCTTGGAATAAATACTTGCCTCAGAACCTTCA
 481 AAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaCACCC---UC--CCGUCACCACUCUc 5'
            | |||   ||  ||::| ||||:|: 
Target 5' ctGAGGGCCCAGGTGGTGGAGGTGGGGt 3'
154 - 181 127.00 -22.84
2
miRNA  3' gaCACCCUCCCGUCACC--ACUCUc 5'
            |||| ||  ||  ||  ||||: 
Target 5' ctGTGGCAGCTCACAGGCATGAGGg 3'
57 - 81 109.00 -19.50
3
miRNA  3' gacaccCUCCCGUCACCACUCUc 5'
                ||   ||| ||||: | 
Target 5' agctcaGACCACAGAGGTGGCAa 3'
312 - 334 105.00 -11.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1229-3p :: CPT1B    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gacACCCTCCCGTCACCACTCTc 5'
             || ||| | | |||||:|| 
Target 5' --aTGTGAGTG-ACTGGTGGGAa 3'
1 - 20
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
134 hsa-miR-1229-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT036258 VWA8 KIAA0564 1 1
MIRT036259 SORBS3 sorbin and SH3 domain containing 3 1 1
MIRT036260 HIST1H3A histone cluster 1, H3a 1 1
MIRT036261 TIA1 TIA1 cytotoxic granule-associated RNA binding protein 1 1
MIRT036262 COIL coilin 1 1
MIRT036263 PBRM1 polybromo 1 1 1
MIRT036264 KRT28 keratin 28 1 1
MIRT036265 RPL7A ribosomal protein L7a 1 1
MIRT036266 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT036267 CEP152 centrosomal protein 152kDa 1 1
MIRT036268 CPT1B carnitine palmitoyltransferase 1B (muscle) 1 1
MIRT036269 CEP55 centrosomal protein 55kDa 1 1
MIRT036270 ZMYM2 zinc finger, MYM-type 2 1 1
MIRT036271 CRISP3 cysteine-rich secretory protein 3 1 1
MIRT036272 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT036273 ADPRHL2 ADP-ribosylhydrolase like 2 1 1
MIRT036274 PHRF1 PHD and ring finger domains 1 1 1
MIRT036275 RPL3 ribosomal protein L3 1 1
MIRT036276 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT036277 PTPRF protein tyrosine phosphatase, receptor type, F 1 1
MIRT036278 ZNF264 zinc finger protein 264 1 1
MIRT036279 AHCYL1 adenosylhomocysteinase-like 1 1 1
MIRT036280 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT036281 INTS10 integrator complex subunit 10 1 1
MIRT036282 TARDBP TAR DNA binding protein 1 1
MIRT036283 CTNND1 catenin (cadherin-associated protein), delta 1 1 1
MIRT036284 KCTD15 potassium channel tetramerisation domain containing 15 1 1
MIRT036285 CEP350 centrosomal protein 350kDa 1 1
MIRT036286 C19orf10 chromosome 19 open reading frame 10 1 1
MIRT036287 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT036288 CHCHD2 coiled-coil-helix-coiled-coil-helix domain containing 2 1 1
MIRT036289 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 1
MIRT036290 PHC1 polyhomeotic homolog 1 (Drosophila) 1 1
MIRT036291 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) 1 1
MIRT036292 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT036293 AIF1L allograft inflammatory factor 1-like 1 1
MIRT036294 NEU3 sialidase 3 (membrane sialidase) 1 1
MIRT036295 DCTD dCMP deaminase 1 1
MIRT036296 TUBA1B tubulin, alpha 1b 1 1
MIRT036297 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 1 1
MIRT036298 ACOT7 acyl-CoA thioesterase 7 1 1
MIRT036299 MDK midkine (neurite growth-promoting factor 2) 1 1
MIRT036300 INO80D INO80 complex subunit D 1 1
MIRT036301 LDOC1L leucine zipper, down-regulated in cancer 1-like 1 1
MIRT036302 C2orf44 chromosome 2 open reading frame 44 1 1
MIRT036303 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT036304 EPB41L2 erythrocyte membrane protein band 4.1-like 2 1 1
MIRT036305 REXO2 REX2, RNA exonuclease 2 homolog (S. cerevisiae) 1 1
MIRT036306 CTNNBL1 catenin, beta like 1 1 1
MIRT036307 SAFB scaffold attachment factor B 1 1
MIRT036308 PPP6R1 SAPS domain family, member 1 1 1
MIRT036309 FEN1 flap structure-specific endonuclease 1 1 1
MIRT036310 LRBA LPS-responsive vesicle trafficking, beach and anchor containing 1 1
MIRT036311 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT036312 DAG1 dystroglycan 1 (dystrophin-associated glycoprotein 1) 1 1
MIRT036313 HYPK chromosome 15 open reading frame 63 1 1
MIRT036314 HIST1H4C histone cluster 1, H4c 1 1
MIRT036315 CDC42EP4 CDC42 effector protein (Rho GTPase binding) 4 1 1
MIRT036316 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT036317 GTF2I general transcription factor IIi 1 1
MIRT036318 RPGRIP1L RPGRIP1-like 1 1
MIRT036319 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT036320 TRRAP transformation/transcription domain-associated protein 1 1
MIRT036321 PHF8 PHD finger protein 8 1 1
MIRT036322 TSC22D3 TSC22 domain family, member 3 1 1
MIRT036323 MPP2 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) 1 1
MIRT036324 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT036325 ALS2 amyotrophic lateral sclerosis 2 (juvenile) 1 1
MIRT036326 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT036327 ITGA5 integrin, alpha 5 (fibronectin receptor, alpha polypeptide) 1 1
MIRT036328 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 1
MIRT036329 KIF24 kinesin family member 24 1 1
MIRT036330 PPP4C protein phosphatase 4, catalytic subunit 1 1
MIRT036331 FMNL2 formin-like 2 1 1
MIRT036332 NF2 neurofibromin 2 (merlin) 1 1
MIRT036333 NUP210 nucleoporin 210kDa 1 1
MIRT036334 CTDNEP1 dullard homolog (Xenopus laevis) 1 1
MIRT036335 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT036336 CTCF CCCTC-binding factor (zinc finger protein) 1 1
MIRT036337 LRIT1 leucine-rich repeat, immunoglobulin-like and transmembrane domains 1 1 1
MIRT036338 SFPQ splicing factor proline/glutamine-rich 1 1
MIRT036339 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT036340 NAPEPLD N-acyl phosphatidylethanolamine phospholipase D 1 1
MIRT036341 SLC39A7 solute carrier family 39 (zinc transporter), member 7 1 1
MIRT036342 KDM5C lysine (K)-specific demethylase 5C 1 1
MIRT036343 ACLY ATP citrate lyase 1 1
MIRT036344 MED19 mediator complex subunit 19 1 1
MIRT036345 SRP72 signal recognition particle 72kDa 1 1
MIRT036346 RUVBL2 RuvB-like 2 (E. coli) 1 1
MIRT036347 CLSTN3 calsyntenin 3 1 1
MIRT036348 SAE1 SUMO1 activating enzyme subunit 1 1 1
MIRT036349 TUBG1 tubulin, gamma 1 1 1
MIRT036350 FOXP1 forkhead box P1 1 1
MIRT036351 ZNF687 zinc finger protein 687 1 1
MIRT036352 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT036353 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 1 1
MIRT036354 RNF40 ring finger protein 40 1 1
MIRT036355 KPNB1 karyopherin (importin) beta 1 1 1
MIRT036356 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT036357 DDX23 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 1 1
MIRT036358 BET1L blocked early in transport 1 homolog (S. cerevisiae)-like 1 1
MIRT036359 BRD2 bromodomain containing 2 1 1
MIRT036360 EML1 echinoderm microtubule associated protein like 1 1 1
MIRT036361 BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 1 1
MIRT036362 STAT5B signal transducer and activator of transcription 5B 1 1
MIRT036363 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT036364 GPI glucose-6-phosphate isomerase 1 1
MIRT036365 PTBP3 ROD1 regulator of differentiation 1 (S. pombe) 1 1
MIRT036366 RPS15 ribosomal protein S15 1 1
MIRT036367 ZDHHC7 zinc finger, DHHC-type containing 7 1 1
MIRT036368 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT036369 SNX12 sorting nexin 12 1 1
MIRT036370 OTUD7B OTU domain containing 7B 1 1
MIRT036371 AP2M1 adaptor-related protein complex 2, mu 1 subunit 1 1
MIRT036372 C9orf114 chromosome 9 open reading frame 114 1 1
MIRT036373 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT036374 FOXK1 forkhead box K1 1 1
MIRT036375 SIK2 salt-inducible kinase 2 1 1
MIRT036376 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT036377 PHGDH phosphoglycerate dehydrogenase 1 1
MIRT036378 PITPNB phosphatidylinositol transfer protein, beta 1 1
MIRT036379 MAD2L2 MAD2 mitotic arrest deficient-like 2 (yeast) 1 1
MIRT036380 TUSC3 tumor suppressor candidate 3 1 1
MIRT036381 PRKRIP1 PRKR interacting protein 1 (IL11 inducible) 1 1
MIRT036382 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT036383 NME2 non-metastatic cells 2, protein (NM23B) expressed in 1 1
MIRT036384 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT036385 SLC16A13 solute carrier family 16, member 13 (monocarboxylic acid transporter 13) 1 1
MIRT036386 PRDX4 peroxiredoxin 4 1 1
MIRT036387 NXPE3 family with sequence similarity 55, member C 1 1
MIRT036388 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT036389 CPNE1 copine I 1 1
MIRT036390 PSMC5 proteasome (prosome, macropain) 26S subunit, ATPase, 5 1 1
MIRT036391 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 1 1