Accession ID: MIRT036408 [miRNA, hsa-miR-1227-3p :: LAMP1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-1227LinkOut: [miRBase ]
Synonyms MIRN1227, hsa-mir-1227, MIR1227
Description Homo sapiens miR-1227 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-1227-3p
Mature Sequence 69| CGUGCCACCCUUUUCCCCAG |88
Evidence Experimental
Experiments Cloned
Putative hsa-miR-1227-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LAMP1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CD107a, LAMPA, LGP120
Description lysosomal-associated membrane protein 1
Transcript NM_0055    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LAMP1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of LAMP1
(miRNA target sites are highlighted)
>LAMP1|NM_0055|3'UTR
   1 TAGCCTGGTGCACGCAGGCACAGCAGCTGCAGGGGCCTCTGTTCCTTTCTCTGGGCTTAGGGTCCTGTCGAAGGGGAGGC
  81 ACACTTTCTGGCAAACGTTTCTCAAATCTGCTTCATCCAATGTGAAGTTCATCTTGCAGCATTTACTATGCACAACAGAG
 161 TAACTATCGAAATGACGGTGTTAATTTTGCTAACTGGGTTAAATATTTTGCTAACTGGTTAAACATTAATATTTACCAAA
 241 GTAGGATTTTGAGGGTGGGGGTGCTCTCTCTGAGGGGGTGGGGGTGCCGCTGTCTCTGAGGGGTGGGGGTGCCGCTGTCT
 321 CTGAGGGGTGGGGGTGCCGCTCTCTCTGAGGGGGTGGGGGTGCCGCTTTCTCTGAGGGGGTGGGGGTGCCGCTCTCTCTG
 401 AGGGGGTGGGGGTGCTGCTCTCTCCGAGGGGTGGAATGCCGCTGTCTCTGAGGGGTGGGGGTGCCGCTCTAAATTGGCTC
 481 CATATCATTTGAGTTTAGGGTTCTGGTGTTTGGTTTCTTCATTCTTTACTGCACTCAGATTTAAGCCTTACAAAGGGAAA
 561 GCCTCTGGCCGTCACACGTAGGACGCATGAAGGTCACTCGTGGTGAGGCTGACATGCTCACACATTACAACAGTAGAGAG
 641 GGAAAATCCTAAGACAGAGGAACTCCAGAGATGAGTGTCTGGAGCGCTTCAGTTCAGCTTTAAAGGCCAGGACGGGCCAC
 721 ACGTGGCTGGCGGCCTCGTTCCAGTGGCGGCACGTCCTTGGGCGTCTCTAATGTCTGCAGCTCAAGGGCTGGCACTTTTT
 801 TAAATATAAAAATGGGTGTTATTTTTATTTTTTTTTGTAAAGTGATTTTTGGTCTTCTGTTGACATTCGGGGTGATCCTG
 881 TTCTGCGCTGTGTACAATGTGAGATCGGTGCGTTCTCCTGATGTTTTGCCGTGGCTTGGGGATTGTACACGGGACCAGCT
 961 CACGTAATGCATTGCCTGTAACAATGTAATAAAAAGCCTCTTTCTTTTAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaccccUUUUCCCACCGUGc 5'
                :||:||| ||||| 
Target 5' cctgtcGAAGGGGAGGCACa 3'
64 - 83 130.00 -17.60
2
miRNA  3' gaccccuUUUCCCACCGUGc 5'
                 ||:|| |||||| 
Target 5' gcagctcAAGGGCTGGCACt 3'
777 - 796 129.00 -14.70
3
miRNA  3' gaCCCCUUUUCCCACCGUGc 5'
            ||||: ::||||| |:| 
Target 5' gaGGGGGTGGGGGTGCCGCt 3'
272 - 291 122.00 -22.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1227-3p :: LAMP1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gacCCCTTTTCCCACCGTgc 5'
             | ||:||||||| ||  
Target 5' gcaGAGAGAAGGGTGTCAgg 3'
26 - 45
2
miRNA  3' gaCCCCTTTTCCCACCGtgc 5'
            ||||  :|||||||:   
Target 5' acGGGGTTGAGGGTGGTctc 3'
3 - 22
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
15 hsa-miR-1227-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT036394 MTFR1 mitochondrial fission regulator 1 1 1
MIRT036395 ANAPC5 anaphase promoting complex subunit 5 1 1
MIRT036396 TSC22D2 TSC22 domain family, member 2 1 1
MIRT036397 ACTG1 actin, gamma 1 1 1
MIRT036398 RPSA ribosomal protein SA 1 1
MIRT036399 TRPM5 transient receptor potential cation channel, subfamily M, member 5 1 1
MIRT036400 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT036401 VWA8 KIAA0564 1 1
MIRT036402 CCT4 chaperonin containing TCP1, subunit 4 (delta) 1 1
MIRT036403 FAM3C family with sequence similarity 3, member C 1 1
MIRT036404 TXLNA taxilin alpha 1 1
MIRT036405 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT036406 SPNS1 spinster homolog 1 (Drosophila) 1 1
MIRT036407 CDC123 cell division cycle 123 homolog (S. cerevisiae) 1 1
MIRT036408 LAMP1 lysosomal-associated membrane protein 1 1 1