Accession ID: MIRT036408 [miRNA, hsa-miR-1227-3p :: LAMP1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-1227LinkOut: [miRBase ]
Synonyms MIRN1227, hsa-mir-1227, MIR1227
Description Homo sapiens miR-1227 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-1227-3p
Mature Sequence 69| CGUGCCACCCUUUUCCCCAG |88
Evidence Experimental
Experiments Cloned
Putative hsa-miR-1227-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1227-3p :: LAMP1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gacCCCTTTTCCCACCGTgc 5'
             | ||:||||||| ||  
Target 5' gcaGAGAGAAGGGTGTCAgg 3'
26 - 45
2
miRNA  3' gaCCCCTTTTCCCACCGtgc 5'
            ||||  :|||||||:   
Target 5' acGGGGTTGAGGGTGGTctc 3'
3 - 22
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
144 hsa-miR-1227-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT036394 MTFR1 mitochondrial fission regulator 1 1 1
MIRT036395 ANAPC5 anaphase promoting complex subunit 5 1 1
MIRT036396 TSC22D2 TSC22 domain family, member 2 1 1
MIRT036397 ACTG1 actin, gamma 1 1 1
MIRT036398 RPSA ribosomal protein SA 1 1
MIRT036399 TRPM5 transient receptor potential cation channel, subfamily M, member 5 1 1
MIRT036400 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT036401 VWA8 von Willebrand factor A domain containing 8 1 1
MIRT036402 CCT4 chaperonin containing TCP1, subunit 4 (delta) 1 1
MIRT036403 FAM3C family with sequence similarity 3, member C 1 1
MIRT036404 TXLNA taxilin alpha 1 2
MIRT036405 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT036406 SPNS1 spinster homolog 1 (Drosophila) 1 1
MIRT036407 CDC123 cell division cycle 123 homolog (S. cerevisiae) 1 1
MIRT036408 LAMP1 lysosomal-associated membrane protein 1 1 1
MIRT072611 KIAA0101 KIAA0101 1 2
MIRT099162 MYLIP myosin regulatory light chain interacting protein 1 1
MIRT244121 RAB32 RAB32, member RAS oncogene family 1 1
MIRT442012 NDUFA4P1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa, pseudogene 1 1 1
MIRT442532 MOB3B MOB kinase activator 3B 1 1
MIRT443179 DENND4C DENN/MADD domain containing 4C 1 1
MIRT443218 TRDMT1 tRNA aspartic acid methyltransferase 1 1 1
MIRT443413 HOXA1 homeobox A1 1 1
MIRT443738 INSL4 insulin-like 4 (placenta) 1 1
MIRT443791 UBASH3B ubiquitin associated and SH3 domain containing B 1 1
MIRT452479 DDX4 DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 1 1
MIRT454563 NT5DC3 5'-nucleotidase domain containing 3 1 1
MIRT458098 TTLL1 tubulin tyrosine ligase-like family, member 1 1 1
MIRT458492 MARVELD2 MARVEL domain containing 2 1 1
MIRT459080 LSM1 LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT460482 FAM105A family with sequence similarity 105, member A 1 1
MIRT461948 C3 complement component 3 1 2
MIRT465739 TMPPE transmembrane protein with metallophosphoesterase domain 1 1
MIRT468396 SETD3 SET domain containing 3 1 1
MIRT469530 RBBP8 retinoblastoma binding protein 8 1 1
MIRT470578 POTEM POTE ankyrin domain family, member M 1 1
MIRT470608 POTEG POTE ankyrin domain family, member G 1 1
MIRT473009 MRPS14 mitochondrial ribosomal protein S14 1 1
MIRT473412 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT476250 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 2
MIRT477985 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT478242 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 2
MIRT482174 AHR aryl hydrocarbon receptor 1 1
MIRT485730 CALM2 calmodulin 2 (phosphorylase kinase, delta) 1 1
MIRT494916 NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough 1 1
MIRT495035 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT495110 NOL10 nucleolar protein 10 1 1
MIRT496070 GLCCI1 glucocorticoid induced transcript 1 1 1
MIRT496620 TMEM67 transmembrane protein 67 1 1
MIRT505888 RNF11 ring finger protein 11 1 1
MIRT508776 GSG1 germ cell associated 1 1 1
MIRT516919 HINFP histone H4 transcription factor 1 1
MIRT520762 TCF23 transcription factor 23 1 1
MIRT526113 RIC8A resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) 1 1
MIRT526615 NME6 NME/NM23 nucleoside diphosphate kinase 6 1 1
MIRT526952 TMC7 transmembrane channel-like 7 1 1
MIRT531824 MTPAP mitochondrial poly(A) polymerase 1 2
MIRT534159 SLC9A7 solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7 1 1
MIRT534642 RNF6 ring finger protein (C3H2C3 type) 6 1 1
MIRT542167 SSTR2 somatostatin receptor 2 1 1
MIRT542198 C14orf142 chromosome 14 open reading frame 142 1 1
MIRT563162 RPS14 ribosomal protein S14 1 1
MIRT563586 FAM229B chromosome 6 open reading frame 225 1 1
MIRT565772 SEPHS1 selenophosphate synthetase 1 1 1
MIRT572572 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT576214 Srsf1 serine/arginine-rich splicing factor 1 1 1
MIRT607575 TANGO2 chromosome 22 open reading frame 25 1 1
MIRT608264 NOP14 NOP14 nucleolar protein homolog (yeast) 1 1
MIRT608466 RRP36 ribosomal RNA processing 36 homolog (S. cerevisiae) 1 1
MIRT610542 WNT2B wingless-type MMTV integration site family, member 2B 1 2
MIRT619014 SLC2A6 solute carrier family 2 (facilitated glucose transporter), member 6 1 1
MIRT620990 C19orf52 chromosome 19 open reading frame 52 1 1
MIRT622883 PDCL3 phosducin-like 3 1 2
MIRT624532 BTG1 B-cell translocation gene 1, anti-proliferative 1 1
MIRT624633 ATG2A autophagy related 2A 1 1
MIRT624806 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif, 4 1 1
MIRT626795 CSE1L CSE1 chromosome segregation 1-like (yeast) 1 1
MIRT627208 ZC3H12B zinc finger CCCH-type containing 12B 1 1
MIRT627252 XKR4 XK, Kell blood group complex subunit-related family, member 4 1 1
MIRT636247 SEC63 SEC63 homolog (S. cerevisiae) 1 1
MIRT636931 TRAPPC2 trafficking protein particle complex 2 1 1
MIRT638127 UGT8 UDP glycosyltransferase 8 1 1
MIRT638731 FKBP9 FK506 binding protein 9, 63 kDa 1 1
MIRT639963 PRKD2 protein kinase D2 1 1
MIRT643680 AMER3 family with sequence similarity 123C 1 1
MIRT645567 TACR2 tachykinin receptor 2 1 1
MIRT648972 ACAD8 acyl-CoA dehydrogenase family, member 8 1 1
MIRT651877 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT654711 PRR13 proline rich 13 1 1
MIRT655109 PHLDA3 pleckstrin homology-like domain, family A, member 3 1 1
MIRT664034 RPL27A ribosomal protein L27a 1 2
MIRT664092 ZDHHC24 zinc finger, DHHC-type containing 24 1 1
MIRT665211 RBM22 RNA binding motif protein 22 1 1
MIRT667155 NRXN3 neurexin 3 1 1
MIRT669034 CHEK1 checkpoint kinase 1 1 1
MIRT676577 RDH13 retinol dehydrogenase 13 (all-trans/9-cis) 1 1
MIRT678048 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT679771 GOLGA2 golgin A2 1 1
MIRT680592 FOPNL FGFR1OP N-terminal like 1 1
MIRT681429 LRTOMT leucine rich transmembrane and 0-methyltransferase domain containing 1 1
MIRT683038 TRIM68 tripartite motif containing 68 1 1
MIRT683063 NUP205 nucleoporin 205kDa 1 1
MIRT683131 GSR glutathione reductase 1 1
MIRT683194 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT683545 HAVCR1 hepatitis A virus cellular receptor 1 1 1
MIRT684214 C9orf64 chromosome 9 open reading frame 64 1 1
MIRT689297 C5AR2 G protein-coupled receptor 77 1 1
MIRT689355 ZNF101 zinc finger protein 101 1 1
MIRT689763 CCDC38 coiled-coil domain containing 38 1 1
MIRT690142 PPIL6 peptidylprolyl isomerase (cyclophilin)-like 6 1 1
MIRT690297 LYRM7 LYR motif containing 7 1 1
MIRT690591 C17orf105 chromosome 17 open reading frame 105 1 1
MIRT690796 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT691384 ATP13A4 ATPase type 13A4 1 1
MIRT691456 C21orf58 chromosome 21 open reading frame 58 1 1
MIRT691955 RHOH ras homolog family member H 1 1
MIRT694056 NQO2 NAD(P)H dehydrogenase, quinone 2 1 1
MIRT694224 ZNF749 zinc finger protein 749 1 1
MIRT694314 NLRP9 NLR family, pyrin domain containing 9 1 1
MIRT694359 CHST6 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6 1 1
MIRT694578 IGSF9B immunoglobulin superfamily, member 9B 1 1
MIRT695400 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT695783 HSD17B12 hydroxysteroid (17-beta) dehydrogenase 12 1 1
MIRT696162 TIPIN TIMELESS interacting protein 1 1
MIRT697223 ZYG11A zyg-11 homolog A (C. elegans) 1 1
MIRT697475 ZBTB8B zinc finger and BTB domain containing 8B 1 1
MIRT698537 TFRC transferrin receptor (p90, CD71) 1 1
MIRT698935 SPATA2 spermatogenesis associated 2 1 1
MIRT699526 SIX4 SIX homeobox 4 1 1
MIRT700211 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT700635 PQLC2 PQ loop repeat containing 2 1 1
MIRT700962 PDK3 pyruvate dehydrogenase kinase, isozyme 3 1 1
MIRT701873 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT702031 MOGAT1 monoacylglycerol O-acyltransferase 1 1 1
MIRT702185 LYPD3 LY6/PLAUR domain containing 3 1 1
MIRT702447 KIAA1467 KIAA1467 1 1
MIRT702683 IRGQ immunity-related GTPase family, Q 1 1
MIRT704290 DDX19B DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B 1 1
MIRT705854 AFF3 AF4/FMR2 family, member 3 1 1
MIRT706873 TNFAIP8L1 tumor necrosis factor, alpha-induced protein 8-like 1 1 1
MIRT706939 DNAJC18 DnaJ (Hsp40) homolog, subfamily C, member 18 1 1
MIRT708806 CDS2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 1 1
MIRT709730 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 1 1
MIRT716067 LETM2 leucine zipper-EF-hand containing transmembrane protein 2 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*