Accession ID: MIRT036496 [miRNA, hsa-miR-1226-3p :: CTNNB1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-1226LinkOut: [miRBase ]
Synonyms MIRN1226, hsa-mir-1226, MIR1226
Description Homo sapiens miR-1226 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-1226-3p
Mature Sequence 54| UCACCAGCCCUGUGUUCCCUAG |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-1226-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CTNNB1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CTNNB, DKFZp686D02253, FLJ25606, FLJ37923
Description catenin (cadherin-associated protein), beta 1, 88kDa
Transcript NM_0019    LinkOut: [ RefSeq ]
Other Transcripts NM_0010982 , NM_0010982   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTNNB1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTNNB1
(miRNA target sites are highlighted)
>CTNNB1|NM_0019|3'UTR
   1 TAAATCATCCTTTAGGTAAGAAGTTTTAAAAAGCCAGTTTGGGTAAAATACTTTTACTCTGCCTACAGAACTTCAGAAAG
  81 ACTTGGTTGGTAGGGTGGGAGTGGTTTAGGCTATTTGTAAATCTGCCACAAAAACAGGTATATACTTTGAAAGGAGATGT
 161 CTTGGAACATTGGAATGTTCTCAGATTTCTGGTTGTTATGTGATCATGTGTGGAAGTTATTAACTTTAATGTTTTTTGCC
 241 ACAGCTTTTGCAACTTAATACTCAAATGAGTAACATTTGCTGTTTTAAACATTAATAGCAGCCTTTCTCTCTTTATACAG
 321 CTGTATTGTCTGAACTTGCATTGTGATTGGCCTGTAGAGTTGCTGAGAGGGCTCGAGGGGTGGGCTGGTATCTCAGAAAG
 401 TGCCTGACACACTAACCAAGCTGAGTTTCCTATGGGAACAATTGAAGTAAACTTTTTGTTCTGGTCCTTTTTGGTCGAGG
 481 AGTAACAATACAAATGGATTTTGGGAGTGACTCAAGAAGTGAAGAATGCACAAGAATGGATCACAAGATGGAATTTATCA
 561 AACCCTAGCCTTGCTTGTTAAATTTTTTTTTTTTTTTTTTTAAGAATATCTGTAATGGTACTGACTTTGCTTGCTTTGAA
 641 GTAGCTCTTTTTTTTTTTTTTTTTTTTTTTTTGCAGTAACTGTTTTTTAAGTCTCTCGTAGTGTTAAGTTATAGTGAATA
 721 CTGCTACAGCAATTTCTAATTTTTAAGAATTGAGTAATGGTGTAGAACACTAATTCATAATCACTCTAATTAATTGTAAT
 801 CTGAATAAAGTGTAACAATTGTGTAGCCTTTTTGTATAAAATAGACAAATAGAAAATGGTCCAATTAGTTTCCTTTTTAA
 881 TATGCTTAAAATAAGCAGGTGGATCTATTTCATGTTTTTGATCAAAAACTATTTGGGATATGTATGGGTAGGGTAAATCA
 961 GTAAGAGGTGTTATTTGGAACCTTGTTTTGGACAGTTTACCAGTTGCCTTTTATCCCAAAGTTGTTGTAACCTGCTGTGA
1041 TACGATGCTTCAAGAGAAAATGCGGTTATAAAAAATGGTTCAGAATTAAACTTTTAATTCATTCGATTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaUCC----CUUGUGUCCCGACCAcu 5'
            |||    ||: :  ||||||||  
Target 5' agAGGGCTCGAGGGGTGGGCTGGTat 3'
366 - 391 134.00 -20.90
2
miRNA  3' gaucCCUUGUGUCCCGACCAcu 5'
              | || ||  ||:||||  
Target 5' ttcaGAAAGACTTGGTTGGTag 3'
72 - 93 122.00 -13.10
3
miRNA  3' gaucccUUGUGUCCCGACCACu 5'
                || |:|  || |||| 
Target 5' atgcttAAAATA-AGCAGGTGg 3'
882 - 902 115.00 -7.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1226-3p :: CTNNB1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gatcccttgtgtCCCGACCACt 5'
                      ||||||||| 
Target 5' -------ccttcGGGCTGGTGa 3'
1 - 15
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
130 hsa-miR-1226-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005492 MUC1 mucin 1, cell surface associated 3 1
MIRT036409 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT036410 UBE2A ubiquitin-conjugating enzyme E2A (RAD6 homolog) 1 1
MIRT036411 WDR1 WD repeat domain 1 1 1
MIRT036412 HIST1H4B histone cluster 1, H4b 1 1
MIRT036413 BLMH bleomycin hydrolase 1 1
MIRT036414 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT036415 KDM2A lysine (K)-specific demethylase 2A 1 1
MIRT036416 RPL35 ribosomal protein L35 1 1
MIRT036417 KARS lysyl-tRNA synthetase 1 1
MIRT036418 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT036419 GLUD2 glutamate dehydrogenase 2 1 1
MIRT036420 GALNT2 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2) 1 1
MIRT036421 CABIN1 calcineurin binding protein 1 1 1
MIRT036422 LEPREL4 synaptonemal complex protein SC65 1 1
MIRT036423 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT036424 UBE2G1 ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, yeast) 1 1
MIRT036425 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 1
MIRT036426 CCDC47 coiled-coil domain containing 47 1 1
MIRT036427 SCAMP1 secretory carrier membrane protein 1 1 1
MIRT036428 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT036429 GIMAP8 GTPase, IMAP family member 8 1 1
MIRT036430 MBTPS2 membrane-bound transcription factor peptidase, site 2 1 1
MIRT036431 RCC2 regulator of chromosome condensation 2 1 1
MIRT036432 DUT deoxyuridine triphosphatase 1 1
MIRT036433 XYLT2 xylosyltransferase II 1 1
MIRT036434 SUN2 Sad1 and UNC84 domain containing 2 1 1
MIRT036435 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT036436 C12orf29 chromosome 12 open reading frame 29 1 1
MIRT036437 PSMB2 proteasome (prosome, macropain) subunit, beta type, 2 1 1
MIRT036438 PAF1 Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) 1 1
MIRT036439 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT036440 PIM2 pim-2 oncogene 1 1
MIRT036441 JUNB jun B proto-oncogene 1 1
MIRT036442 TBX18 T-box 18 1 1
MIRT036443 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT036444 CYB5B cytochrome b5 type B (outer mitochondrial membrane) 1 1
MIRT036445 ATXN2 ataxin 2 1 1
MIRT036446 TBX3 T-box 3 1 1
MIRT036447 EPB41L1 erythrocyte membrane protein band 4.1-like 1 1 1
MIRT036448 TMEM25 transmembrane protein 25 1 1
MIRT036449 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT036450 NDRG3 NDRG family member 3 1 1
MIRT036451 CPSF3L cleavage and polyadenylation specific factor 3-like 1 1
MIRT036452 SORBS2 sorbin and SH3 domain containing 2 1 1
MIRT036453 RPA2 replication protein A2, 32kDa 1 1
MIRT036454 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT036455 ZNF629 zinc finger protein 629 1 1
MIRT036456 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT036457 KIAA1644 KIAA1644 1 1
MIRT036458 HSPA9 heat shock 70kDa protein 9 (mortalin) 1 1
MIRT036459 ITPR3 inositol 1,4,5-triphosphate receptor, type 3 1 1
MIRT036460 TM9SF4 transmembrane 9 superfamily protein member 4 1 1
MIRT036461 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT036462 EXOC8 exocyst complex component 8 1 1
MIRT036463 ATP6AP2 ATPase, H+ transporting, lysosomal accessory protein 2 1 1
MIRT036464 HIST1H4C histone cluster 1, H4c 1 1
MIRT036465 ZDHHC4 zinc finger, DHHC-type containing 4 1 1
MIRT036466 ERCC2 excision repair cross-complementing rodent repair deficiency, complementation group 2 1 1
MIRT036467 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT036468 RBM27 RNA binding motif protein 27 1 1
MIRT036469 EHHADH enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase 1 1
MIRT036470 RABL6 chromosome 9 open reading frame 86 1 1
MIRT036471 RBM10 RNA binding motif protein 10 1 1
MIRT036472 RABGGTB Rab geranylgeranyltransferase, beta subunit 1 1
MIRT036473 PFKL phosphofructokinase, liver 1 1
MIRT036474 TOP2A topoisomerase (DNA) II alpha 170kDa 1 1
MIRT036475 KIAA1671 KIAA1671 1 1
MIRT036476 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT036477 IPO7 importin 7 1 1
MIRT036478 CTDNEP1 dullard homolog (Xenopus laevis) 1 1
MIRT036479 ZBTB7B zinc finger and BTB domain containing 7B 1 1
MIRT036480 GPBP1L1 GC-rich promoter binding protein 1-like 1 1 1
MIRT036481 PANK3 pantothenate kinase 3 1 1
MIRT036482 SLC35F6 chromosome 2 open reading frame 18 1 1
MIRT036483 RPL36A ribosomal protein L36a 1 1
MIRT036484 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT036485 AKIP1 chromosome 11 open reading frame 17 1 1
MIRT036486 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT036487 ACTG1 actin, gamma 1 1 1
MIRT036488 EDC4 enhancer of mRNA decapping 4 1 1
MIRT036489 FTSJD2 FtsJ methyltransferase domain containing 2 1 1
MIRT036490 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT036491 AP2M1 adaptor-related protein complex 2, mu 1 subunit 1 1
MIRT036492 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT036493 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase, type I, alpha 1 1
MIRT036494 ZBTB40 zinc finger and BTB domain containing 40 1 1
MIRT036495 PIK3R4 phosphoinositide-3-kinase, regulatory subunit 4 1 1
MIRT036496 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT036497 CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 1 1
MIRT036498 PKN3 protein kinase N3 1 1
MIRT036499 FAM3C family with sequence similarity 3, member C 1 1
MIRT036500 IDH1 isocitrate dehydrogenase 1 (NADP+), soluble 1 1
MIRT036501 CKAP4 cytoskeleton-associated protein 4 1 1
MIRT036502 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT036503 ASTL astacin-like metallo-endopeptidase (M12 family) 1 1
MIRT036504 ADAR adenosine deaminase, RNA-specific 1 1
MIRT036505 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT036506 ALDH1B1 aldehyde dehydrogenase 1 family, member B1 1 1
MIRT036507 HSPB8 heat shock 22kDa protein 8 1 1
MIRT036508 MCM2 minichromosome maintenance complex component 2 1 1
MIRT036509 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT036510 SIMC1 chromosome 5 open reading frame 25 1 1
MIRT036511 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT036512 CENPF centromere protein F, 350/400ka (mitosin) 1 1
MIRT036513 PRPF6 PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) 1 1
MIRT036514 CHD3 chromodomain helicase DNA binding protein 3 1 1
MIRT036515 PBRM1 polybromo 1 1 1
MIRT036516 USP24 ubiquitin specific peptidase 24 1 1
MIRT036517 UQCC ubiquinol-cytochrome c reductase complex chaperone 1 1
MIRT036518 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT036519 CNTNAP3 contactin associated protein-like 3 1 1
MIRT036520 DDT D-dopachrome tautomerase 1 1
MIRT036521 ZNF395 zinc finger protein 395 1 1
MIRT036522 NDUFA5 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa 1 1
MIRT036523 SLC25A39 solute carrier family 25, member 39 1 1
MIRT036524 NCKIPSD NCK interacting protein with SH3 domain 1 1
MIRT036525 AAMP angio-associated, migratory cell protein 1 1
MIRT036526 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT036527 AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) 1 1
MIRT036528 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT036529 ABHD14B abhydrolase domain containing 14B 1 1
MIRT036530 BIRC5 baculoviral IAP repeat-containing 5 1 1
MIRT036531 BAG6 HLA-B associated transcript 3 1 1
MIRT036532 MRPS26 mitochondrial ribosomal protein S26 1 1
MIRT036533 KIF4B kinesin family member 4B 1 1
MIRT036534 TUBB4B tubulin, beta 2C 1 1
MIRT036535 FAM168B family with sequence similarity 168, member B 1 1
MIRT036536 TUBB4A tubulin, beta 4 1 1
MIRT036537 AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) 1 1