Accession ID: MIRT036627 [miRNA, hsa-miR-940 :: TNFRSF10B, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-940LinkOut: [miRBase ]
Synonyms MIRN940, hsa-mir-940, MIR940
Description Homo sapiens miR-940 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-940
Mature Sequence 60| AAGGCAGGGCCCCCGCUCCCC |80
Evidence Experimental
Experiments Cloned
Putative hsa-miR-940 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-940 :: TNFRSF10B    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ccCCTCGCCCC--C----GGGACGGAa 5'
            || ||||||  |    |:|||:|| 
Target 5' ggGGTGCGGGGCAGTTCACTCTGTCTc 3'
14 - 40
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
48 hsa-miR-940 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT036586 STK40 serine/threonine kinase 40 1 1
MIRT036587 STEAP2 STEAP family member 2, metalloreductase 1 1
MIRT036588 RPAIN RPA interacting protein 1 1
MIRT036589 EPHA2 EPH receptor A2 1 1
MIRT036590 RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6 1 1
MIRT036591 TPM4 tropomyosin 4 1 1
MIRT036592 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT036593 RPL7A ribosomal protein L7a 1 1
MIRT036594 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT036595 TUBA1C tubulin, alpha 1c 1 1
MIRT036596 KSR2 kinase suppressor of ras 2 1 1
MIRT036597 VPS37B vacuolar protein sorting 37 homolog B (S. cerevisiae) 1 1
MIRT036598 ANP32A acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 1 1
MIRT036599 BRD2 bromodomain containing 2 1 1
MIRT036600 PSMG1 proteasome (prosome, macropain) assembly chaperone 1 1 1
MIRT036601 PIEZO1 piezo-type mechanosensitive ion channel component 1 1 1
MIRT036602 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1
MIRT036603 FZD7 frizzled family receptor 7 1 1
MIRT036604 RPS2 ribosomal protein S2 1 1
MIRT036605 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT036606 FOXC1 forkhead box C1 1 1
MIRT036607 ZNF77 zinc finger protein 77 1 1
MIRT036608 SHMT2 serine hydroxymethyltransferase 2 (mitochondrial) 1 1
MIRT036609 KIAA1671 KIAA1671 1 1
MIRT036610 WASF2 WAS protein family, member 2 1 1
MIRT036611 CTBP1 C-terminal binding protein 1 1 1
MIRT036612 IPO4 importin 4 1 1
MIRT036613 HIST1H2AE histone cluster 1, H2ae 1 1
MIRT036614 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 1
MIRT036615 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT036616 SYMPK symplekin 1 1
MIRT036617 UNC45A unc-45 homolog A (C. elegans) 1 1
MIRT036618 LRP6 low density lipoprotein receptor-related protein 6 1 1
MIRT036619 FAN1 FANCD2/FANCI-associated nuclease 1 1 1
MIRT036620 TBC1D9B TBC1 domain family, member 9B (with GRAM domain) 1 1
MIRT036621 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT036622 TUB tubby homolog (mouse) 1 1
MIRT036623 UACA uveal autoantigen with coiled-coil domains and ankyrin repeats 1 1
MIRT036624 NDUFS2 NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase) 1 1
MIRT036625 IL17RC interleukin 17 receptor C 1 1
MIRT036626 PIM3 pim-3 oncogene 1 1
MIRT036627 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 1
MIRT036628 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT036629 GLYCTK glycerate kinase 1 1
MIRT036630 TMEM8A transmembrane protein 8A 1 1
MIRT036631 PYCR1 pyrroline-5-carboxylate reductase 1 1 1
MIRT036632 HNRNPR heterogeneous nuclear ribonucleoprotein R 1 1
MIRT036633 KHSRP KH-type splicing regulatory protein 1 1