Accession ID: MIRT036627 [miRNA, hsa-miR-940 :: TNFRSF10B, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-940LinkOut: [miRBase ]
Synonyms MIRN940, hsa-mir-940, MIR940
Description Homo sapiens miR-940 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-940
Mature Sequence 60| AAGGCAGGGCCCCCGCUCCCC |80
Evidence Experimental
Experiments Cloned
Putative hsa-miR-940 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-940 :: TNFRSF10B    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ccCCTCGCCCC--C----GGGACGGAa 5'
            || ||||||  |    |:|||:|| 
Target 5' ggGGTGCGGGGCAGTTCACTCTGTCTc 3'
14 - 40
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
527 hsa-miR-940 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT036586 STK40 serine/threonine kinase 40 1 1
MIRT036587 STEAP2 STEAP family member 2, metalloreductase 1 1
MIRT036588 RPAIN RPA interacting protein 1 1
MIRT036589 EPHA2 EPH receptor A2 1 1
MIRT036590 RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6 1 1
MIRT036591 TPM4 tropomyosin 4 1 2
MIRT036592 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT036593 RPL7A ribosomal protein L7a 1 1
MIRT036594 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT036595 TUBA1C tubulin, alpha 1c 1 1
MIRT036596 KSR2 kinase suppressor of ras 2 1 1
MIRT036597 VPS37B vacuolar protein sorting 37 homolog B (S. cerevisiae) 1 2
MIRT036598 ANP32A acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 1 1
MIRT036599 BRD2 bromodomain containing 2 1 1
MIRT036600 PSMG1 proteasome (prosome, macropain) assembly chaperone 1 1 1
MIRT036601 PIEZO1 piezo-type mechanosensitive ion channel component 1 1 1
MIRT036602 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1
MIRT036603 FZD7 frizzled family receptor 7 1 1
MIRT036604 RPS2 ribosomal protein S2 1 1
MIRT036605 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT036606 FOXC1 forkhead box C1 1 1
MIRT036607 ZNF77 zinc finger protein 77 1 1
MIRT036608 SHMT2 serine hydroxymethyltransferase 2 (mitochondrial) 1 1
MIRT036609 KIAA1671 KIAA1671 1 1
MIRT036610 WASF2 WAS protein family, member 2 1 1
MIRT036611 CTBP1 C-terminal binding protein 1 1 1
MIRT036612 IPO4 importin 4 1 1
MIRT036613 HIST1H2AE histone cluster 1, H2ae 1 1
MIRT036614 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 1
MIRT036615 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT036616 SYMPK symplekin 1 1
MIRT036617 UNC45A unc-45 homolog A (C. elegans) 1 1
MIRT036618 LRP6 low density lipoprotein receptor-related protein 6 1 1
MIRT036619 FAN1 FANCD2/FANCI-associated nuclease 1 1 1
MIRT036620 TBC1D9B TBC1 domain family, member 9B (with GRAM domain) 1 1
MIRT036621 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT036622 TUB tubby homolog (mouse) 1 1
MIRT036623 UACA uveal autoantigen with coiled-coil domains and ankyrin repeats 1 1
MIRT036624 NDUFS2 NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase) 1 1
MIRT036625 IL17RC interleukin 17 receptor C 1 1
MIRT036626 PIM3 pim-3 oncogene 1 1
MIRT036627 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 1
MIRT036628 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT036629 GLYCTK glycerate kinase 1 1
MIRT036630 TMEM8A transmembrane protein 8A 1 1
MIRT036631 PYCR1 pyrroline-5-carboxylate reductase 1 1 1
MIRT036632 HNRNPR heterogeneous nuclear ribonucleoprotein R 1 1
MIRT036633 KHSRP KH-type splicing regulatory protein 1 1
MIRT058857 VANGL1 vang-like 1 (van gogh, Drosophila) 1 3
MIRT065790 HOXC8 homeobox C8 1 3
MIRT105103 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 0 1
MIRT108708 XIAP X-linked inhibitor of apoptosis 1 1
MIRT113301 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 1 1
MIRT129701 AGTRAP angiotensin II receptor-associated protein 1 1
MIRT140178 CHAC1 ChaC, cation transport regulator homolog 1 (E. coli) 1 1
MIRT166759 PAPD7 PAP associated domain containing 7 1 2
MIRT180252 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT307002 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 1
MIRT325567 HIATL1 hippocampus abundant transcript-like 1 1 2
MIRT370119 TRIB3 tribbles homolog 3 (Drosophila) 1 1
MIRT370506 ZNRF3 zinc and ring finger 3 1 1
MIRT386077 ZNF609 zinc finger protein 609 1 1
MIRT395051 TNFAIP2 tumor necrosis factor, alpha-induced protein 2 1 1
MIRT406912 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT437985 DUSP1 dual specificity phosphatase 1 3 1
MIRT438403 CD274 CD274 molecule 2 1
MIRT443499 MXI1 MAX interactor 1 1 2
MIRT443530 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT444628 GSPT1 G1 to S phase transition 1 1 1
MIRT446285 C17orf102 chromosome 17 open reading frame 102 1 1
MIRT447169 MFSD8 major facilitator superfamily domain containing 8 1 1
MIRT447912 SLC35E2 solute carrier family 35, member E2 1 1
MIRT448203 B4GALT7 xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 1 2
MIRT451115 RPS19 ribosomal protein S19 1 1
MIRT451464 HSD11B1L hydroxysteroid (11-beta) dehydrogenase 1-like 1 1
MIRT451509 ALOX15 arachidonate 15-lipoxygenase 1 1
MIRT452067 ZNF585B zinc finger protein 585B 1 5
MIRT452222 HAVCR1 hepatitis A virus cellular receptor 1 1 3
MIRT452584 ZFP69B zinc finger protein 643 1 1
MIRT452641 PCCB propionyl CoA carboxylase, beta polypeptide 1 1
MIRT452728 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 2
MIRT452743 PTGES3L prostaglandin E synthase 3 (cytosolic)-like 1 1
MIRT452770 TCEA3 transcription elongation factor A (SII), 3 1 2
MIRT452834 FAM131B family with sequence similarity 131, member B 1 1
MIRT452873 LAX1 lymphocyte transmembrane adaptor 1 1 1
MIRT452882 PRSS45 protease, serine, 45 1 1
MIRT452971 ZNF844 zinc finger protein 844 1 3
MIRT453029 ZNF527 zinc finger protein 527 1 2
MIRT453174 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT453435 GLG1 golgi glycoprotein 1 1 1
MIRT453611 ZNF557 zinc finger protein 557 1 1
MIRT453712 TBX20 T-box 20 1 1
MIRT453914 GABRR2 gamma-aminobutyric acid (GABA) A receptor, rho 2 1 1
MIRT453972 ATP13A4 ATPase type 13A4 1 3
MIRT454073 SLC35E3 solute carrier family 35, member E3 1 1
MIRT454254 CCDC125 coiled-coil domain containing 125 1 1
MIRT454992 RECK reversion-inducing-cysteine-rich protein with kazal motifs 1 1
MIRT455148 TBC1D25 TBC1 domain family, member 25 1 1
MIRT455487 NPY4R pancreatic polypeptide receptor 1 1 1
MIRT455704 ZMYM1 zinc finger, MYM-type 1 1 1
MIRT455876 SLC35C2 solute carrier family 35, member C2 1 1
MIRT455952 CYP4A22 cytochrome P450, family 4, subfamily A, polypeptide 22 1 1
MIRT455976 BCAS4 breast carcinoma amplified sequence 4 1 2
MIRT456218 LIX1L Lix1 homolog (mouse)-like 1 3
MIRT456239 LHPP phospholysine phosphohistidine inorganic pyrophosphate phosphatase 1 3
MIRT456281 HRNR hornerin 1 1
MIRT456741 TMEM239 transmembrane protein 239 1 1
MIRT456925 DDA1 DET1 and DDB1 associated 1 1 1
MIRT457003 ZNF669 zinc finger protein 669 1 2
MIRT457346 HSD3B7 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 1 1
MIRT457475 SLC35F6 chromosome 2 open reading frame 18 1 1
MIRT457551 ZC3H6 zinc finger CCCH-type containing 6 1 1
MIRT457750 NCR3LG1 natural killer cell cytotoxicity receptor 3 ligand 1 1 1
MIRT457989 APAF1 apoptotic peptidase activating factor 1 1 2
MIRT458403 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 1 2
MIRT458467 SNX22 sorting nexin 22 1 3
MIRT458516 GSG2 germ cell associated 2 (haspin) 1 3
MIRT458562 C10orf71 chromosome 10 open reading frame 71 1 1
MIRT458652 SGPP2 sphingosine-1-phosphate phosphatase 2 1 1
MIRT458752 CES2 carboxylesterase 2 1 1
MIRT458786 ZNF786 zinc finger protein 786 1 1
MIRT458803 CYP8B1 cytochrome P450, family 8, subfamily B, polypeptide 1 1 1
MIRT458900 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT458956 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT459000 KIAA1551 KIAA1551 1 1
MIRT459108 CYP4A11 cytochrome P450, family 4, subfamily A, polypeptide 11 1 1
MIRT459331 HAVCR2 hepatitis A virus cellular receptor 2 1 1
MIRT459401 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT459555 BTD biotinidase 1 2
MIRT460250 IL17RB interleukin 17 receptor B 1 1
MIRT460367 TXNDC16 thioredoxin domain containing 16 1 2
MIRT460518 SDE2 SDE2 telomere maintenance homolog (S. pombe) 1 1
MIRT460706 RNF157 ring finger protein 157 1 1
MIRT460804 VPS33A vacuolar protein sorting 33 homolog A (S. cerevisiae) 1 1
MIRT460843 EGF epidermal growth factor 1 2
MIRT460949 NOA1 nitric oxide associated 1 1 1
MIRT461015 SYT7 synaptotagmin VII 1 1
MIRT461131 RAB36 RAB36, member RAS oncogene family 1 2
MIRT461213 TIPIN TIMELESS interacting protein 1 1
MIRT461406 SLFN12L schlafen family member 12-like 1 4
MIRT461827 SNAP23 synaptosomal-associated protein, 23kDa 1 1
MIRT461868 ZNF317 zinc finger protein 317 1 1
MIRT462086 MSANTD2 Myb/SANT-like DNA-binding domain containing 2 1 1
MIRT462217 MLH1 mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) 1 1
MIRT462436 GTPBP10 GTP-binding protein 10 (putative) 1 2
MIRT462510 MTFMT mitochondrial methionyl-tRNA formyltransferase 1 4
MIRT462540 PLLP plasmolipin 1 2
MIRT462893 ZSCAN29 zinc finger and SCAN domain containing 29 1 2
MIRT462973 ZNF788 zinc finger family member 788 1 1
MIRT463077 ZNF639 zinc finger protein 639 1 2
MIRT463903 WNT7B wingless-type MMTV integration site family, member 7B 1 1
MIRT464124 VPS35 vacuolar protein sorting 35 homolog (S. cerevisiae) 1 1
MIRT464833 UBE2B ubiquitin-conjugating enzyme E2B 1 1
MIRT465530 PRICKLE4 prickle homolog 4 (Drosophila) 1 1
MIRT465584 TNRC6B trinucleotide repeat containing 6B 1 2
MIRT466095 TMEM184C transmembrane protein 184C 1 1
MIRT466218 TMED10 transmembrane emp24-like trafficking protein 10 (yeast) 1 1
MIRT466694 TAF13 TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa 1 2
MIRT467017 SSBP2 single-stranded DNA binding protein 2 1 2
MIRT467259 SPPL2A signal peptide peptidase like 2A 1 1
MIRT467758 SLC35F1 solute carrier family 35, member F1 1 2
MIRT469013 RNF41 ring finger protein 41 1 1
MIRT469069 RNF20 ring finger protein 20, E3 ubiquitin protein ligase 1 1
MIRT469579 RARA retinoic acid receptor, alpha 1 1
MIRT471068 PIM2 pim-2 oncogene 1 1
MIRT471478 PDE7B phosphodiesterase 7B 1 1
MIRT471651 PANK2 pantothenate kinase 2 1 2
MIRT471850 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT472325 NF2 neurofibromin 2 (merlin) 1 1
MIRT472836 MTMR10 myotubularin related protein 10 1 2
MIRT473055 MORN4 MORN repeat containing 4 1 3
MIRT473117 MLXIP MLX interacting protein 1 1
MIRT474185 LETMD1 LETM1 domain containing 1 1 1
MIRT474371 KLLN killin, p53-regulated DNA replication inhibitor 1 3
MIRT474442 KLHL18 kelch-like 18 (Drosophila) 1 3
MIRT474622 KLF2 Kruppel-like factor 2 (lung) 1 2
MIRT474890 KCTD5 potassium channel tetramerisation domain containing 5 1 1
MIRT475292 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT475402 ICMT isoprenylcysteine carboxyl methyltransferase 1 2
MIRT475689 HHIPL1 HHIP-like 1 1 1
MIRT476414 GDE1 glycerophosphodiester phosphodiesterase 1 1 4
MIRT476809 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT477081 FAM208A family with sequence similarity 208, member A 1 3
MIRT477653 EFNA1 ephrin-A1 1 1
MIRT478230 DDX52 DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 1 1
MIRT478488 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT478760 CS citrate synthase 1 1
MIRT478820 CRTAP cartilage associated protein 1 1
MIRT479203 CLCN5 chloride channel, voltage-sensitive 5 1 3
MIRT479305 CFL2 cofilin 2 (muscle) 1 1
MIRT479921 CCDC117 coiled-coil domain containing 117 1 3
MIRT480235 C9orf41 chromosome 9 open reading frame 41 1 1
MIRT480359 C5orf24 chromosome 5 open reading frame 24 1 1
MIRT480734 BPTF bromodomain PHD finger transcription factor 1 1
MIRT481072 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT481102 B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 1 1
MIRT481270 ATXN7L3 ataxin 7-like 3 1 1
MIRT481436 ASB6 ankyrin repeat and SOCS box containing 6 1 1
MIRT481575 ARIH2 ariadne homolog 2 (Drosophila) 1 1
MIRT481623 ARHGAP1 Rho GTPase activating protein 1 1 1
MIRT482261 AGO3 eukaryotic translation initiation factor 2C, 3 1 1
MIRT486074 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 2
MIRT486944 DTX2 deltex homolog 2 (Drosophila) 1 1
MIRT487273 CCNF cyclin F 1 1
MIRT487358 PHF15 PHD finger protein 15 1 1
MIRT487469 ANKRD42 ankyrin repeat domain 42 1 1
MIRT487530 GXYLT2 glucoside xylosyltransferase 2 1 2
MIRT487973 IQSEC2 IQ motif and Sec7 domain 2 1 1
MIRT489047 PRPF4B PRP4 pre-mRNA processing factor 4 homolog B (yeast) 1 1
MIRT489070 STARD3 StAR-related lipid transfer (START) domain containing 3 1 1
MIRT489724 CALML3 calmodulin-like 3 1 1
MIRT490846 ADD2 adducin 2 (beta) 1 1
MIRT491849 ZBTB7A zinc finger and BTB domain containing 7A 1 1
MIRT492641 PLXNA1 plexin A1 1 1
MIRT492694 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT495460 PNMAL2 paraneoplastic Ma antigen family-like 2 1 1
MIRT495492 VTI1B vesicle transport through interaction with t-SNAREs homolog 1B (yeast) 1 1
MIRT495727 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT495773 ZNF546 zinc finger protein 546 1 2
MIRT495805 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT495825 TMEM151A transmembrane protein 151A 1 1
MIRT496077 ATP1B4 ATPase, Na+/K+ transporting, beta 4 polypeptide 1 2
MIRT496101 SNX17 sorting nexin 17 1 1
MIRT496138 RBL1 retinoblastoma-like 1 (p107) 1 1
MIRT496180 TRIM73 tripartite motif containing 73 1 1
MIRT496234 TRIM74 tripartite motif containing 74 1 1
MIRT496263 SHROOM2 shroom family member 2 1 1
MIRT496278 SLC2A13 solute carrier family 2 (facilitated glucose transporter), member 13 1 1
MIRT496290 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT496498 MAST3 microtubule associated serine/threonine kinase 3 1 1
MIRT496543 EBI3 Epstein-Barr virus induced 3 1 1
MIRT496704 TRIM39 tripartite motif containing 39 1 1
MIRT496797 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 1
MIRT498684 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 1 1
MIRT498740 SNTN sentan, cilia apical structure protein 1 3
MIRT500558 XBP1P1 X-box binding protein 1 pseudogene 1 1 4
MIRT503039 CAMSAP2 calmodulin regulated spectrin-associated protein family, member 2 1 1
MIRT503436 SLC25A45 solute carrier family 25, member 45 1 3
MIRT507271 FERMT2 fermitin family member 2 1 1
MIRT507343 FAM168A family with sequence similarity 168, member A 1 1
MIRT508612 IRAK4 interleukin-1 receptor-associated kinase 4 1 3
MIRT508904 PTPLB protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b 1 1
MIRT510120 IRAK3 interleukin-1 receptor-associated kinase 3 1 4
MIRT510469 ZDHHC18 zinc finger, DHHC-type containing 18 1 1
MIRT512942 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 2
MIRT514158 TMEM145 transmembrane protein 145 1 2
MIRT514200 PGPEP1 pyroglutamyl-peptidase I 1 2
MIRT517225 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 2
MIRT517482 PEX26 peroxisomal biogenesis factor 26 1 1
MIRT517982 DSCR3 Down syndrome critical region gene 3 1 1
MIRT518734 ABCG8 ATP-binding cassette, sub-family G (WHITE), member 8 1 1
MIRT518910 CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) 1 1
MIRT520055 YIPF4 Yip1 domain family, member 4 1 3
MIRT524623 C7orf73 chromosome 7 open reading frame 73 1 1
MIRT524888 ARHGAP11A Rho GTPase activating protein 11A 1 2
MIRT529053 CDK18 cyclin-dependent kinase 18 1 1
MIRT531309 GPR26 G protein-coupled receptor 26 1 1
MIRT534862 RAB15 RAB15, member RAS oncogene family 1 2
MIRT541071 SENP5 SUMO1/sentrin specific peptidase 5 1 1
MIRT544170 HEYL hairy/enhancer-of-split related with YRPW motif-like 1 1
MIRT547845 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT548043 GOLIM4 golgi integral membrane protein 4 1 1
MIRT550430 ORC4 origin recognition complex, subunit 4 1 1
MIRT550584 SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 1 1
MIRT550599 CBY3 chibby homolog 3 (Drosophila) 1 1
MIRT550991 RBM38 RNA binding motif protein 38 1 1
MIRT551341 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 1 1
MIRT551374 EPM2AIP1 EPM2A (laforin) interacting protein 1 1 1
MIRT551397 MRI1 methylthioribose-1-phosphate isomerase homolog (S. cerevisiae) 1 2
MIRT551592 HDGFRP2 hepatoma-derived growth factor-related protein 2 1 1
MIRT553094 UBXN2A UBX domain protein 2A 1 2
MIRT554230 SLC17A5 solute carrier family 17 (anion/sugar transporter), member 5 1 1
MIRT555406 PPM1L protein phosphatase, Mg2+/Mn2+ dependent, 1L 1 1
MIRT557315 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 1 1
MIRT559319 ATXN1 ataxin 1 1 1
MIRT559661 AHCYL2 adenosylhomocysteinase-like 2 1 1
MIRT562320 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT563669 SMC4 structural maintenance of chromosomes 4 1 1
MIRT565906 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT569836 SOX11 SRY (sex determining region Y)-box 11 1 1
MIRT570248 CPNE5 copine V 1 1
MIRT575573 Cd99 CD99 antigen 1 1
MIRT608279 NOP14 NOP14 nucleolar protein homolog (yeast) 1 1
MIRT610866 ARSA arylsulfatase A 1 1
MIRT614143 THAP1 THAP domain containing, apoptosis associated protein 1 1 3
MIRT614600 IRF2BPL interferon regulatory factor 2 binding protein-like 1 1
MIRT615237 BROX BRO1 domain and CAAX motif containing 1 1
MIRT617431 ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 1 2
MIRT618180 ZNF681 zinc finger protein 681 1 2
MIRT618884 MBL2 mannose-binding lectin (protein C) 2, soluble 1 1
MIRT618986 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT619198 SLC16A4 solute carrier family 16, member 4 (monocarboxylic acid transporter 5) 1 1
MIRT620325 AQP6 aquaporin 6, kidney specific 1 1
MIRT620459 CENPN centromere protein N 1 1
MIRT621652 UBXN2B UBX domain protein 2B 1 1
MIRT622824 PGAM5 phosphoglycerate mutase family member 5 1 2
MIRT623362 LZIC leucine zipper and CTNNBIP1 domain containing 1 1
MIRT624932 FBXW2 F-box and WD repeat domain containing 2 1 1
MIRT624988 ZNF665 zinc finger protein 665 1 2
MIRT625499 SMAD9 SMAD family member 9 1 1
MIRT625601 KLHL23 kelch-like 23 (Drosophila) 1 1
MIRT625670 C2orf48 chromosome 2 open reading frame 48 1 1
MIRT625890 INADL InaD-like (Drosophila) 1 1
MIRT626240 ZNF749 zinc finger protein 749 1 1
MIRT626633 SLC30A6 solute carrier family 30 (zinc transporter), member 6 1 1
MIRT626996 LINC00598 long intergenic non-protein coding RNA 598 1 1
MIRT627470 STX7 syntaxin 7 1 1
MIRT627684 RPL28 ribosomal protein L28 1 1
MIRT627900 OLFML2A olfactomedin-like 2A 1 1
MIRT627990 NDRG3 NDRG family member 3 1 1
MIRT628326 CLPB ClpB caseinolytic peptidase B homolog (E. coli) 1 1
MIRT628347 CCDC68 coiled-coil domain containing 68 1 1
MIRT630196 TLN1 talin 1 1 1
MIRT631959 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 2
MIRT633400 FBXW8 F-box and WD repeat domain containing 8 1 1
MIRT633842 WHAMM WAS protein homolog associated with actin, golgi membranes and microtubules 1 1
MIRT635391 NHLRC2 NHL repeat containing 2 1 1
MIRT635805 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT636372 OGFRL1 opioid growth factor receptor-like 1 1 1
MIRT638669 GGCX gamma-glutamyl carboxylase 1 1
MIRT639198 TRAPPC2 trafficking protein particle complex 2 1 1
MIRT639601 CD3EAP CD3e molecule, epsilon associated protein 1 1
MIRT639682 PPEF2 protein phosphatase, EF-hand calcium binding domain 2 1 3
MIRT642235 RABAC1 Rab acceptor 1 (prenylated) 1 1
MIRT642379 ZNF581 zinc finger protein 581 1 1
MIRT645776 RAB3B RAB3B, member RAS oncogene family 1 1
MIRT647076 BRIX1 BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) 1 1
MIRT647327 RPH3AL rabphilin 3A-like (without C2 domains) 1 1
MIRT649009 MRPL49 mitochondrial ribosomal protein L49 1 1
MIRT650459 ZNF141 zinc finger protein 141 1 1
MIRT650535 CCDC77 coiled-coil domain containing 77 1 2
MIRT651001 ZNF770 zinc finger protein 770 1 1
MIRT651747 VEGFB vascular endothelial growth factor B 1 1
MIRT655735 NRXN3 neurexin 3 1 1
MIRT657579 GRSF1 G-rich RNA sequence binding factor 1 1 1
MIRT658634 ENAH enabled homolog (Drosophila) 1 1
MIRT659822 CASP16 caspase 16, apoptosis-related cysteine peptidase (putative) 1 1
MIRT660477 ARSK arylsulfatase family, member K 1 1
MIRT661144 ZNF43 zinc finger protein 43 1 1
MIRT661203 MPPE1 metallophosphoesterase 1 1 1
MIRT661438 MANSC1 MANSC domain containing 1 1 1
MIRT661551 ZNF674 zinc finger protein 674 1 2
MIRT661684 ZNF623 zinc finger protein 623 1 1
MIRT661810 NUP85 nucleoporin 85kDa 1 1
MIRT661863 ZNF766 zinc finger protein 766 1 1
MIRT662140 ZC3H8 zinc finger CCCH-type containing 8 1 1
MIRT662293 SLC29A4 solute carrier family 29 (nucleoside transporters), member 4 1 1
MIRT662517 ANGPT4 angiopoietin 4 1 1
MIRT662718 C10orf111 chromosome 10 open reading frame 111 1 2
MIRT662836 LY6G5B lymphocyte antigen 6 complex, locus G5B 1 1
MIRT662892 PCDHA6 protocadherin alpha 6 1 1
MIRT663005 TMEM59 transmembrane protein 59 1 1
MIRT663245 MPHOSPH8 M-phase phosphoprotein 8 1 1
MIRT663430 ZNF607 zinc finger protein 607 1 1
MIRT663712 ABHD17B family with sequence similarity 108, member B1 1 1
MIRT663835 AGBL5 ATP/GTP binding protein-like 5 1 2
MIRT663871 MUC20 mucin 20, cell surface associated 1 1
MIRT664269 NMUR1 neuromedin U receptor 1 1 1
MIRT664851 HUS1 HUS1 checkpoint homolog (S. pombe) 1 1
MIRT664946 CARD6 caspase recruitment domain family, member 6 1 2
MIRT665516 UTP15 UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) 1 1
MIRT665650 TRPM7 transient receptor potential cation channel, subfamily M, member 7 1 1
MIRT665670 TRAF1 TNF receptor-associated factor 1 1 1
MIRT665694 TNPO3 transportin 3 1 1
MIRT665852 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT665942 TBC1D19 TBC1 domain family, member 19 1 2
MIRT666007 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT666108 SSR1 signal sequence receptor, alpha 1 1
MIRT666174 SNX27 sorting nexin family member 27 1 2
MIRT666375 SHOX short stature homeobox 1 1
MIRT667006 PDPN podoplanin 1 2
MIRT667187 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 2
MIRT667605 LIPC lipase, hepatic 1 1
MIRT667830 IRGQ immunity-related GTPase family, Q 1 1
MIRT667864 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT668298 FOSL2 FOS-like antigen 2 1 2
MIRT668582 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 2
MIRT669014 CHORDC1 cysteine and histidine-rich domain (CHORD) containing 1 1 1
MIRT669105 CDK19 cyclin-dependent kinase 19 1 1
MIRT670075 ZNF783 zinc finger family member 783 1 1
MIRT670966 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 2
MIRT671197 ZNF891 zinc finger protein 891-like 1 1
MIRT671412 ERCC6L2 excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2 1 1
MIRT671748 ZNF451 zinc finger protein 451 1 1
MIRT672049 SMTNL2 smoothelin-like 2 1 1
MIRT672587 RNF24 ring finger protein 24 1 1
MIRT673454 ZNF583 zinc finger protein 583 1 1
MIRT673919 DCTN6 dynactin 6 1 1
MIRT673954 ZNF500 zinc finger protein 500 1 1
MIRT674169 BLOC1S3 biogenesis of lysosomal organelles complex-1, subunit 3 1 1
MIRT674208 FUT2 fucosyltransferase 2 (secretor status included) 1 1
MIRT674689 PLCE1 phospholipase C, epsilon 1 1 1
MIRT675249 MAK male germ cell-associated kinase 1 1
MIRT675363 KLHL26 kelch-like 26 (Drosophila) 1 1
MIRT676014 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT678295 PTRH2 peptidyl-tRNA hydrolase 2 1 1
MIRT680262 NDUFA7 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa 1 1
MIRT680942 EVC Ellis van Creveld syndrome 1 1
MIRT680966 SLC15A1 solute carrier family 15 (oligopeptide transporter), member 1 1 2
MIRT681067 PAQR7 progestin and adipoQ receptor family member VII 1 1
MIRT681211 ZNF638 zinc finger protein 638 1 1
MIRT681576 ABHD15 abhydrolase domain containing 15 1 1
MIRT681599 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa 1 1
MIRT681914 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT682039 AGXT2 alanine--glyoxylate aminotransferase 2 1 2
MIRT682342 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 2
MIRT682667 CASP8 caspase 8, apoptosis-related cysteine peptidase 1 1
MIRT683285 ZNF99 zinc finger protein 99 1 1
MIRT683361 SCARF1 scavenger receptor class F, member 1 1 1
MIRT683455 ACOT2 acyl-CoA thioesterase 2 1 1
MIRT683598 GSTCD glutathione S-transferase, C-terminal domain containing 1 1
MIRT683663 ZNF695 zinc finger protein 695 1 1
MIRT683738 EIF3L eukaryotic translation initiation factor 3, subunit L 1 1
MIRT683772 CPE carboxypeptidase E 1 1
MIRT683809 NOTO notochord homeobox 1 1
MIRT684464 MFSD4 major facilitator superfamily domain containing 4 1 1
MIRT684527 C1orf174 chromosome 1 open reading frame 174 1 1
MIRT684987 MINOS1 mitochondrial inner membrane organizing system 1 1 1
MIRT685014 CXorf56 chromosome X open reading frame 56 1 1
MIRT685117 DTD2 D-tyrosyl-tRNA deacylase 2 (putative) 1 1
MIRT685479 CACNG8 calcium channel, voltage-dependent, gamma subunit 8 1 1
MIRT686012 NEK4 NIMA (never in mitosis gene a)-related kinase 4 1 1
MIRT686034 UMPS uridine monophosphate synthetase 1 1
MIRT686561 TPM3 tropomyosin 3 1 1
MIRT686732 TANGO2 chromosome 22 open reading frame 25 1 1
MIRT686968 SFT2D2 SFT2 domain containing 2 1 1
MIRT687289 PARP2 poly (ADP-ribose) polymerase 2 1 1
MIRT687338 OSBPL2 oxysterol binding protein-like 2 1 1
MIRT687556 MLEC malectin 1 1
MIRT687760 KIAA1328 KIAA1328 1 1
MIRT688087 GLUL glutamate-ammonia ligase 1 1
MIRT688603 CYCS cytochrome c, somatic 1 1
MIRT688923 C11orf84 chromosome 11 open reading frame 84 1 1
MIRT689287 C5AR2 G protein-coupled receptor 77 1 1
MIRT689444 CYB561 cytochrome b-561 1 1
MIRT689557 XPO6 exportin 6 1 1
MIRT690053 C6orf141 chromosome 6 open reading frame 141 1 1
MIRT690206 C5orf45 chromosome 5 open reading frame 45 1 1
MIRT690273 CAMLG calcium modulating ligand 1 1
MIRT690333 MRPS30 mitochondrial ribosomal protein S30 1 1
MIRT690528 ZNF566 zinc finger protein 566 1 1
MIRT690583 MICA MHC class I polypeptide-related sequence A 1 1
MIRT690875 PLEKHG2 pleckstrin homology domain containing, family G (with RhoGef domain) member 2 1 1
MIRT691160 APOL6 apolipoprotein L, 6 1 1
MIRT691290 CENPM centromere protein M 1 1
MIRT691766 BCL2L15 BCL2-like 15 1 1
MIRT691784 SLC24A4 solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 1 1
MIRT691835 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT691970 PLCXD1 phosphatidylinositol-specific phospholipase C, X domain containing 1 1 1
MIRT692049 PAK1IP1 PAK1 interacting protein 1 1 1
MIRT692195 POLR1E polymerase (RNA) I polypeptide E, 53kDa 1 1
MIRT692769 NDUFS5 NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) 1 1
MIRT692861 ZSWIM1 zinc finger, SWIM-type containing 1 1 1
MIRT693074 AS3MT arsenic (+3 oxidation state) methyltransferase 1 1
MIRT693123 SCNM1 sodium channel modifier 1 1 1
MIRT693180 NPR1 natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A) 1 1
MIRT693516 MOB3A MOB kinase activator 3A 1 1
MIRT693577 PIGR polymeric immunoglobulin receptor 1 1
MIRT693690 MXRA7 matrix-remodelling associated 7 1 1
MIRT693801 RHOG ras homolog family member G 1 1
MIRT694080 RNASEH2B ribonuclease H2, subunit B 1 1
MIRT694165 SLC36A2 solute carrier family 36 (proton/amino acid symporter), member 2 1 1
MIRT694264 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT694558 BPNT1 3'(2'), 5'-bisphosphate nucleotidase 1 1 1
MIRT694781 BVES blood vessel epicardial substance 1 1
MIRT695047 ALG10B asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast) 1 1
MIRT695436 TCF23 transcription factor 23 1 1
MIRT695568 ZNF562 zinc finger protein 562 1 1
MIRT696370 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT696535 C3 complement component 3 1 1
MIRT696580 TTC21B tetratricopeptide repeat domain 21B 1 1
MIRT696781 DHODH dihydroorotate dehydrogenase (quinone) 1 1
MIRT697077 PSMC4 proteasome (prosome, macropain) 26S subunit, ATPase, 4 1 1
MIRT697106 GPKOW G patch domain and KOW motifs 1 1
MIRT697462 ZC3H4 zinc finger CCCH-type containing 4 1 1
MIRT697500 ZBTB8B zinc finger and BTB domain containing 8B 1 1
MIRT697632 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT697968 TSPYL1 TSPY-like 1 1 1
MIRT698373 TMED4 transmembrane emp24 protein transport domain containing 4 1 1
MIRT698561 TFDP2 transcription factor Dp-2 (E2F dimerization partner 2) 1 1
MIRT698976 SPAST spastin 1 1
MIRT699049 SOAT1 sterol O-acyltransferase 1 1 1
MIRT699097 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 18kDa 1 1
MIRT699492 SLC10A6 solute carrier family 10 (sodium/bile acid cotransporter family), member 6 1 1
MIRT699588 SIKE1 suppressor of IKBKE 1 1 1
MIRT699607 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT700154 RNF115 ring finger protein 115 1 1
MIRT700420 QDPR quinoid dihydropteridine reductase 1 1
MIRT700472 PURB purine-rich element binding protein B 1 1
MIRT700548 PTBP2 polypyrimidine tract binding protein 2 1 1
MIRT700776 PLA2G4A phospholipase A2, group IVA (cytosolic, calcium-dependent) 1 1
MIRT700877 PER2 period homolog 2 (Drosophila) 1 1
MIRT700954 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT701174 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT701283 NUP210 nucleoporin 210kDa 1 1
MIRT701481 NEK9 NIMA (never in mitosis gene a)- related kinase 9 1 1
MIRT701663 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT701781 MSL2 male-specific lethal 2 homolog (Drosophila) 1 1
MIRT701792 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 1
MIRT702796 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 1
MIRT703128 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 1
MIRT703256 GNS glucosamine (N-acetyl)-6-sulfatase 1 1
MIRT703398 GABPB1 GA binding protein transcription factor, beta subunit 1 1 1
MIRT703449 FYTTD1 forty-two-three domain containing 1 1 1
MIRT703659 FAM60A family with sequence similarity 60, member A 1 1
MIRT703767 FAM118A family with sequence similarity 118, member A 1 1
MIRT703864 ERN1 endoplasmic reticulum to nucleus signaling 1 1 1
MIRT704666 CLCC1 chloride channel CLIC-like 1 1 1
MIRT704814 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT704950 CCDC120 coiled-coil domain containing 120 1 1
MIRT705546 ARL10 ADP-ribosylation factor-like 10 1 1
MIRT705627 AP1S3 adaptor-related protein complex 1, sigma 3 subunit 1 1
MIRT705684 ANKRD40 ankyrin repeat domain 40 1 1
MIRT706240 SYT15 synaptotagmin XV 1 1
MIRT706569 EIF2AK2 eukaryotic translation initiation factor 2-alpha kinase 2 1 1
MIRT706691 COL13A1 collagen, type XIII, alpha 1 1 1
MIRT708928 RPP14 ribonuclease P/MRP 14kDa subunit 1 1
MIRT708948 FZR1 fizzy/cell division cycle 20 related 1 (Drosophila) 1 1
MIRT710611 ZNF555 zinc finger protein 555 1 1
MIRT711719 IREB2 iron-responsive element binding protein 2 1 1
MIRT713159 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT714469 KLF13 Kruppel-like factor 13 1 1
MIRT716873 PTK2B PTK2B protein tyrosine kinase 2 beta 1 1
MIRT717146 DLEU1 deleted in lymphocytic leukemia 1 (non-protein coding) 1 1
MIRT717993 C9orf171 chromosome 9 open reading frame 171 1 1
MIRT724120 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT725315 NLRC5 NLR family, CARD domain containing 5 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*