Accession ID: MIRT036653 [miRNA, hsa-miR-935 :: CKB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-935LinkOut: [miRBase ]
Synonyms MIRN935, hsa-mir-935, MIR935
Description Homo sapiens miR-935 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-935
Mature Sequence 56| CCAGUUACCGCUUCCGCUACCGC |78
Evidence Experimental
Experiments Cloned
Putative hsa-miR-935 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CKB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms B-CK, CKBB
Description creatine kinase, brain
Transcript NM_0018    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CKB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CKB
(miRNA target sites are highlighted)
>CKB|NM_0018|3'UTR
   1 TGAAGCCCGGCCCACACCCGACACCAGCCCTGCTGCTTCCTAACTTATTGCCTGGGCAGTGCCCACCATGCACCCCTGAT
  81 GTTCGCCGTCTGGCGAGCCCTTAGCCTTGCTGTAGAGACTTCCGTCACCCTTGGTAGAGTTTATTTTTTTGATGGCTAAG
 161 ATACTGCTGATGCTGAAATAAACTAGGGTTTTGGCCTGCCTGCGTCTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgCCAUCGCCUUCGCCAUUGACc 5'
            | |:||  ||   |  |||| 
Target 5' ttGATGGC-TAA---GATACTGc 3'
149 - 167 81.00 -5.50
2
miRNA  3' cgccaucgccuucgccAUUGACc 5'
                          |: ||| 
Target 5' aactagggttttggccTGCCTGc 3'
181 - 203 72.00 -6.90
3
miRNA  3' cgccaucgccuuCGCCAUUGACc 5'
                      || ||  ||| 
Target 5' cccctgatgttcGCCGT--CTGg 3'
73 - 93 67.00 -6.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-935 :: CKB    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' cgCCATCGCCT--TCGCCATTGAcc 5'
            || :|||||  ||| | |:||  
Target 5' acGGAGGCGGAGCAGCAGCAGCTca 3'
4 - 28
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
62 hsa-miR-935 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT036639 PURB purine-rich element binding protein B 1 1
MIRT036640 DHFR dihydrofolate reductase 1 1
MIRT036641 IKZF5 IKAROS family zinc finger 5 (Pegasus) 1 1
MIRT036642 ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 1 1
MIRT036643 USP7 ubiquitin specific peptidase 7 (herpes virus-associated) 1 1
MIRT036644 SHB Src homology 2 domain containing adaptor protein B 1 1
MIRT036645 ZFP37 zinc finger protein 37 homolog (mouse) 1 1
MIRT036646 ASB3 ankyrin repeat and SOCS box-containing 3 1 1
MIRT036647 DEDD death effector domain containing 1 1
MIRT036648 NBEA neurobeachin 1 1
MIRT036649 USP24 ubiquitin specific peptidase 24 1 1
MIRT036650 NOL10 nucleolar protein 10 1 1
MIRT036651 PTPRK protein tyrosine phosphatase, receptor type, K 1 1
MIRT036652 KDM3B lysine (K)-specific demethylase 3B 1 1
MIRT036653 CKB creatine kinase, brain 1 1
MIRT036654 TMEM205 transmembrane protein 205 1 1
MIRT036655 TGOLN2 trans-golgi network protein 2 1 1
MIRT036656 ITPR2 inositol 1,4,5-triphosphate receptor, type 2 1 1
MIRT036657 CCT5 chaperonin containing TCP1, subunit 5 (epsilon) 1 1
MIRT036658 DHX8 DEAH (Asp-Glu-Ala-His) box polypeptide 8 1 1
MIRT036659 HIST1H4L histone cluster 1, H4l 1 1
MIRT036660 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT036661 SF1 splicing factor 1 1 1
MIRT036662 TUBB tubulin, beta 1 1
MIRT036663 NOB1 NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) 1 1
MIRT036664 RNF26 ring finger protein 26 1 1
MIRT036665 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT036666 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 1
MIRT036667 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 1
MIRT036668 FXN frataxin 1 1
MIRT036669 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT036670 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT036671 TALDO1 transaldolase 1 1 1
MIRT036672 VCP valosin-containing protein 1 1
MIRT036673 ACTG1 actin, gamma 1 1 1
MIRT036674 RPL26 ribosomal protein L26 1 1
MIRT036675 PXMP2 peroxisomal membrane protein 2, 22kDa 1 1
MIRT036676 CREBBP CREB binding protein 1 1
MIRT036677 NFKBIE nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon 1 1
MIRT036678 LDHA lactate dehydrogenase A 1 1
MIRT036679 MTFMT mitochondrial methionyl-tRNA formyltransferase 1 1
MIRT036680 THOP1 thimet oligopeptidase 1 1 1
MIRT036681 SREK1IP1 SFRS12-interacting protein 1 1 1
MIRT036682 TFDP1 transcription factor Dp-1 1 1
MIRT036683 ACTN4 actinin, alpha 4 1 1
MIRT036684 CBX3 chromobox homolog 3 (HP1 gamma homolog, Drosophila) 1 1
MIRT036685 POGK pogo transposable element with KRAB domain 1 1
MIRT036686 RPS9 ribosomal protein S9 1 1
MIRT036687 DPP8 dipeptidyl-peptidase 8 1 1
MIRT036688 MED29 mediator complex subunit 29 1 1
MIRT036689 CANX calnexin 1 1
MIRT036690 DKC1 dyskeratosis congenita 1, dyskerin 1 1
MIRT036691 LMF1 lipase maturation factor 1 1 1
MIRT036692 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT036693 SMG7 Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT036694 LMNB2 lamin B2 1 1
MIRT036695 YBX1 Y box binding protein 1 1 1
MIRT036696 SRSF9 splicing factor, arginine/serine-rich 9 1 1
MIRT036697 PKM pyruvate kinase, muscle 1 1
MIRT036698 TMEM181 transmembrane protein 181 1 1
MIRT036699 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 1 1
MIRT036701 APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 1 1