Accession ID: MIRT036729 [miRNA, hsa-miR-760 :: HSP90AA1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-760LinkOut: [miRBase ]
Synonyms MIRN760, hsa-mir-760, MIR760
Description Homo sapiens miR-760 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-760
Mature Sequence 49| CGGCUCUGGGUCUGUGGGGA |68
Evidence Experimental
Experiments Cloned
Putative hsa-miR-760 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol HSP90AA1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ31884, HSP86, HSP89A, HSP90A, HSP90N, HSPC1, HSPCA, HSPCAL1, HSPCAL4, HSPN, Hsp89, Hsp90, LAP2
Description heat shock protein 90kDa alpha (cytosolic), class A member 1
Transcript NM_0010179    LinkOut: [ RefSeq ]
Other Transcripts NM_0053   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on HSP90AA1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of HSP90AA1
(miRNA target sites are highlighted)
>HSP90AA1|NM_0010179|3'UTR
   1 TAATCTCTGGCTGAGGGATGACTTACCTGTTCAGTACTCTACAATTCCTCTGATAATATATTTTCAAGGATGTTTTTCTT
  81 TATTTTTGTTAATATTAAAAAGTCTGTATGGCATGACAACTACTTTAAGGGGAAGATAAGATTTCTGTCTACTAAGTGAT
 161 GCTGTGATACCTTAGGCACTAAAGCAGAGCTAGTAATGCTTTTTGAGTTTCATGTTGGTTTATTTTCACAGATTGGGGTA
 241 ACGTGCACTGTAAGACGTATGTAACATGATGTTAACTTTGTGGTCTAAAGTGTTTAGCTGTCAAGCCGGATGCCTAAGTA
 321 GACCAAATCTTGTTATTGAAGTGTTCTGAGCTGTATCTTGATGTTTAGAAAAGTATTCGTTACATCTTGTAGGATCTACT
 401 TTTTGAACTTTTCATTCCCTGTAGTTGACAATTCTGCATGTACTAGTCCTCTAGAAATAGGTTAAACTGAAGCAACTTGA
 481 TGGAAGGATCTCTCCACAGGGCTTGTTTTCCAAAGAAAAGTATTGTTTGGAGGAGCAAAGTTAAAAGCCTACCTAAGCAT
 561 ATCGTAAAGCTGTTCAAAAATAACTCAGACCCAGTCTTGTGGATGGAAATGTAGTGCTCGAGTCACATTCTGCTTAAAGT
 641 TGTAACAAATACAGATGAGTTAAAAGATATTGTGTGACAGTGTCTTATTTAGGGGGAAAGGGGAGTATCTGGATGACAGT
 721 TAGTGCCAAAATGTAAAACATGAGGCGCTAGCAGGAGATGGTTAAACACTAGCTGCTCCAAGGGTTGACATGGTCTTCCC
 801 AGCATGTACTCAGCAGGTGTGGGGTGGAGCACACGTAGGCACAGAAAACAGGAATGCAGACAACATGCATCCCCTGCGTC
 881 CATGAGTTACATGTGTTCTCTTAGTGTCCACGTTGTTTTGATGTTATTCATGGAATACCTTCTGTGTTAAATACAGTCAC
 961 TTAATTCCTTGGCCTTAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agggGUGUCUGGGUCUCGGc 5'
              |||  |  ||||||: 
Target 5' taggCACTAAAGCAGAGCTa 3'
173 - 192 132.00 -11.00
2
miRNA  3' aggggUGUCUGGGUCUCGGc 5'
               |:| ||:|||| || 
Target 5' caaaaATA-ACTCAGACCCa 3'
575 - 593 122.00 -14.02
3
miRNA  3' agGGGUGUCUGGGUCUCGGc 5'
            |:| |   | |||:||: 
Target 5' atCTCTC---CACAGGGCTt 3'
488 - 504 111.00 -16.26
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-760 :: HSP90AA1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
94 hsa-miR-760 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT007209 CSNK2A1 casein kinase 2, alpha 1 polypeptide 3 1
MIRT036706 COX1 cytochrome c oxidase subunit I 1 1
MIRT036707 RTN3 reticulon 3 1 1
MIRT036708 VARS valyl-tRNA synthetase 1 1
MIRT036709 ZNF703 zinc finger protein 703 1 1
MIRT036710 XRN2 5'-3' exoribonuclease 2 1 1
MIRT036711 SGSM1 small G protein signaling modulator 1 1 1
MIRT036712 SETD1A SET domain containing 1A 1 1
MIRT036713 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT036714 SON SON DNA binding protein 1 1
MIRT036715 PTMA prothymosin, alpha 1 1
MIRT036716 TRRAP transformation/transcription domain-associated protein 1 1
MIRT036717 PBX3 pre-B-cell leukemia homeobox 3 1 1
MIRT036718 TUBA1B tubulin, alpha 1b 1 1
MIRT036719 COASY CoA synthase 1 1
MIRT036720 UNK unkempt homolog (Drosophila) 1 1
MIRT036721 ND2 MTND2 1 1
MIRT036722 PSMD3 proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 1 1
MIRT036723 SDHA succinate dehydrogenase complex, subunit A, flavoprotein (Fp) 1 1
MIRT036724 FEM1A fem-1 homolog a (C. elegans) 1 1
MIRT036725 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT036726 FAM160A2 family with sequence similarity 160, member A2 1 1
MIRT036727 LAMB1 laminin, beta 1 1 1
MIRT036728 RPL36A ribosomal protein L36a 1 1
MIRT036729 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT036730 WDR6 WD repeat domain 6 1 1
MIRT036731 PEF1 penta-EF-hand domain containing 1 1 1
MIRT036732 UBB ubiquitin B 1 1
MIRT036733 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT036734 DUSP7 dual specificity phosphatase 7 1 1
MIRT036735 UBE3B ubiquitin protein ligase E3B 1 1
MIRT036736 HIST1H2AI histone cluster 1, H2ai 1 1
MIRT036737 PDXK pyridoxal (pyridoxine, vitamin B6) kinase 1 1
MIRT036738 DROSHA ribonuclease type III, nuclear 1 1
MIRT036739 PHIP pleckstrin homology domain interacting protein 1 1
MIRT036740 HIPK2 homeodomain interacting protein kinase 2 1 1
MIRT036741 KIAA1967 KIAA1967 1 1
MIRT036742 ST3GAL2 ST3 beta-galactoside alpha-2,3-sialyltransferase 2 1 1
MIRT036743 NCOA6 nuclear receptor coactivator 6 1 1
MIRT036744 FAM213B chromosome 1 open reading frame 93 1 1
MIRT036745 ND3 NADH dehydrogenase, subunit 3 (complex I) 1 1
MIRT036746 GUSB glucuronidase, beta 1 1
MIRT036747 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT036748 TLN1 talin 1 1 1
MIRT036749 LSM2 LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT036750 RPL29 ribosomal protein L29 1 1
MIRT036751 PRRC2A HLA-B associated transcript 2 1 1
MIRT036752 BCORL1 BCL6 corepressor-like 1 1 1
MIRT036753 SYMPK symplekin 1 1
MIRT036754 NPTX1 neuronal pentraxin I 1 1
MIRT036755 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT036756 ZNF618 zinc finger protein 618 1 1
MIRT036757 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT036758 ATXN2L ataxin 2-like 1 1
MIRT036759 PDCD6IP programmed cell death 6 interacting protein 1 1
MIRT036760 GPI glucose-6-phosphate isomerase 1 1
MIRT036761 RPS2 ribosomal protein S2 1 1
MIRT036762 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT036763 PBX2 pre-B-cell leukemia homeobox 2 1 1
MIRT036764 EMC10 chromosome 19 open reading frame 63 1 1
MIRT036765 HOXA13 homeobox A13 1 1
MIRT036766 EPM2AIP1 EPM2A (laforin) interacting protein 1 1 1
MIRT036767 ATP1B3 ATPase, Na+/K+ transporting, beta 3 polypeptide 1 1
MIRT036768 HMGA2 high mobility group AT-hook 2 1 1
MIRT036769 TUBA1C tubulin, alpha 1c 1 1
MIRT036770 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 1
MIRT036771 MINK1 misshapen-like kinase 1 (zebrafish) 1 1
MIRT036772 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT036773 FAM195A family with sequence similarity 195, member A 1 1
MIRT036774 FDFT1 farnesyl-diphosphate farnesyltransferase 1 1 1
MIRT036775 ACBD4 acyl-CoA binding domain containing 4 1 1
MIRT036776 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT036777 SRRM1 serine/arginine repetitive matrix 1 1 1
MIRT036778 NDFIP2 Nedd4 family interacting protein 2 1 1
MIRT036779 UBAP2L ubiquitin associated protein 2-like 1 1
MIRT036780 RHOT2 ras homolog gene family, member T2 1 1
MIRT036781 CORO1B coronin, actin binding protein, 1B 1 1
MIRT036782 KIAA1244 KIAA1244 1 1
MIRT036783 BAG6 HLA-B associated transcript 3 1 1
MIRT036784 WBP1L chromosome 10 open reading frame 26 1 1
MIRT036785 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT036786 WDR46 WD repeat domain 46 1 1
MIRT036787 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT036788 URB1 URB1 ribosome biogenesis 1 homolog (S. cerevisiae) 1 1
MIRT036789 RAB35 RAB35, member RAS oncogene family 1 1
MIRT036790 LYRM2 LYR motif containing 2 1 1
MIRT036791 MAGED1 melanoma antigen family D, 1 1 1
MIRT036792 EIF2B5 eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa 1 1
MIRT036793 PAIP1 poly(A) binding protein interacting protein 1 1 1
MIRT036794 FOXJ2 forkhead box J2 1 1
MIRT036795 HIST1H3D histone cluster 1, H3d 1 1
MIRT036796 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT036797 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 1 1
MIRT036798 DNTTIP1 deoxynucleotidyltransferase, terminal, interacting protein 1 1 1