Accession ID: MIRT037171 [miRNA, hsa-miR-877-3p :: EPB41L3, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-877LinkOut: [miRBase ]
Synonyms MIRN877, hsa-mir-877, miRNA877, MIR877
Description Homo sapiens miR-877 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-877-3p
Mature Sequence 66| UCCUCUUCUCCCUCCUCCCAG |86
Evidence Experimental
Experiments Cloned
Putative hsa-miR-877-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol EPB41L3 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms 4.1B, DAL-1, DAL1, FLJ37633, KIAA0987
Description erythrocyte membrane protein band 4.1-like 3
Transcript NM_0123    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on EPB41L3 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of EPB41L3
(miRNA target sites are highlighted)
>EPB41L3|NM_0123|3'UTR
   1 CCAGAAGATGGAGAGGATTGACCAGAGGAATAACTTAGCTTGCACATGAATGCAGTCATGCAAACCGTTAGGAAAACCAG
  81 AGCCTATATGGAGTTCCCTCTTCTAACCCAACTGACTTGTATCTGTCCGTGGAAAATTTCAGTCCAGAAGAATTGACCTT
 161 GACCATTAATAAAGACACTGGCAGAGAGATCTTCCCATAATAAAGCAATCTGATTCAGCATCACTAAACCGATAATGCAT
 241 GAAGCAACGATAAAATTACAAAAGAGCAGCATTTTTAATTTTCACAAAATGTCTCAGTTTTCAGCTATACCTGCACGTTC
 321 ATAACCAACAATATAAACCGTGGTCTCATGTAACACATAAACAATTCATGCCTTTCATAGTTTATTATTATTAAAGTCTA
 401 AACAAAATTGCAATTTCTTAGGTAACCTTATATTTACAATAAATGAAGATTACCCTCAAATGCTAGAAGCTGTCTAGGTC
 481 CGTCCGGTGTGTCAGATTTTCCTCAGATTAGATGTGCCAATAACCAAGTTTATTCAGTAAACAACTTGTACTTGTTTCAT
 561 CTGGTTTTATTACTCTCACCCATAAACAGTAATGACTCTCTGACCCTCTGGAAATATGTAATGCTTCCAATCTTGCTTTG
 641 TGTATCTCATTTAATTTGTTATAAGGTAGTACTGATTTTAGCATATTAATGCGATTTCTTCCTTGTTGTTTGCTTTGGTC
 721 TGTGTTCAATCCAGAGAGCTTAAATTGTCATTATTTTGGGAAGAAAACCTGTATTTTTGTTAGTTTACAATATTATGAAA
 801 TTTCACTTCAGGAGAAACTGCTGGGCTTCCTGTGGCTTTGTTTTCTTAGTTACTTTTTCCGTGCCGTGTATTTTTTAATT
 881 GATTTTTCTTCTTTTACTTGAAAAGAAAGTGTTTTATTTTCAAATCTGGTCCATATTTACATTCTAGTTCAGAGCCAAGC
 961 CTTAAACTGTACAGAATTTCCACTGTAATTAAAACTATTTAGTGTTAGTTATAAATAGCCTTCAAAAAGAGAGATTCTCC
1041 ATTACACGATCACCTGCATCACAGCCCATGGTGAATGTATGTTTCTGCATAGCGAAATAAAAATGGCAAATGCACTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gacccucCUCCCUCUUCUCCu 5'
                 || |  |:||||| 
Target 5' ----ccaGAAGATGGAGAGGa 3'
1 - 17 130.00 -12.90
2
miRNA  3' gacccuccuccCUCUUCUccu 5'
                     |:|||||   
Target 5' gtcattattttGGGAAGAaaa 3'
747 - 767 106.00 -5.65
3
miRNA  3' gacccuccucccUCUUCUccu 5'
                      ||:|||   
Target 5' aaatttcacttcAGGAGAaac 3'
798 - 818 89.00 -5.54
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-877-3p :: EPB41L3    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gaCCCTCCTCCCTCTTCTCCt 5'
            || ||||||| ||:|||| 
Target 5' gaGGAAGGAGGG-GAGGAGGt 3'
4 - 23
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
399 hsa-miR-877-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT036805 SLC6A8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 1 1
MIRT036806 TRAK2 trafficking protein, kinesin binding 2 1 1
MIRT036807 ITM2C integral membrane protein 2C 1 1
MIRT036808 TBC1D9B TBC1 domain family, member 9B (with GRAM domain) 1 1
MIRT036809 LRPPRC leucine-rich PPR-motif containing 1 1
MIRT036810 FAM122B family with sequence similarity 122B 1 1
MIRT036811 RHOT1 ras homolog gene family, member T1 1 1
MIRT036812 AIFM1 apoptosis-inducing factor, mitochondrion-associated, 1 1 1
MIRT036813 CEP152 centrosomal protein 152kDa 1 1
MIRT036814 LTN1 ring finger protein 160 1 1
MIRT036815 HIST1H1E histone cluster 1, H1e 1 1
MIRT036816 OVCH2 ovochymase 2 (gene/pseudogene) 1 1
MIRT036817 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT036818 ISG20L2 interferon stimulated exonuclease gene 20kDa-like 2 1 1
MIRT036819 THOC2 THO complex 2 1 1
MIRT036820 CAPN7 calpain 7 1 1
MIRT036821 SYNPR synaptoporin 1 1
MIRT036822 LBX2 ladybird homeobox 2 1 1
MIRT036823 RLF rearranged L-myc fusion 1 1
MIRT036824 ZRANB2 zinc finger, RAN-binding domain containing 2 1 1
MIRT036825 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT036826 CUX1 cut-like homeobox 1 1 1
MIRT036827 TIMELESS timeless homolog (Drosophila) 1 1
MIRT036828 NSF N-ethylmaleimide-sensitive factor 1 1
MIRT036829 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT036830 CKAP4 cytoskeleton-associated protein 4 1 1
MIRT036831 NCK2 NCK adaptor protein 2 1 1
MIRT036832 FASN fatty acid synthase 1 1
MIRT036833 PRPF38B PRP38 pre-mRNA processing factor 38 (yeast) domain containing B 1 1
MIRT036834 UQCRC1 ubiquinol-cytochrome c reductase core protein I 1 1
MIRT036835 SND1 staphylococcal nuclease and tudor domain containing 1 1 1
MIRT036836 PANK2 pantothenate kinase 2 1 1
MIRT036837 USP7 ubiquitin specific peptidase 7 (herpes virus-associated) 1 1
MIRT036838 CDC123 cell division cycle 123 homolog (S. cerevisiae) 1 1
MIRT036839 PDIA4 protein disulfide isomerase family A, member 4 1 1
MIRT036840 AKAP12 A kinase (PRKA) anchor protein 12 1 1
MIRT036841 HDLBP high density lipoprotein binding protein 1 1
MIRT036842 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT036843 ELAC2 elaC homolog 2 (E. coli) 1 1
MIRT036844 IPO5 importin 5 1 1
MIRT036845 RNF10 ring finger protein 10 1 1
MIRT036846 GNL2 guanine nucleotide binding protein-like 2 (nucleolar) 1 1
MIRT036847 EXOC5 exocyst complex component 5 1 1
MIRT036848 CLEC5A C-type lectin domain family 5, member A 1 1
MIRT036849 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT036850 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT036851 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 1 1
MIRT036852 HELLS helicase, lymphoid-specific 1 1
MIRT036853 PI4KB phosphatidylinositol 4-kinase, catalytic, beta 1 1
MIRT036854 TFG TRK-fused gene 1 1
MIRT036855 GPD2 glycerol-3-phosphate dehydrogenase 2 (mitochondrial) 1 1
MIRT036856 ZNF134 zinc finger protein 134 1 1
MIRT036857 TPRKB TP53RK binding protein 1 1
MIRT036858 MPI mannose phosphate isomerase 1 1
MIRT036859 CCDC43 coiled-coil domain containing 43 1 1
MIRT036860 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase, type II, gamma 1 1
MIRT036861 KLHDC3 kelch domain containing 3 1 1
MIRT036862 ZC3H7B zinc finger CCCH-type containing 7B 1 1
MIRT036863 MDC1 mediator of DNA-damage checkpoint 1 1 1
MIRT036864 AGPAT4 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) 1 1
MIRT036865 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT036866 P4HA1 prolyl 4-hydroxylase, alpha polypeptide I 1 1
MIRT036867 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT036868 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT036869 HSD17B10 hydroxysteroid (17-beta) dehydrogenase 10 1 1
MIRT036870 TSPYL1 TSPY-like 1 1 1
MIRT036871 PSMD10 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 1 1
MIRT036872 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT036873 WDR33 WD repeat domain 33 1 1
MIRT036874 DENR density-regulated protein 1 1
MIRT036875 KBTBD7 kelch repeat and BTB (POZ) domain containing 7 1 1
MIRT036876 AP2A2 adaptor-related protein complex 2, alpha 2 subunit 1 1
MIRT036877 STK24 serine/threonine kinase 24 (STE20 homolog, yeast) 1 1
MIRT036878 TP53BP2 tumor protein p53 binding protein, 2 1 1
MIRT036879 TMEM19 transmembrane protein 19 1 1
MIRT036880 MLLT6 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 1 1
MIRT036881 NUP50 nucleoporin 50kDa 1 1
MIRT036882 SPAG9 sperm associated antigen 9 1 1
MIRT036883 COPB2 coatomer protein complex, subunit beta 2 (beta prime) 1 1
MIRT036884 URGCP upregulator of cell proliferation 1 1
MIRT036885 LIMCH1 LIM and calponin homology domains 1 1 1
MIRT036886 ECI2 peroxisomal D3,D2-enoyl-CoA isomerase 1 1
MIRT036887 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT036888 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT036889 NCL nucleolin 1 1
MIRT036890 CTDSPL2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 1 1
MIRT036891 AMMECR1L AMME chromosomal region gene 1-like 1 1
MIRT036892 LEPREL4 synaptonemal complex protein SC65 1 1
MIRT036893 TTC3 tetratricopeptide repeat domain 3 1 1
MIRT036894 BRD4 bromodomain containing 4 1 1
MIRT036895 AKT2 v-akt murine thymoma viral oncogene homolog 2 1 1
MIRT036896 ERO1LB ERO1-like beta (S. cerevisiae) 1 1
MIRT036897 NUDT5 nudix (nucleoside diphosphate linked moiety X)-type motif 5 1 1
MIRT036898 ZBTB18 zinc finger protein 238 1 1
MIRT036899 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT036900 KIF1C kinesin family member 1C 1 1
MIRT036901 CADM1 cell adhesion molecule 1 1 1
MIRT036902 HNRNPL heterogeneous nuclear ribonucleoprotein L 1 1
MIRT036903 MVB12B family with sequence similarity 125, member B 1 1
MIRT036904 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT036905 GEMIN5 gem (nuclear organelle) associated protein 5 1 1
MIRT036906 ZNF687 zinc finger protein 687 1 1
MIRT036907 OLA1 Obg-like ATPase 1 1 1
MIRT036908 KIAA0195 KIAA0195 1 1
MIRT036909 FRAT1 frequently rearranged in advanced T-cell lymphomas 1 1
MIRT036910 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT036911 RNF181 ring finger protein 181 1 1
MIRT036912 HSPA2 heat shock 70kDa protein 2 1 1
MIRT036913 ZNF629 zinc finger protein 629 1 1
MIRT036914 SYNCRIP synaptotagmin binding, cytoplasmic RNA interacting protein 1 1
MIRT036915 PSMC4 proteasome (prosome, macropain) 26S subunit, ATPase, 4 1 1
MIRT036916 KIAA0586 KIAA0586 1 1
MIRT036917 SNRPF small nuclear ribonucleoprotein polypeptide F 1 1
MIRT036918 ACAA1 acetyl-CoA acyltransferase 1 1 1
MIRT036919 SET SET nuclear oncogene 1 1
MIRT036920 HTATSF1 HIV-1 Tat specific factor 1 1 1
MIRT036921 SPAG5 sperm associated antigen 5 1 1
MIRT036922 PNN pinin, desmosome associated protein 1 1
MIRT036923 VOPP1 vesicular, overexpressed in cancer, prosurvival protein 1 1 1
MIRT036924 ANKRD52 ankyrin repeat domain 52 1 1
MIRT036925 EXPH5 exophilin 5 1 1
MIRT036926 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT036927 SF3B2 splicing factor 3b, subunit 2, 145kDa 1 1
MIRT036928 TTL tubulin tyrosine ligase 1 1
MIRT036929 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT036930 SEPT2 septin 2 1 1
MIRT036931 TUBA1B tubulin, alpha 1b 1 1
MIRT036932 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 1 1
MIRT036933 TUBA1C tubulin, alpha 1c 1 1
MIRT036934 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 1
MIRT036935 BPTF bromodomain PHD finger transcription factor 1 1
MIRT036936 FIP1L1 FIP1 like 1 (S. cerevisiae) 1 1
MIRT036937 DOCK5 dedicator of cytokinesis 5 1 1
MIRT036938 DDX21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 1 1
MIRT036939 STIM2 stromal interaction molecule 2 1 1
MIRT036940 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT036941 SLC20A2 solute carrier family 20 (phosphate transporter), member 2 1 1
MIRT036942 SRSF4 splicing factor, arginine/serine-rich 4 1 1
MIRT036943 SSH1 slingshot homolog 1 (Drosophila) 1 1
MIRT036944 ZNF473 zinc finger protein 473 1 1
MIRT036945 HDDC2 HD domain containing 2 1 1
MIRT036946 SRP9 signal recognition particle 9kDa 1 1
MIRT036947 DLC1 deleted in liver cancer 1 1 1
MIRT036948 WDR1 WD repeat domain 1 1 1
MIRT036949 RARS arginyl-tRNA synthetase 1 1
MIRT036950 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT036951 RPL19 ribosomal protein L19 1 1
MIRT036952 ASH2L ash2 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT036953 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT036954 GMEB2 glucocorticoid modulatory element binding protein 2 1 1
MIRT036955 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT036956 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT036957 ATG4A ATG4 autophagy related 4 homolog A (S. cerevisiae) 1 1
MIRT036958 BRPF3 bromodomain and PHD finger containing, 3 1 1
MIRT036959 VCPIP1 valosin containing protein (p97)/p47 complex interacting protein 1 1 1
MIRT036960 EML5 echinoderm microtubule associated protein like 5 1 1
MIRT036961 SLC48A1 solute carrier family 48 (heme transporter), member 1 1 1
MIRT036962 PBRM1 polybromo 1 1 1
MIRT036963 KANSL3 KIAA1310 1 1
MIRT036964 EIF3B eukaryotic translation initiation factor 3, subunit B 1 1
MIRT036965 PKM pyruvate kinase, muscle 1 1
MIRT036966 GLUL glutamate-ammonia ligase 1 1
MIRT036967 TSFM Ts translation elongation factor, mitochondrial 1 1
MIRT036968 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 1 1
MIRT036969 RAB21 RAB21, member RAS oncogene family 1 1
MIRT036970 PLEKHB2 pleckstrin homology domain containing, family B (evectins) member 2 1 1
MIRT036971 CD99 CD99 molecule 1 1
MIRT036972 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 1 1
MIRT036973 ZNF696 zinc finger protein 696 1 1
MIRT036974 LY6E lymphocyte antigen 6 complex, locus E 1 1
MIRT036975 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT036976 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT036977 SLC9A3R1 solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 1 1
MIRT036978 CCND2 cyclin D2 1 1
MIRT036979 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT036980 WDR4 WD repeat domain 4 1 1
MIRT036981 RBM8A RNA binding motif protein 8A 1 1
MIRT036982 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT036983 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT036984 ITPR2 inositol 1,4,5-triphosphate receptor, type 2 1 1
MIRT036985 YDJC YdjC homolog (bacterial) 1 1
MIRT036986 CCT7 chaperonin containing TCP1, subunit 7 (eta) 1 1
MIRT036987 EEF2K eukaryotic elongation factor-2 kinase 1 1
MIRT036988 CLSTN3 calsyntenin 3 1 1
MIRT036989 C3orf37 chromosome 3 open reading frame 37 1 1
MIRT036990 ND6 NADH dehydrogenase, subunit 6 (complex I) 1 1
MIRT036991 AP1M1 adaptor-related protein complex 1, mu 1 subunit 1 1
MIRT036992 KLRG1 killer cell lectin-like receptor subfamily G, member 1 1 1
MIRT036993 ITPR3 inositol 1,4,5-triphosphate receptor, type 3 1 1
MIRT036994 ENSA endosulfine alpha 1 1
MIRT036995 VAV2 vav 2 guanine nucleotide exchange factor 1 1
MIRT036996 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT036997 SDHC succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa 1 1
MIRT036998 KDM3B lysine (K)-specific demethylase 3B 1 1
MIRT036999 TXLNA taxilin alpha 1 1
MIRT037000 HIRA HIR histone cell cycle regulation defective homolog A (S. cerevisiae) 1 1
MIRT037001 WASF2 WAS protein family, member 2 1 1
MIRT037002 ATXN1 ataxin 1 1 1
MIRT037003 AGGF1 angiogenic factor with G patch and FHA domains 1 1 1
MIRT037004 HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 1 1
MIRT037005 ADCY9 adenylate cyclase 9 1 1
MIRT037006 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT037007 FLAD1 FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) 1 1
MIRT037008 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT037009 HGS hepatocyte growth factor-regulated tyrosine kinase substrate 1 1
MIRT037010 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT037011 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT037012 TIMM10B fracture callus 1 homolog (rat) 1 1
MIRT037013 DDX6 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 1 1
MIRT037014 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide 1 1
MIRT037015 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT037016 C1orf115 chromosome 1 open reading frame 115 1 1
MIRT037017 ZNF792 zinc finger protein 792 1 1
MIRT037018 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT037019 WDR43 WD repeat domain 43 1 1
MIRT037020 HMGB1 high-mobility group box 1 1 1
MIRT037021 DCTN3 dynactin 3 (p22) 1 1
MIRT037022 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT037023 SETD5 SET domain containing 5 1 1
MIRT037024 PBX1 pre-B-cell leukemia homeobox 1 1 1
MIRT037025 ARFGEF1 ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited) 1 1
MIRT037026 BRD7 bromodomain containing 7 1 1
MIRT037027 ERBB2IP erbb2 interacting protein 1 1
MIRT037028 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 1
MIRT037029 KIAA1429 KIAA1429 1 1
MIRT037030 PIGS phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT037031 SH2B3 SH2B adaptor protein 3 1 1
MIRT037032 PDE12 phosphodiesterase 12 1 1
MIRT037033 EMILIN3 elastin microfibril interfacer 3 1 1
MIRT037034 AACS acetoacetyl-CoA synthetase 1 1
MIRT037035 CCDC117 coiled-coil domain containing 117 1 1
MIRT037036 NACA nascent polypeptide-associated complex alpha subunit 1 1
MIRT037037 SCARB1 scavenger receptor class B, member 1 1 1
MIRT037038 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT037039 ARFIP1 ADP-ribosylation factor interacting protein 1 1 1
MIRT037040 KAT6A MYST histone acetyltransferase (monocytic leukemia) 3 1 1
MIRT037041 ANP32B acidic (leucine-rich) nuclear phosphoprotein 32 family, member B 1 1
MIRT037042 EML4 echinoderm microtubule associated protein like 4 1 1
MIRT037043 ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 1 1
MIRT037044 COL18A1 collagen, type XVIII, alpha 1 1 1
MIRT037045 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 1
MIRT037046 LETM1 leucine zipper-EF-hand containing transmembrane protein 1 1 1
MIRT037047 ACTG1 actin, gamma 1 1 1
MIRT037048 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 1 1
MIRT037049 ARL2 ADP-ribosylation factor-like 2 1 1
MIRT037050 TUBA1A tubulin, alpha 1a 1 1
MIRT037051 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT037052 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT037053 SCAF8 RNA binding motif protein 16 1 1
MIRT037054 CUL4B cullin 4B 1 1
MIRT037055 NOMO3 NODAL modulator 3 1 1
MIRT037056 TMEM120B transmembrane protein 120B 1 1
MIRT037057 CLN3 ceroid-lipofuscinosis, neuronal 3 1 1
MIRT037058 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT037059 UTP18 UTP18, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT037060 PRRC2C HLA-B associated transcript 2-like 2 1 1
MIRT037061 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT037062 PRDM1 PR domain containing 1, with ZNF domain 1 1
MIRT037063 UBE2O ubiquitin-conjugating enzyme E2O 1 1
MIRT037064 DNAJC7 DnaJ (Hsp40) homolog, subfamily C, member 7 1 1
MIRT037065 FAM216A chromosome 12 open reading frame 24 1 1
MIRT037066 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT037067 HIRIP3 HIRA interacting protein 3 1 1
MIRT037068 TRIM28 tripartite motif-containing 28 1 1
MIRT037069 PRRC2B HLA-B associated transcript 2-like 1 1 1
MIRT037070 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT037071 ACLY ATP citrate lyase 1 1
MIRT037072 RPL13A ribosomal protein L13a 1 1
MIRT037073 HN1L hematological and neurological expressed 1-like 1 1
MIRT037074 PRMT1 protein arginine methyltransferase 1 1 1
MIRT037075 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 1
MIRT037076 CBX1 chromobox homolog 1 (HP1 beta homolog Drosophila ) 1 1
MIRT037077 WDR62 WD repeat domain 62 1 1
MIRT037078 GOLM1 golgi membrane protein 1 1 1
MIRT037079 XPO4 exportin 4 1 1
MIRT037080 TRIM25 tripartite motif-containing 25 1 1
MIRT037081 MBD3 methyl-CpG binding domain protein 3 1 1
MIRT037082 CFL1 cofilin 1 (non-muscle) 1 1
MIRT037083 F2R coagulation factor II (thrombin) receptor 1 1
MIRT037084 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT037085 HIST2H2BE histone cluster 2, H2be 1 1
MIRT037086 TCERG1 transcription elongation regulator 1 1 1
MIRT037087 ZNF330 zinc finger protein 330 1 1
MIRT037088 RRM1 ribonucleotide reductase M1 1 1
MIRT037089 VAPB VAMP (vesicle-associated membrane protein)-associated protein B and C 1 1
MIRT037090 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT037091 PTPRK protein tyrosine phosphatase, receptor type, K 1 1
MIRT037092 CDK11A cyclin-dependent kinase 11A 1 1
MIRT037093 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT037094 ZHX3 zinc fingers and homeoboxes 3 1 1
MIRT037095 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT037096 GTF3C5 general transcription factor IIIC, polypeptide 5, 63kDa 1 1
MIRT037097 CCDC137 coiled-coil domain containing 137 1 1
MIRT037098 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT037099 POM121 POM121 membrane glycoprotein (rat) 1 1
MIRT037100 ARGLU1 arginine and glutamate rich 1 1 1
MIRT037101 HERC2 hect domain and RLD 2 1 1
MIRT037102 TSC22D3 TSC22 domain family, member 3 1 1
MIRT037103 CTIF KIAA0427 1 1
MIRT037104 TRAF3IP1 TNF receptor-associated factor 3 interacting protein 1 1 1
MIRT037105 KHDRBS1 KH domain containing, RNA binding, signal transduction associated 1 1 1
MIRT037106 AAMP angio-associated, migratory cell protein 1 1
MIRT037107 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT037108 RPL22 ribosomal protein L22 1 1
MIRT037109 ZDHHC7 zinc finger, DHHC-type containing 7 1 1
MIRT037110 NGFRAP1 nerve growth factor receptor (TNFRSF16) associated protein 1 1 1
MIRT037111 ZBTB38 zinc finger and BTB domain containing 38 1 1
MIRT037112 LIMA1 LIM domain and actin binding 1 1 1
MIRT037113 CANX calnexin 1 1
MIRT037114 SH2B1 SH2B adaptor protein 1 1 1
MIRT037115 SYAP1 synapse associated protein 1, SAP47 homolog (Drosophila) 1 1
MIRT037116 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT037117 ARNT aryl hydrocarbon receptor nuclear translocator 1 1
MIRT037118 RASL10B RAS-like, family 10, member B 1 1
MIRT037119 DBN1 drebrin 1 1 1
MIRT037120 BCLAF1 BCL2-associated transcription factor 1 1 1
MIRT037121 ANK2 ankyrin 2, neuronal 1 1
MIRT037122 AP2B1 adaptor-related protein complex 2, beta 1 subunit 1 1
MIRT037123 CDC42EP1 CDC42 effector protein (Rho GTPase binding) 1 1 1
MIRT037124 KIFC1 kinesin family member C1 1 1
MIRT037125 BRF1 BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) 1 1
MIRT037126 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT037127 ZMIZ2 zinc finger, MIZ-type containing 2 1 1
MIRT037128 EIF1AD eukaryotic translation initiation factor 1A domain containing 1 1
MIRT037129 CRAMP1L Crm, cramped-like (Drosophila) 1 1
MIRT037130 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 1 1
MIRT037131 ECM2 extracellular matrix protein 2, female organ and adipocyte specific 1 1
MIRT037132 SHCBP1 SHC SH2-domain binding protein 1 1 1
MIRT037133 MAGED2 melanoma antigen family D, 2 1 1
MIRT037134 EXOC4 exocyst complex component 4 1 1
MIRT037135 PPM1G protein phosphatase, Mg2+/Mn2+ dependent, 1G 1 1
MIRT037136 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT037137 NHSL1 NHS-like 1 1 1
MIRT037138 CWC22 CWC22 spliceosome-associated protein homolog (S. cerevisiae) 1 1
MIRT037139 STK33 serine/threonine kinase 33 1 1
MIRT037140 FBXO18 F-box protein, helicase, 18 1 1
MIRT037141 MYH14 myosin, heavy chain 14, non-muscle 1 1
MIRT037142 VPS54 vacuolar protein sorting 54 homolog (S. cerevisiae) 1 1
MIRT037143 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT037144 CMYA5 cardiomyopathy associated 5 1 1
MIRT037145 NELFCD TH1-like (Drosophila) 1 1
MIRT037146 ZNF593 zinc finger protein 593 1 1
MIRT037147 TRAPPC11 chromosome 4 open reading frame 41 1 1
MIRT037148 ANXA6 annexin A6 1 1
MIRT037149 TAF5L TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT037150 SNRNP200 small nuclear ribonucleoprotein 200kDa (U5) 1 1
MIRT037151 PDHA1 pyruvate dehydrogenase (lipoamide) alpha 1 1 1
MIRT037152 YARS tyrosyl-tRNA synthetase 1 1
MIRT037153 KPNB1 karyopherin (importin) beta 1 1 1
MIRT037154 GLYR1 glyoxylate reductase 1 homolog (Arabidopsis) 1 1
MIRT037155 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT037156 DDX31 DEAD (Asp-Glu-Ala-Asp) box polypeptide 31 1 1
MIRT037157 HADHA hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit 1 1
MIRT037158 ATP5I ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E 1 1
MIRT037159 ARHGEF2 Rho/Rac guanine nucleotide exchange factor (GEF) 2 1 1
MIRT037160 MOGS mannosyl-oligosaccharide glucosidase 1 1
MIRT037161 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT037162 PRRC2A HLA-B associated transcript 2 1 1
MIRT037163 RPL36A ribosomal protein L36a 1 1
MIRT037164 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT037165 LMNB2 lamin B2 1 1
MIRT037166 BCDIN3D BCDIN3 domain containing 1 1
MIRT037167 TARS threonyl-tRNA synthetase 1 1
MIRT037168 BASP1 brain abundant, membrane attached signal protein 1 1 1
MIRT037169 SLC38A1 solute carrier family 38, member 1 1 1
MIRT037170 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT037171 EPB41L3 erythrocyte membrane protein band 4.1-like 3 1 1
MIRT037172 BNIP2 BCL2/adenovirus E1B 19kDa interacting protein 2 1 1
MIRT037173 TTLL4 tubulin tyrosine ligase-like family, member 4 1 1
MIRT037174 FAM115A family with sequence similarity 115, member A 1 1
MIRT037175 AUP1 ancient ubiquitous protein 1 1 1
MIRT037176 HMGA1 high mobility group AT-hook 1 1 1
MIRT037177 UBXN7 UBX domain protein 7 1 1
MIRT037178 ABR active BCR-related gene 1 1
MIRT037179 KHNYN KH and NYN domain containing 1 1
MIRT037180 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 1
MIRT037181 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT037182 IGHMBP2 immunoglobulin mu binding protein 2 1 1
MIRT037183 CATSPERG cation channel, sperm-associated, gamma 1 1
MIRT037184 GSG1 germ cell associated 1 1 1
MIRT037185 UBE2D3 ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) 1 1
MIRT037186 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT037187 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT037188 PARP4 poly (ADP-ribose) polymerase family, member 4 1 1
MIRT037189 IPO4 importin 4 1 1
MIRT037190 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT037191 PROCR protein C receptor, endothelial 1 1
MIRT037192 COL6A1 collagen, type VI, alpha 1 1 1
MIRT037193 RAB10 RAB10, member RAS oncogene family 1 1
MIRT037194 PDAP1 PDGFA associated protein 1 1 1
MIRT037195 MFHAS1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT037197 KIAA1967 KIAA1967 1 1
MIRT037198 PRKAG1 protein kinase, AMP-activated, gamma 1 non-catalytic subunit 1 1
MIRT037199 SBF1 SET binding factor 1 1 1
MIRT037200 TNFRSF13B tumor necrosis factor receptor superfamily, member 13B 1 1
MIRT037201 BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 1 1
MIRT037202 SCRIB scribbled homolog (Drosophila) 1 1
MIRT037203 FBRS fibrosin 1 1
MIRT037204 EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) 1 1