Accession ID: MIRT037262 [miRNA, hsa-miR-877-5p :: UCHL1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-877LinkOut: [miRBase ]
Synonyms MIRN877, hsa-mir-877, miRNA877, MIR877
Description Homo sapiens miR-877 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-877-5p
Mature Sequence 1| GUAGAGGAGAUGGCGCAGGG |20
Evidence Experimental
Experiments Cloned
Putative hsa-miR-877-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol UCHL1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms PARK5, PGP 9.5, PGP9.5, PGP95, Uch-L1
Description ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
Transcript NM_0041    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on UCHL1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of UCHL1
(miRNA target sites are highlighted)
>UCHL1|NM_0041|3'UTR
   1 TAATGCTCTGTGGGAGGGACTTTGCTGATTTCCCCTCTTCCCTTCAACATGAAAATATATACCCCCCCATGCAGTCTAAA
  81 ATGCTTCAGTACTTGTGAAACACAGCTGTTCTTCTGTTCTGCAGACACGCCTTCCCCTCAGCCACACCCAGGCACTTAAG
 161 CACAAGCAGAGTGCACAGCTGTCCACTGGGCCATTGTGGTGTGAGCTTCAGATGGTGAAGCATTCTCCCCAGTGTATGTC
 241 TTGTATCCGATATCTAACGCTTTAAATGGCTACTTTGGTTTCTGTCTGTAAGTTAAGACCTTGGATGTGGTTTAATTGTT
 321 TGTCCTCAAAAGGAATAAAACTTTTCTGCTGATAAGATAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gggacgCGGUAGAGGAGAUg 5'
                ||::| ||:|||: 
Target 5' aacacaGCTGT-TCTTCTGt 3'
99 - 117 117.00 -8.50
2
miRNA  3' ggGACGCGG-UAGAGGAGAug 5'
            || :||: ||:||| ||  
Target 5' gaCTTTGCTGATTTCCCCTct 3'
18 - 38 110.00 -14.70
3
miRNA  3' gggacgcgguAGAGGAGAUg 5'
                    | ||||| | 
Target 5' tttaattgttTGTCCTCAAa 3'
311 - 330 110.00 -6.42
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-877-5p :: UCHL1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
173 hsa-miR-877-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT037205 RPLP1 ribosomal protein, large, P1 1 1
MIRT037206 LRRC57 leucine rich repeat containing 57 1 1
MIRT037207 SYNPR synaptoporin 1 1
MIRT037208 LETMD1 LETM1 domain containing 1 1 1
MIRT037209 GYLTL1B glycosyltransferase-like 1B 1 1
MIRT037210 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT037211 MAPRE1 microtubule-associated protein, RP/EB family, member 1 1 1
MIRT037212 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT037213 TBCC tubulin folding cofactor C 1 1
MIRT037214 TMEM167A transmembrane protein 167A 1 1
MIRT037215 CDR2L cerebellar degeneration-related protein 2-like 1 1
MIRT037216 EIF2AK2 eukaryotic translation initiation factor 2-alpha kinase 2 1 1
MIRT037217 PLK1 polo-like kinase 1 (Drosophila) 1 1
MIRT037218 HMGB3 high-mobility group box 3 1 1
MIRT037219 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT037220 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 1
MIRT037221 RC3H1 ring finger and CCCH-type zinc finger domains 1 1 1
MIRT037222 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT037223 MC4R melanocortin 4 receptor 1 1
MIRT037224 NACA nascent polypeptide-associated complex alpha subunit 1 1
MIRT037225 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 1 1
MIRT037226 INPP4A inositol polyphosphate-4-phosphatase, type I, 107kDa 1 1
MIRT037227 HSPA8 heat shock 70kDa protein 8 1 1
MIRT037228 RNF126 ring finger protein 126 1 1
MIRT037229 DSCR3 Down syndrome critical region gene 3 1 1
MIRT037230 ARHGEF6 Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 1 1
MIRT037231 SEC24C SEC24 family, member C (S. cerevisiae) 1 1
MIRT037232 AP3S1 adaptor-related protein complex 3, sigma 1 subunit 1 1
MIRT037233 ZBTB11 zinc finger and BTB domain containing 11 1 1
MIRT037234 TET1 tet oncogene 1 1 1
MIRT037235 TUBB2B tubulin, beta 2B 1 1
MIRT037236 RPL35 ribosomal protein L35 1 1
MIRT037237 CHAMP1 zinc finger protein 828 1 1
MIRT037238 FAM72A family with sequence similarity 72, member A 1 1
MIRT037239 DDX47 DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 1 1
MIRT037240 TMEM106B transmembrane protein 106B 1 1
MIRT037241 INTS1 integrator complex subunit 1 1 1
MIRT037242 RNF167 ring finger protein 167 1 1
MIRT037243 C17orf51 chromosome 17 open reading frame 51 1 1
MIRT037244 ARL9 ADP-ribosylation factor-like 9 1 1
MIRT037245 TOB2 transducer of ERBB2, 2 1 1
MIRT037246 TUBA1B tubulin, alpha 1b 1 1
MIRT037247 SHISA5 shisa homolog 5 (Xenopus laevis) 1 1
MIRT037248 MEF2D myocyte enhancer factor 2D 1 1
MIRT037249 NELFE RD RNA binding protein 1 1
MIRT037250 STAU1 staufen, RNA binding protein, homolog 1 (Drosophila) 1 1
MIRT037251 CCND2 cyclin D2 1 1
MIRT037252 ECEL1 endothelin converting enzyme-like 1 1 1
MIRT037253 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT037254 FBXL8 F-box and leucine-rich repeat protein 8 1 1
MIRT037255 RPS27 ribosomal protein S27 1 1
MIRT037256 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT037257 RPL23A ribosomal protein L23a 1 1
MIRT037258 CAB39 calcium binding protein 39 1 1
MIRT037259 SLC25A5 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 1 1
MIRT037260 RAB1B RAB1B, member RAS oncogene family 1 1
MIRT037261 USP30 ubiquitin specific peptidase 30 1 1
MIRT037262 UCHL1 ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) 1 1
MIRT037263 ANP32A acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 1 1
MIRT037264 MEGF9 multiple EGF-like-domains 9 1 1
MIRT037265 TCF25 transcription factor 25 (basic helix-loop-helix) 1 1
MIRT037266 TMEM30A transmembrane protein 30A 1 1
MIRT037267 MTHFD1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase 1 1
MIRT037268 CHD8 chromodomain helicase DNA binding protein 8 1 1
MIRT037269 FAM122B family with sequence similarity 122B 1 1
MIRT037270 USP33 ubiquitin specific peptidase 33 1 1
MIRT037271 GORASP2 golgi reassembly stacking protein 2, 55kDa 1 1
MIRT037272 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 1
MIRT037273 GLUL glutamate-ammonia ligase 1 1
MIRT037274 SLC25A1 solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 1 1
MIRT037275 USP2 ubiquitin specific peptidase 2 1 1
MIRT037276 PRND prion protein 2 (dublet) 1 1
MIRT037277 SQSTM1 sequestosome 1 1 1
MIRT037278 PPIL4 peptidylprolyl isomerase (cyclophilin)-like 4 1 1
MIRT037279 DGKD diacylglycerol kinase, delta 130kDa 1 1
MIRT037280 FOXC1 forkhead box C1 1 1
MIRT037281 THRA thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) 1 1
MIRT037282 FAM171A1 family with sequence similarity 171, member A1 1 1
MIRT037283 ERF Ets2 repressor factor 1 1
MIRT037284 CSTB cystatin B (stefin B) 1 1
MIRT037285 SIGMAR1 sigma non-opioid intracellular receptor 1 1 1
MIRT037286 PRCC papillary renal cell carcinoma (translocation-associated) 1 1
MIRT037287 TMEM147 transmembrane protein 147 1 1
MIRT037288 HIST1H2BL histone cluster 1, H2bl 1 1
MIRT037289 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 1 1
MIRT037290 LEPR leptin receptor 1 1
MIRT037291 UBE2N ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast) 1 1
MIRT037292 NOTCH2NL Notch homolog 2 (Drosophila) N-terminal like 1 1
MIRT037293 SREBF2 sterol regulatory element binding transcription factor 2 1 1
MIRT037294 MTMR3 myotubularin related protein 3 1 1
MIRT037295 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT037296 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 1
MIRT037297 EIF5A eukaryotic translation initiation factor 5A 1 1
MIRT037298 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT037299 KIAA1147 KIAA1147 1 1
MIRT037300 CAMSAP1 calmodulin regulated spectrin-associated protein 1 1 1
MIRT037301 CASC3 cancer susceptibility candidate 3 1 1
MIRT037302 UBC ubiquitin C 1 1
MIRT037303 SLC25A3 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 1 1
MIRT037304 RNF41 ring finger protein 41 1 1
MIRT037305 SURF4 surfeit 4 1 1
MIRT037306 LNPEP leucyl/cystinyl aminopeptidase 1 1
MIRT037307 GRB10 growth factor receptor-bound protein 10 1 1
MIRT037308 BRD2 bromodomain containing 2 1 1
MIRT037309 ZNF174 zinc finger protein 174 1 1
MIRT037310 SAP18 Sin3A-associated protein, 18kDa 1 1
MIRT037311 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT037312 MPI mannose phosphate isomerase 1 1
MIRT037313 MARCKS myristoylated alanine-rich protein kinase C substrate 1 1
MIRT037314 PLD3 phospholipase D family, member 3 1 1
MIRT037315 ATP5O ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit 1 1
MIRT037316 HIST1H3B histone cluster 1, H3b 1 1
MIRT037317 AKAP1 A kinase (PRKA) anchor protein 1 1 1
MIRT037318 MLXIP MLX interacting protein 1 1
MIRT037319 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT037320 TXN2 thioredoxin 2 1 1
MIRT037321 WBP11 WW domain binding protein 11 1 1
MIRT037322 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT037323 MAPK8 mitogen-activated protein kinase 8 1 1
MIRT037324 PTDSS1 phosphatidylserine synthase 1 1 1
MIRT037325 ELF4 E74-like factor 4 (ets domain transcription factor) 1 1
MIRT037326 TUBB tubulin, beta 1 1
MIRT037327 TAF11 TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa 1 1
MIRT037328 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT037329 SLC39A1 solute carrier family 39 (zinc transporter), member 1 1 1
MIRT037330 ZNF280B zinc finger protein 280B 1 1
MIRT037331 ZKSCAN8 zinc finger protein 192 1 1
MIRT037332 ACBD3 acyl-CoA binding domain containing 3 1 1
MIRT037333 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT037334 OTUD7B OTU domain containing 7B 1 1
MIRT037335 UBL5 ubiquitin-like 5 1 1
MIRT037336 AFF1 AF4/FMR2 family, member 1 1 1
MIRT037337 ZBTB38 zinc finger and BTB domain containing 38 1 1
MIRT037338 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT037339 IGF2 insulin-like growth factor 2 (somatomedin A) 1 1
MIRT037340 ADCY3 adenylate cyclase 3 1 1
MIRT037341 TMX3 thioredoxin-related transmembrane protein 3 1 1
MIRT037342 NDUFB11 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa 1 1
MIRT037343 ZNF283 zinc finger protein 283 1 1
MIRT037344 CMTM8 CKLF-like MARVEL transmembrane domain containing 8 1 1
MIRT037345 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT037346 RNASEK ribonuclease, RNase K 1 1
MIRT037347 ND2 MTND2 1 1
MIRT037348 PAPOLA poly(A) polymerase alpha 1 1
MIRT037349 FAM127A family with sequence similarity 127, member A 1 1
MIRT037350 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 1
MIRT037351 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 1 1
MIRT037352 TEX264 testis expressed 264 1 1
MIRT037353 CENPF centromere protein F, 350/400ka (mitosin) 1 1
MIRT037354 SORBS3 sorbin and SH3 domain containing 3 1 1
MIRT037355 PROX1 prospero homeobox 1 1 1
MIRT037356 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT037357 SMG1 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT037358 PI4K2A phosphatidylinositol 4-kinase type 2 alpha 1 1
MIRT037359 ACTA1 actin, alpha 1, skeletal muscle 1 1
MIRT037360 ACTG1 actin, gamma 1 1 1
MIRT037361 IGF2BP2 insulin-like growth factor 2 mRNA binding protein 2 1 1
MIRT037362 MTMR14 myotubularin related protein 14 1 1
MIRT037363 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT037364 TPP1 tripeptidyl peptidase I 1 1
MIRT037365 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT037366 ORC2 origin recognition complex, subunit 2-like (yeast) 1 1
MIRT037367 HADH hydroxyacyl-CoA dehydrogenase 1 1
MIRT037368 TMEM184B transmembrane protein 184B 1 1
MIRT037369 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT037370 HMGA1 high mobility group AT-hook 1 1 1
MIRT037371 VDAC1 voltage-dependent anion channel 1 1 1
MIRT037372 FBXO7 F-box protein 7 1 1
MIRT037373 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT037374 HAND1 heart and neural crest derivatives expressed 1 1 1
MIRT037375 MICU1 calcium binding atopy-related autoantigen 1 1 1
MIRT037376 CCNT2 cyclin T2 1 1
MIRT037377 SH3GL1 SH3-domain GRB2-like 1 1 1