Accession ID: MIRT037433 [miRNA, hsa-miR-744-5p :: GAK, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-744LinkOut: [miRBase ]
Synonyms MIRN744, hsa-mir-744, MIR744
Description Homo sapiens miR-744 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-744-5p
Mature Sequence 11| UGCGGGGCUAGGGCUAACAGCA |32
Evidence Experimental
Experiments Cloned
Putative hsa-miR-744-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol GAK LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ16629, FLJ40395, MGC99654
Description cyclin G associated kinase
Transcript NM_0052    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on GAK LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of GAK
(miRNA target sites are highlighted)
>GAK|NM_0052|3'UTR
   1 TGAGGCCGCAGTGGTGGTGGCTGCGCACACAGCTCCACAGGTTGGGAGCCGTCGTGGGACCTGGGTCCCCACCGTGAGGA
  81 CCCCGTGGGCGACAGCAGGTGTGGCCAGGGTGGGGCTCCGAGCCCCGGGTCACCGCCCGCCCAGCGTTCCAGGCACATGA
 161 AGAGAAAGCATTCCAAAGCCTCTGATTGTTGTTTCCTTTTTCTCCTCCCGAAGGAACAGCTGATTCATGCTCCTCCCGCA
 241 ATTGTCACGTCTGTGATTTATTTGGTGTTTCGGGCGTGGCCTCTGGAGCCCCGGCACGTGGTGGGCCACGCTGCTGGCGC
 321 TCATGGGCCCTGGTGTTTGCACCGCACTTTGTAATCAGTCCCGTGGTTGTCTGTACAGAATTAAACTATTTTCCGATGAA
 401 AAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' acgacaAUCGG-GA--UCGGGGCgu 5'
                |:||| ||  |||||||  
Target 5' cgggcgTGGCCTCTGGAGCCCCGgc 3'
271 - 295 138.00 -23.00
2
miRNA  3' acgaCAAUC--GGGAUCGGGGCgu 5'
              || :|  :|| |||||||  
Target 5' caggGTGGGGCTCCGAGCCCCGgg 3'
106 - 129 136.00 -22.10
3
miRNA  3' acGACAAUCGGGA----UCGGGGCgu 5'
            ||| |:|| ||    :||||:|  
Target 5' cgCTGCTGGCGCTCATGGGCCCTGgt 3'
309 - 334 126.00 -21.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-744-5p :: GAK    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
364 hsa-miR-744-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT016085 ARL15 ADP-ribosylation factor-like 15 1 1
MIRT016086 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 1 2
MIRT016087 PPTC7 PTC7 protein phosphatase homolog (S. cerevisiae) 1 1
MIRT016088 RASSF1 Ras association (RalGDS/AF-6) domain family member 1 1 1
MIRT016089 IER5 immediate early response 5 1 1
MIRT037383 UFC1 ubiquitin-fold modifier conjugating enzyme 1 1 1
MIRT037384 STAM2 signal transducing adaptor molecule (SH3 domain and ITAM motif) 2 1 1
MIRT037385 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT037386 DCXR dicarbonyl/L-xylulose reductase 1 1
MIRT037387 TSPAN17 tetraspanin 17 1 1
MIRT037388 ACTB actin, beta 1 1
MIRT037389 HIST1H2BC histone cluster 1, H2bc 1 1
MIRT037390 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT037391 VDAC1 voltage-dependent anion channel 1 1 1
MIRT037392 RNASEK ribonuclease, RNase K 1 1
MIRT037393 CDK16 cyclin-dependent kinase 16 1 1
MIRT037394 ZCCHC24 zinc finger, CCHC domain containing 24 1 1
MIRT037395 ARRDC2 arrestin domain containing 2 1 1
MIRT037396 SGMS1 sphingomyelin synthase 1 1 1
MIRT037397 HSPD1 heat shock 60kDa protein 1 (chaperonin) 1 1
MIRT037398 MRPL46 mitochondrial ribosomal protein L46 1 1
MIRT037399 RHEB Ras homolog enriched in brain 1 1
MIRT037400 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT037401 TP53I13 tumor protein p53 inducible protein 13 1 1
MIRT037402 CD44 CD44 molecule (Indian blood group) 1 1
MIRT037403 USP12 ubiquitin specific peptidase 12 1 1
MIRT037404 AP2B1 adaptor-related protein complex 2, beta 1 subunit 1 1
MIRT037405 RPL18A ribosomal protein L18a 1 1
MIRT037406 PPP1CA protein phosphatase 1, catalytic subunit, alpha isozyme 1 1
MIRT037407 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT037408 PXK PX domain containing serine/threonine kinase 1 1
MIRT037409 TDRKH tudor and KH domain containing 1 1
MIRT037410 PRRC2A HLA-B associated transcript 2 1 1
MIRT037411 ATP11A ATPase, class VI, type 11A 1 1
MIRT037412 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT037413 STK16 serine/threonine kinase 16 1 1
MIRT037414 PSMB2 proteasome (prosome, macropain) subunit, beta type, 2 1 1
MIRT037415 EPN1 epsin 1 1 1
MIRT037416 EN2 engrailed homeobox 2 1 1
MIRT037417 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT037418 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT037419 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 1 1
MIRT037420 AP2A2 adaptor-related protein complex 2, alpha 2 subunit 1 1
MIRT037421 ACTG1 actin, gamma 1 1 1
MIRT037422 PIKFYVE phosphoinositide kinase, FYVE finger containing 1 1
MIRT037423 UBE2O ubiquitin-conjugating enzyme E2O 1 1
MIRT037424 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT037425 SECISBP2 SECIS binding protein 2 1 1
MIRT037426 KIAA0922 KIAA0922 1 1
MIRT037427 PTMA prothymosin, alpha 1 1
MIRT037428 WDR45B WDR45-like 1 1
MIRT037429 ZNF282 zinc finger protein 282 1 1
MIRT037430 GART phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase 1 1
MIRT037431 TNKS tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 1 1
MIRT037432 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT037433 GAK cyclin G associated kinase 1 1
MIRT037434 ATP6 ATP synthase F0 subunit 6 1 1
MIRT037435 DIDO1 death inducer-obliterator 1 1 1
MIRT037436 RPL3 ribosomal protein L3 1 1
MIRT037437 AIMP2 aminoacyl tRNA synthetase complex-interacting multifunctional protein 2 1 1
MIRT037438 PIGC phosphatidylinositol glycan anchor biosynthesis, class C 1 1
MIRT037439 ARHGEF2 Rho/Rac guanine nucleotide exchange factor (GEF) 2 1 1
MIRT037440 USP21 ubiquitin specific peptidase 21 1 1
MIRT037441 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT037442 RPS6 ribosomal protein S6 1 1
MIRT037443 ILKAP integrin-linked kinase-associated serine/threonine phosphatase 2C 1 1
MIRT037444 COX1 cytochrome c oxidase subunit I 1 1
MIRT037445 VPS37C vacuolar protein sorting 37 homolog C (S. cerevisiae) 1 1
MIRT037446 CDK12 cyclin-dependent kinase 12 1 1
MIRT037447 RBM8A RNA binding motif protein 8A 1 1
MIRT037448 CKB creatine kinase, brain 1 1
MIRT037449 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT037450 DDX23 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 1 1
MIRT037451 ABI3 ABI family, member 3 1 1
MIRT037452 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT037453 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT037454 C17orf70 chromosome 17 open reading frame 70 1 1
MIRT037455 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT037456 KCTD11 potassium channel tetramerisation domain containing 11 1 1
MIRT037457 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT037458 NCOA3 nuclear receptor coactivator 3 1 1
MIRT037459 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 1 1
MIRT037460 GDI2 GDP dissociation inhibitor 2 1 1
MIRT037461 SLC2A4RG SLC2A4 regulator 1 1
MIRT037462 SLX4 BTB (POZ) domain containing 12 1 1
MIRT037463 COPA coatomer protein complex, subunit alpha 1 1
MIRT037464 GPRASP2 G protein-coupled receptor associated sorting protein 2 1 1
MIRT037465 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT037466 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT037467 COTL1 coactosin-like 1 (Dictyostelium) 1 1
MIRT037468 CAPNS1 calpain, small subunit 1 1 1
MIRT037469 FRZB frizzled-related protein 1 1
MIRT037470 UBQLN4 ubiquilin 4 1 1
MIRT037471 NUP153 nucleoporin 153kDa 1 1
MIRT037472 TMEM175 transmembrane protein 175 1 1
MIRT037473 HIST1H2BD histone cluster 1, H2bd 1 1
MIRT037474 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT037475 BCL2L12 BCL2-like 12 (proline rich) 1 1
MIRT037476 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT037477 MINK1 misshapen-like kinase 1 (zebrafish) 1 1
MIRT037478 PDXK pyridoxal (pyridoxine, vitamin B6) kinase 1 1
MIRT037479 FAM110A family with sequence similarity 110, member A 1 1
MIRT037480 ZNF598 zinc finger protein 598 1 1
MIRT037481 ILK integrin-linked kinase 1 1
MIRT037482 HINT1 histidine triad nucleotide binding protein 1 1 1
MIRT037483 WBP2 WW domain binding protein 2 1 1
MIRT037484 CYTB cytochrome b 1 1
MIRT037485 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT037486 TRIM33 tripartite motif-containing 33 1 1
MIRT037487 SLC25A3 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 1 1
MIRT037488 IRS4 insulin receptor substrate 4 1 1
MIRT037489 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 1
MIRT037490 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT037491 ATXN2L ataxin 2-like 1 1
MIRT037492 MTOR mechanistic target of rapamycin (serine/threonine kinase) 1 1
MIRT037493 ZNF318 zinc finger protein 318 1 1
MIRT037494 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT037495 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT037496 STMN1 stathmin 1 1 1
MIRT037497 SAT1 spermidine/spermine N1-acetyltransferase 1 1 1
MIRT037498 SALL1 sal-like 1 (Drosophila) 1 1
MIRT037499 ZSCAN18 zinc finger and SCAN domain containing 18 1 1
MIRT037500 SLC35D1 solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1 1 1
MIRT037501 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT037502 TIAM1 T-cell lymphoma invasion and metastasis 1 1 1
MIRT037503 CHD5 chromodomain helicase DNA binding protein 5 1 1
MIRT037504 BAG6 HLA-B associated transcript 3 1 1
MIRT037505 MED28 mediator complex subunit 28 1 1
MIRT037506 ANKRD52 ankyrin repeat domain 52 1 1
MIRT037507 MTHFD1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase 1 1
MIRT037508 PPDPF pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish) 1 1
MIRT037509 PRKACA protein kinase, cAMP-dependent, catalytic, alpha 1 1
MIRT037510 HPCAL4 hippocalcin like 4 1 1
MIRT037511 ZNF256 zinc finger protein 256 1 1
MIRT037512 CGNL1 cingulin-like 1 1 1
MIRT037513 TUBA1B tubulin, alpha 1b 1 1
MIRT037514 LNPEP leucyl/cystinyl aminopeptidase 1 1
MIRT037515 PDE4A phosphodiesterase 4A, cAMP-specific (phosphodiesterase E2 dunce homolog, Drosophila) 1 1
MIRT037516 HOXD11 homeobox D11 1 1
MIRT037517 QARS glutaminyl-tRNA synthetase 1 1
MIRT037518 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT037519 PLEKHM2 pleckstrin homology domain containing, family M (with RUN domain) member 2 1 1
MIRT037520 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT037521 KIAA1462 KIAA1462 1 1
MIRT037522 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 1
MIRT037523 YBX1 Y box binding protein 1 1 1
MIRT037524 PTGES3 prostaglandin E synthase 3 (cytosolic) 1 1
MIRT037525 FOXO3 forkhead box O3 1 1
MIRT037526 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT037527 AARS alanyl-tRNA synthetase 1 1
MIRT037528 ZNF155 zinc finger protein 155 1 1
MIRT037529 NCS1 neuronal calcium sensor 1 1 1
MIRT037530 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT037531 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 1 1
MIRT037532 MAPK7 mitogen-activated protein kinase 7 1 1
MIRT037533 AGPAT2 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) 1 1
MIRT037534 HIST1H1E histone cluster 1, H1e 1 1
MIRT037535 MLF2 myeloid leukemia factor 2 1 1
MIRT037536 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT037537 CHRAC1 chromatin accessibility complex 1 1 1
MIRT037538 WIPF3 WAS/WASL interacting protein family, member 3 1 1
MIRT037539 COX2 cytochrome c oxidase subunit II 1 1
MIRT037540 SRSF1 splicing factor, arginine/serine-rich 1 1 1
MIRT037541 CTNNBIP1 catenin, beta interacting protein 1 1 1
MIRT037542 RPL4 ribosomal protein L4 1 1
MIRT037543 COX3 cytochrome c oxidase III 1 1
MIRT037544 DDX54 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 1 1
MIRT037545 TOB2 transducer of ERBB2, 2 1 1
MIRT037546 MAN2C1 mannosidase, alpha, class 2C, member 1 1 1
MIRT037547 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 1
MIRT037548 RPLP1 ribosomal protein, large, P1 1 1
MIRT037549 RAN RAN, member RAS oncogene family 1 1
MIRT037550 NONO non-POU domain containing, octamer-binding 1 1
MIRT037551 CYB5R3 cytochrome b5 reductase 3 1 1
MIRT037552 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 1 1
MIRT037553 COLGALT1 glycosyltransferase 25 domain containing 1 1 1
MIRT037554 MGRN1 mahogunin, ring finger 1 1 1
MIRT037555 ANAPC1 anaphase promoting complex subunit 1 1 1
MIRT037556 TBX1 T-box 1 1 1
MIRT037557 NXPH4 neurexophilin 4 1 1
MIRT037558 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT037559 UBE2A ubiquitin-conjugating enzyme E2A (RAD6 homolog) 1 1
MIRT037560 KPNB1 karyopherin (importin) beta 1 1 1
MIRT037561 NDUFB10 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa 1 1
MIRT037562 SYMPK symplekin 1 1
MIRT037563 SYPL1 synaptophysin-like 1 1 1
MIRT037564 LRP3 low density lipoprotein receptor-related protein 3 1 1
MIRT037565 DDX24 DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 1 1
MIRT037566 WDR37 WD repeat domain 37 1 1
MIRT037567 RPS14 ribosomal protein S14 1 1
MIRT037568 FAM53C family with sequence similarity 53, member C 1 1
MIRT037569 NMT1 N-myristoyltransferase 1 1 1
MIRT037570 PAGR1 chromosome 16 open reading frame 53 1 1
MIRT037571 AKT2 v-akt murine thymoma viral oncogene homolog 2 1 1
MIRT037572 TMEM14C transmembrane protein 14C 1 1
MIRT037573 MEX3D mex-3 homolog D (C. elegans) 1 1
MIRT037574 BRAF v-raf murine sarcoma viral oncogene homolog B1 1 1
MIRT037575 POLR2L polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa 1 1
MIRT037576 SERP1 stress-associated endoplasmic reticulum protein 1 1 1
MIRT037577 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT037578 NR1D2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT037579 POLD3 polymerase (DNA-directed), delta 3, accessory subunit 1 1
MIRT037580 HMGA1 high mobility group AT-hook 1 1 1
MIRT037581 SLC35B4 solute carrier family 35, member B4 1 1
MIRT037582 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT037583 PLEKHG2 pleckstrin homology domain containing, family G (with RhoGef domain) member 2 1 1
MIRT037584 RPL7A ribosomal protein L7a 1 1
MIRT037585 LAIR1 leukocyte-associated immunoglobulin-like receptor 1 1 1
MIRT037586 RPL10 ribosomal protein L10 1 1
MIRT037587 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT037588 SRM spermidine synthase 1 1
MIRT037589 EIF3K eukaryotic translation initiation factor 3, subunit K 1 1
MIRT037590 DESI1 PPPDE peptidase domain containing 2 1 1
MIRT037591 BET1 blocked early in transport 1 homolog (S. cerevisiae) 1 1
MIRT037592 HTRA2 HtrA serine peptidase 2 1 1
MIRT037593 LARP6 La ribonucleoprotein domain family, member 6 1 1
MIRT037594 NOTCH2 Notch homolog 2 (Drosophila) 1 1
MIRT037595 ADCY9 adenylate cyclase 9 1 1
MIRT037596 C6orf62 chromosome 6 open reading frame 62 1 1
MIRT037597 FBXL19 F-box and leucine-rich repeat protein 19 1 1
MIRT037598 L3MBTL2 l(3)mbt-like 2 (Drosophila) 1 1
MIRT037599 TRIM28 tripartite motif-containing 28 1 1
MIRT037600 LGALS3 lectin, galactoside-binding, soluble, 3 1 1
MIRT037601 IGSF8 immunoglobulin superfamily, member 8 1 1
MIRT037602 LIN37 lin-37 homolog (C. elegans) 1 1
MIRT037603 PTPRF protein tyrosine phosphatase, receptor type, F 1 1
MIRT037604 MTSS1L metastasis suppressor 1-like 1 1
MIRT037605 TRMT2A TRM2 tRNA methyltransferase 2 homolog A (S. cerevisiae) 1 1
MIRT037606 DVL1 dishevelled, dsh homolog 1 (Drosophila) 1 1
MIRT037607 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B) 1 1
MIRT037608 TOR2A torsin family 2, member A 1 1
MIRT037609 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT037610 SMYD4 SET and MYND domain containing 4 1 1
MIRT037611 TJAP1 tight junction associated protein 1 (peripheral) 1 1
MIRT037612 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT037613 PPM1M protein phosphatase, Mg2+/Mn2+ dependent, 1M 1 1
MIRT037614 EIF4A2 eukaryotic translation initiation factor 4A2 1 1
MIRT037615 GFER growth factor, augmenter of liver regeneration 1 1
MIRT037616 PKP2 plakophilin 2 1 1
MIRT037617 FARSB phenylalanyl-tRNA synthetase, beta subunit 1 1
MIRT037618 OPRD1 opioid receptor, delta 1 1 1
MIRT037619 CCNY cyclin Y 1 1
MIRT037620 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT037621 CXCL16 chemokine (C-X-C motif) ligand 16 1 1
MIRT037622 CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 1 1
MIRT037623 DDX11 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae) 1 1
MIRT037624 URB1 URB1 ribosome biogenesis 1 homolog (S. cerevisiae) 1 1
MIRT037625 SBF1 SET binding factor 1 1 1
MIRT037626 GNB2 guanine nucleotide binding protein (G protein), beta polypeptide 2 1 1
MIRT037627 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT037628 DDX17 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 1 1
MIRT037629 SORBS3 sorbin and SH3 domain containing 3 1 1
MIRT037630 TAPBP TAP binding protein (tapasin) 1 1
MIRT037631 BCR breakpoint cluster region 1 1
MIRT037632 RPL18 ribosomal protein L18 1 1
MIRT037633 INTS3 integrator complex subunit 3 1 1
MIRT037634 CDC25B cell division cycle 25 homolog B (S. pombe) 1 1
MIRT037635 LDOC1L leucine zipper, down-regulated in cancer 1-like 1 1
MIRT037636 TUB tubby homolog (mouse) 1 1
MIRT037637 NUDT2 nudix (nucleoside diphosphate linked moiety X)-type motif 2 1 1
MIRT037638 CDAN1 congenital dyserythropoietic anemia, type I 1 1
MIRT037639 MRS2 MRS2 magnesium homeostasis factor homolog (S. cerevisiae) 1 1
MIRT037640 PYGB phosphorylase, glycogen; brain 1 1
MIRT037641 LDLRAD3 low density lipoprotein receptor class A domain containing 3 1 1
MIRT037642 COL5A1 collagen, type V, alpha 1 1 1
MIRT037643 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT037644 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT037645 ZNF212 zinc finger protein 212 1 1
MIRT037646 TSC2 tuberous sclerosis 2 1 1
MIRT037647 FASN fatty acid synthase 1 1
MIRT037648 NOL9 nucleolar protein 9 1 1
MIRT037649 CLUH KIAA0664 1 1
MIRT037650 PHF8 PHD finger protein 8 1 1
MIRT037651 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 1 1
MIRT037652 TRAPPC12 tetratricopeptide repeat domain 15 1 1
MIRT037653 HOXC11 homeobox C11 1 1
MIRT037654 DGCR14 DiGeorge syndrome critical region gene 14 1 1
MIRT037655 SLC25A1 solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 1 1
MIRT037656 MEX3C mex-3 homolog C (C. elegans) 1 1
MIRT037657 RAI1 retinoic acid induced 1 1 1
MIRT037658 LY6E lymphocyte antigen 6 complex, locus E 1 1
MIRT037659 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT037660 RPL37 ribosomal protein L37 1 1
MIRT037661 CNN2 calponin 2 1 1
MIRT037662 ALDH18A1 aldehyde dehydrogenase 18 family, member A1 1 1
MIRT037663 POMGNT1 protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase 1 1
MIRT037664 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT037665 PIM3 pim-3 oncogene 1 1
MIRT037666 PTPMT1 protein tyrosine phosphatase, mitochondrial 1 1 1
MIRT037667 NCEH1 neutral cholesterol ester hydrolase 1 1 1
MIRT037668 ART5 ADP-ribosyltransferase 5 1 1
MIRT037669 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT037670 NCL nucleolin 1 1
MIRT037671 NCKAP5L NCK-associated protein 5-like 1 1
MIRT037672 ZCCHC14 zinc finger, CCHC domain containing 14 1 1
MIRT037673 CCDC71 coiled-coil domain containing 71 1 1
MIRT037674 SURF4 surfeit 4 1 1
MIRT037675 RPL13 ribosomal protein L13 1 1
MIRT037676 ACTN4 actinin, alpha 4 1 1
MIRT037677 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT037678 MIF macrophage migration inhibitory factor (glycosylation-inhibiting factor) 1 1
MIRT037679 UBE2N ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast) 1 1
MIRT037680 LYNX1 Ly6/neurotoxin 1 1 1
MIRT037681 TACC3 transforming, acidic coiled-coil containing protein 3 1 1
MIRT037682 GSR glutathione reductase 1 1
MIRT037683 GSK3A glycogen synthase kinase 3 alpha 1 1
MIRT037684 ZMYM3 zinc finger, MYM-type 3 1 1
MIRT037685 ERP29 endoplasmic reticulum protein 29 1 1
MIRT037686 MATR3 matrin 3 1 1
MIRT037687 FANCG Fanconi anemia, complementation group G 1 1
MIRT037688 FAM83G family with sequence similarity 83, member G 1 1
MIRT037689 DUSP18 dual specificity phosphatase 18 1 1
MIRT037690 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 1 1
MIRT037691 TSPAN7 tetraspanin 7 1 1
MIRT037692 ATMIN ATM interactor 1 1
MIRT037693 SEPT2 septin 2 1 1
MIRT037694 FOXRED2 FAD-dependent oxidoreductase domain containing 2 1 1
MIRT037695 TECR trans-2,3-enoyl-CoA reductase 1 1
MIRT037696 MRPL11 mitochondrial ribosomal protein L11 1 1
MIRT037697 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT037698 PSMD4 proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 1 1
MIRT037699 SH3GL1 SH3-domain GRB2-like 1 1 1
MIRT037700 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT037701 TMEM189 transmembrane protein 189 1 1
MIRT037702 LDLR low density lipoprotein receptor 1 1
MIRT037703 OGFR opioid growth factor receptor 1 1
MIRT037704 ADAP2 ArfGAP with dual PH domains 2 1 1
MIRT037705 LIPA lipase A, lysosomal acid, cholesterol esterase 1 1
MIRT037706 SNAPC4 small nuclear RNA activating complex, polypeptide 4, 190kDa 1 1
MIRT037707 FBN2 fibrillin 2 1 1
MIRT037708 ZNF704 zinc finger protein 704 1 1
MIRT037709 EIF3M eukaryotic translation initiation factor 3, subunit M 1 1
MIRT037710 SMC1A structural maintenance of chromosomes 1A 1 1
MIRT037711 FZR1 fizzy/cell division cycle 20 related 1 (Drosophila) 1 1
MIRT037712 NANOS1 nanos homolog 1 (Drosophila) 1 1
MIRT037713 PRR12 proline rich 12 1 1
MIRT037714 PHC2 polyhomeotic homolog 2 (Drosophila) 1 1
MIRT037715 NOP9 chromosome 14 open reading frame 21 1 1
MIRT037716 HM13 histocompatibility (minor) 13 1 1
MIRT037717 PRDX5 peroxiredoxin 5 1 1
MIRT037718 IRGQ immunity-related GTPase family, Q 1 1
MIRT037719 TGFB1 transforming growth factor, beta 1 1 1
MIRT037720 MARCH3 membrane-associated ring finger (C3HC4) 3 1 1
MIRT037721 TBX2 T-box 2 1 1
MIRT037722 TSC22D3 TSC22 domain family, member 3 1 1
MIRT037723 DUT deoxyuridine triphosphatase 1 1
MIRT037724 FAM171A2 family with sequence similarity 171, member A2 1 1
MIRT037725 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT037726 FRAT1 frequently rearranged in advanced T-cell lymphomas 1 1
MIRT037727 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT037728 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT037729 ENO1 enolase 1, (alpha) 1 1
MIRT037730 AP3D1 adaptor-related protein complex 3, delta 1 subunit 1 1
MIRT037731 TUBA1A tubulin, alpha 1a 1 1
MIRT037732 ULK3 unc-51-like kinase 3 (C. elegans) 1 1
MIRT037733 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase, type I, alpha 1 1
MIRT037734 SLC25A46 solute carrier family 25, member 46 1 1
MIRT037735 MED15 mediator complex subunit 15 1 1
MIRT037736 IRF2BP1 interferon regulatory factor 2 binding protein 1 1 1
MIRT037737 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT037738 ATHL1 ATH1, acid trehalase-like 1 (yeast) 1 1
MIRT037739 CTNNA1 catenin (cadherin-associated protein), alpha 1, 102kDa 1 1
MIRT037740 ADRM1 adhesion regulating molecule 1 1 1
MIRT037741 CCDC106 coiled-coil domain containing 106 1 1