Accession ID: MIRT037926 [miRNA, hsa-miR-532-3p :: CTNNB1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-532LinkOut: [miRBase ]
Synonyms MIRN532, hsa-mir-532, MIR532
Description Homo sapiens miR-532 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-532-3p
Mature Sequence 57| CCUCCCACACCCAAGGCUUGCA |78
Evidence Experimental
Experiments Cloned
Putative hsa-miR-532-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CTNNB1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CTNNB, DKFZp686D02253, FLJ25606, FLJ37923
Description catenin (cadherin-associated protein), beta 1, 88kDa
Transcript NM_0019    LinkOut: [ RefSeq ]
Other Transcripts NM_0010982 , NM_0010982   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTNNB1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTNNB1
(miRNA target sites are highlighted)
>CTNNB1|NM_0019|3'UTR
   1 TAAATCATCCTTTAGGTAAGAAGTTTTAAAAAGCCAGTTTGGGTAAAATACTTTTACTCTGCCTACAGAACTTCAGAAAG
  81 ACTTGGTTGGTAGGGTGGGAGTGGTTTAGGCTATTTGTAAATCTGCCACAAAAACAGGTATATACTTTGAAAGGAGATGT
 161 CTTGGAACATTGGAATGTTCTCAGATTTCTGGTTGTTATGTGATCATGTGTGGAAGTTATTAACTTTAATGTTTTTTGCC
 241 ACAGCTTTTGCAACTTAATACTCAAATGAGTAACATTTGCTGTTTTAAACATTAATAGCAGCCTTTCTCTCTTTATACAG
 321 CTGTATTGTCTGAACTTGCATTGTGATTGGCCTGTAGAGTTGCTGAGAGGGCTCGAGGGGTGGGCTGGTATCTCAGAAAG
 401 TGCCTGACACACTAACCAAGCTGAGTTTCCTATGGGAACAATTGAAGTAAACTTTTTGTTCTGGTCCTTTTTGGTCGAGG
 481 AGTAACAATACAAATGGATTTTGGGAGTGACTCAAGAAGTGAAGAATGCACAAGAATGGATCACAAGATGGAATTTATCA
 561 AACCCTAGCCTTGCTTGTTAAATTTTTTTTTTTTTTTTTTTAAGAATATCTGTAATGGTACTGACTTTGCTTGCTTTGAA
 641 GTAGCTCTTTTTTTTTTTTTTTTTTTTTTTTTGCAGTAACTGTTTTTTAAGTCTCTCGTAGTGTTAAGTTATAGTGAATA
 721 CTGCTACAGCAATTTCTAATTTTTAAGAATTGAGTAATGGTGTAGAACACTAATTCATAATCACTCTAATTAATTGTAAT
 801 CTGAATAAAGTGTAACAATTGTGTAGCCTTTTTGTATAAAATAGACAAATAGAAAATGGTCCAATTAGTTTCCTTTTTAA
 881 TATGCTTAAAATAAGCAGGTGGATCTATTTCATGTTTTTGATCAAAAACTATTTGGGATATGTATGGGTAGGGTAAATCA
 961 GTAAGAGGTGTTATTTGGAACCTTGTTTTGGACAGTTTACCAGTTGCCTTTTATCCCAAAGTTGTTGTAACCTGCTGTGA
1041 TACGATGCTTCAAGAGAAAATGCGGTTATAAAAAATGGTTCAGAATTAAACTTTTAATTCATTCGATTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' acgUUCGGAAC---CCA---CACCCUCc 5'
             ||| ||||   |||   ||||||| 
Target 5' agaAAGACTTGGTTGGTAGGGTGGGAGt 3'
75 - 102 163.00 -17.60
2
miRNA  3' acguucggaacccacACCCUCc 5'
                         |||||| 
Target 5' aatacaaatggatttTGGGAGt 3'
487 - 508 120.00 -10.30
3
miRNA  3' acgUUCGGAAC-CCACACCCucc 5'
             |:| || | || |||||   
Target 5' gagAGGGCTCGAGGGGTGGGctg 3'
365 - 387 119.00 -16.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-532-3p :: CTNNB1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
20 hsa-miR-532-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT037913 PPP3R2 protein phosphatase 3, regulatory subunit B, beta 1 1
MIRT037914 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT037915 MED18 mediator complex subunit 18 1 1
MIRT037916 METTL18 chromosome 1 open reading frame 156 1 1
MIRT037917 SBK1 SH3-binding domain kinase 1 1 1
MIRT037918 APP amyloid beta (A4) precursor protein 1 1
MIRT037919 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 1
MIRT037920 FAM189B family with sequence similarity 189, member B 1 1
MIRT037921 MED14 mediator complex subunit 14 1 1
MIRT037922 AP2B1 adaptor-related protein complex 2, beta 1 subunit 1 1
MIRT037923 SCMH1 sex comb on midleg homolog 1 (Drosophila) 1 1
MIRT037924 EIF3I eukaryotic translation initiation factor 3, subunit I 1 1
MIRT037925 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT037926 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT037927 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT037928 AFF4 AF4/FMR2 family, member 4 1 1
MIRT037929 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT037930 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT037931 COLGALT1 glycosyltransferase 25 domain containing 1 1 1
MIRT037932 C20orf24 chromosome 20 open reading frame 24 1 1