Accession ID: MIRT037926 [miRNA, hsa-miR-532-3p :: CTNNB1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-532LinkOut: [miRBase ]
Synonyms MIRN532, hsa-mir-532, MIR532
Description Homo sapiens miR-532 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-532-3p
Mature Sequence 57| CCUCCCACACCCAAGGCUUGCA |78
Evidence Experimental
Experiments Cloned
Putative hsa-miR-532-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CTNNB1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CTNNB
Description catenin (cadherin-associated protein), beta 1, 88kDa
Transcript NM_001904    LinkOut: [ RefSeq ]
Other Transcripts NM_001098210 , NM_001098209   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTNNB1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTNNB1
(miRNA target sites are highlighted)
>CTNNB1|NM_001904|3'UTR
   1 ATCATCCTTTAGGTAAGAAGTTTTAAAAAGCCAGTTTGGGTAAAATACTTTTACTCTGCCTACAGAACTTCAGAAAGACT
  81 TGGTTGGTAGGGTGGGAGTGGTTTAGGCTATTTGTAAATCTGCCACAAAAACAGGTATATACTTTGAAAGGAGATGTCTT
 161 GGAACATTGGAATGTTCTCAGATTTCTGGTTGTTATGTGATCATGTGTGGAAGTTATTAACTTTAATGTTTTTTGCCACA
 241 GCTTTTGCAACTTAATACTCAAATGAGTAACATTTGCTGTTTTAAACATTAATAGCAGCCTTTCTCTCTTTATACAGCTG
 321 TATTGTCTGAACTTGCATTGTGATTGGCCTGTAGAGTTGCTGAGAGGGCTCGAGGGGTGGGCTGGTATCTCAGAAAGTGC
 401 CTGACACACTAACCAAGCTGAGTTTCCTATGGGAACAATTGAAGTAAACTTTTTGTTCTGGTCCTTTTTGGTCGAGGAGT
 481 AACAATACAAATGGATTTTGGGAGTGACTCAAGAAGTGAAGAATGCACAAGAATGGATCACAAGATGGAATTTATCAAAC
 561 CCTAGCCTTGCTTGTTAAATTTTTTTTTTTTTTTTTTTAAGAATATCTGTAATGGTACTGACTTTGCTTGCTTTGAAGTA
 641 GCTCTTTTTTTTTTTTTTTTTTTTTTTTTGCAGTAACTGTTTTTTAAGTCTCTCGTAGTGTTAAGTTATAGTGAATACTG
 721 CTACAGCAATTTCTAATTTTTAAGAATTGAGTAATGGTGTAGAACACTAATTCATAATCACTCTAATTAATTGTAATCTG
 801 AATAAAGTGTAACAATTGTGTAGCCTTTTTGTATAAAATAGACAAATAGAAAATGGTCCAATTAGTTTCCTTTTTAATAT
 881 GCTTAAAATAAGCAGGTGGATCTATTTCATGTTTTTGATCAAAAACTATTTGGGATATGTATGGGTAGGGTAAATCAGTA
 961 AGAGGTGTTATTTGGAACCTTGTTTTGGACAGTTTACCAGTTGCCTTTTATCCCAAAGTTGTTGTAACCTGCTGTGATAC
1041 GATGCTTCAAGAGAAAATGCGGTTATAAAAAATGGTTCAGAATTAAACTTTTAATTCATTCGATTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' acgUUCGGAAC---CCA---CACCCUCc 5'
             ||| ||||   |||   ||||||| 
Target 5' agaAAGACTTGGTTGGTAGGGTGGGAGt 3'
72 - 99 163.00 -17.60
2
miRNA  3' acguucggaacccacACCCUCc 5'
                         |||||| 
Target 5' aatacaaatggatttTGGGAGt 3'
484 - 505 120.00 -10.30
3
miRNA  3' acgUUCGGAAC-CCACACCCucc 5'
             |:| || | || |||||   
Target 5' gagAGGGCTCGAGGGGTGGGctg 3'
362 - 384 119.00 -16.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-532-3p :: CTNNB1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
208 hsa-miR-532-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT037913 PPP3R2 protein phosphatase 3, regulatory subunit B, beta 1 1
MIRT037914 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT037915 MED18 mediator complex subunit 18 1 1
MIRT037916 METTL18 methyltransferase like 18 1 1
MIRT037917 SBK1 SH3-binding domain kinase 1 1 1
MIRT037918 APP amyloid beta (A4) precursor protein 1 1
MIRT037919 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 1
MIRT037920 FAM189B family with sequence similarity 189, member B 1 1
MIRT037921 MED14 mediator complex subunit 14 1 1
MIRT037922 AP2B1 adaptor-related protein complex 2, beta 1 subunit 1 1
MIRT037923 SCMH1 sex comb on midleg homolog 1 (Drosophila) 1 1
MIRT037924 EIF3I eukaryotic translation initiation factor 3, subunit I 1 1
MIRT037925 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT037926 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT037927 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT037928 AFF4 AF4/FMR2 family, member 4 1 1
MIRT037929 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT037930 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT037931 COLGALT1 glycosyltransferase 25 domain containing 1 1 1
MIRT037932 C20orf24 chromosome 20 open reading frame 24 1 1
MIRT154861 GNAS GNAS complex locus 1 1
MIRT222064 PURB purine-rich element binding protein B 1 2
MIRT232511 MBD6 methyl-CpG binding domain protein 6 1 1
MIRT394175 TIMM8A translocase of inner mitochondrial membrane 8 homolog A (yeast) 1 1
MIRT455736 CDCA8 cell division cycle associated 8 1 1
MIRT459722 ERCC1 excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence) 1 3
MIRT461323 MRPS27 mitochondrial ribosomal protein S27 1 1
MIRT467604 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 1
MIRT493801 GAN gigaxonin 1 3
MIRT495021 C2CD4B C2 calcium-dependent domain containing 4B 1 1
MIRT497482 XPR1 xenotropic and polytropic retrovirus receptor 1 1 1
MIRT504019 ACSL6 acyl-CoA synthetase long-chain family member 6 1 1
MIRT504764 TEP1 telomerase-associated protein 1 1 2
MIRT504834 EREG epiregulin 1 1
MIRT505555 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 1 1
MIRT506089 PPM1A protein phosphatase, Mg2+/Mn2+ dependent, 1A 1 1
MIRT512552 MFN2 mitofusin 2 1 3
MIRT513391 TUBB4A tubulin, beta 4A class IVa 1 1
MIRT517920 F2 coagulation factor II (thrombin) 1 3
MIRT521644 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT525287 C18orf32 chromosome 18 open reading frame 32 1 1
MIRT526170 ANKRD65 ankyrin repeat domain 65 1 1
MIRT526851 KIFC1 kinesin family member C1 1 1
MIRT527153 SCN9A sodium channel, voltage-gated, type IX, alpha subunit 1 2
MIRT527225 C3orf36 chromosome 3 open reading frame 36 1 2
MIRT528037 WT1 Wilms tumor 1 1 1
MIRT528700 TRAF3IP2 TRAF3 interacting protein 2 1 2
MIRT530114 SLC25A42 solute carrier family 25, member 42 1 1
MIRT530237 PLXDC1 plexin domain containing 1 1 1
MIRT530806 GPR182 G protein-coupled receptor 182 1 1
MIRT531986 SLCO1B3 solute carrier organic anion transporter family, member 1B3 1 1
MIRT532744 CMTM6 CKLF-like MARVEL transmembrane domain containing 6 1 1
MIRT533228 VPS4A vacuolar protein sorting 4 homolog A (S. cerevisiae) 1 1
MIRT533796 TMEM119 transmembrane protein 119 1 3
MIRT534318 SKIDA1 SKI/DACH domain containing 1 1 1
MIRT535304 PHF12 PHD finger protein 12 1 1
MIRT535522 PALM2 paralemmin 2 1 1
MIRT540122 HTR7 5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled 1 1
MIRT540130 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT540568 CEP89 centrosomal protein 89kDa 1 1
MIRT540668 MIS18A MIS18 kinetochore protein homolog A (S. pombe) 1 1
MIRT542583 ZC3H12C zinc finger CCCH-type containing 12C 1 2
MIRT544455 KRBOX4 zinc finger family member 673 1 1
MIRT547162 PDZD8 PDZ domain containing 8 1 1
MIRT548161 FRAT2 frequently rearranged in advanced T-cell lymphomas 2 1 1
MIRT551676 BBS5 Bardet-Biedl syndrome 5 1 1
MIRT551693 ASB16 ankyrin repeat and SOCS box containing 16 1 1
MIRT557563 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT572413 PXDN peroxidasin homolog (Drosophila) 1 1
MIRT572903 RUNDC3B RUN domain containing 3B 1 1
MIRT573348 TRPM3 transient receptor potential cation channel, subfamily M, member 3 1 1
MIRT607665 BTN3A2 butyrophilin, subfamily 3, member A2 1 1
MIRT608836 PTCHD1 patched domain containing 1 1 1
MIRT609739 VIPR1 vasoactive intestinal peptide receptor 1 1 1
MIRT610300 KLHL21 kelch-like 21 (Drosophila) 1 1
MIRT610346 AGTRAP angiotensin II receptor-associated protein 1 1
MIRT610554 NOTCH2NL notch 2 N-terminal like 1 2
MIRT613162 DDA1 DET1 and DDB1 associated 1 1 1
MIRT618288 ZNF682 zinc finger protein 682 1 1
MIRT619078 DNAAF3 dynein, axonemal, assembly factor 3 1 1
MIRT619758 MYO1F myosin IF 1 1
MIRT620182 TRIM72 tripartite motif containing 72 1 1
MIRT621529 ZNF507 zinc finger protein 507 1 1
MIRT621720 TRAPPC10 trafficking protein particle complex 10 1 1
MIRT622271 SH3TC2 SH3 domain and tetratricopeptide repeats 2 1 1
MIRT623399 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT625199 GSTCD glutathione S-transferase, C-terminal domain containing 1 1
MIRT625680 SYAP1 synapse associated protein 1 1 1
MIRT626153 NFYA nuclear transcription factor Y, alpha 1 1
MIRT626173 DNAJB13 DnaJ (Hsp40) homolog, subfamily B, member 13 1 1
MIRT626463 CMKLR1 chemokine-like receptor 1 1 1
MIRT626559 NAGS N-acetylglutamate synthase 1 1
MIRT629822 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT630642 ELK1 ELK1, member of ETS oncogene family 1 1
MIRT635443 SLC25A44 solute carrier family 25, member 44 1 1
MIRT635502 CCR4 chemokine (C-C motif) receptor 4 1 1
MIRT636491 GRIN2B glutamate receptor, ionotropic, N-methyl D-aspartate 2B 1 1
MIRT636868 ARSE arylsulfatase E (chondrodysplasia punctata 1) 1 1
MIRT637181 TMEM50A transmembrane protein 50A 1 1
MIRT637242 FAM26E family with sequence similarity 26, member E 1 1
MIRT638727 FOXK1 forkhead box K1 1 1
MIRT638923 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT639150 POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD) 1 1
MIRT641014 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT641818 ULK2 unc-51-like kinase 2 (C. elegans) 1 1
MIRT641968 PWWP2A PWWP domain containing 2A 1 1
MIRT642176 HEBP2 heme binding protein 2 1 1
MIRT642442 CLUAP1 clusterin associated protein 1 1 1
MIRT642513 ORC6 origin recognition complex, subunit 6 1 1
MIRT642703 FGFR1OP2 FGFR1 oncogene partner 2 1 1
MIRT643597 SPAG16 sperm associated antigen 16 1 1
MIRT643642 EZH2 enhancer of zeste homolog 2 (Drosophila) 1 1
MIRT644269 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT644771 TXNRD3NB thioredoxin reductase 3 neighbor 1 1
MIRT644883 C2orf48 chromosome 2 open reading frame 48 1 1
MIRT645668 ADK adenosine kinase 1 1
MIRT646084 MGST3 microsomal glutathione S-transferase 3 1 1
MIRT646834 TLDC1 KIAA1609 1 1
MIRT646851 SLC35E4 solute carrier family 35, member E4 1 1
MIRT648207 TRIM35 tripartite motif containing 35 1 1
MIRT648266 ZNF582 zinc finger protein 582 1 1
MIRT649191 DNPEP aspartyl aminopeptidase 1 1
MIRT649727 LTBP2 latent transforming growth factor beta binding protein 2 1 1
MIRT649820 PSMC1 proteasome (prosome, macropain) 26S subunit, ATPase, 1 1 1
MIRT650774 POP4 processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) 1 1
MIRT651342 ZC2HC1C zinc finger, C2HC-type containing 1C 1 1
MIRT651603 WDFY2 WD repeat and FYVE domain containing 2 1 1
MIRT652234 TRAPPC3L BET3 like (S. cerevisiae) 1 1
MIRT652358 TMEM92 transmembrane protein 92 1 1
MIRT652916 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT654055 S1PR1 sphingosine-1-phosphate receptor 1 1 1
MIRT654283 RCAN3 RCAN family member 3 1 1
MIRT654646 PTAFR platelet-activating factor receptor 1 1
MIRT654764 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 1
MIRT655744 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 1
MIRT657234 IER5 immediate early response 5 1 1
MIRT657465 C21orf33 chromosome 21 open reading frame 33 1 1
MIRT658244 FAXC failed axon connections homolog (Drosophila) 1 1
MIRT658360 FAM65B family with sequence similarity 65, member B 1 1
MIRT658457 FAM13B family with sequence similarity 13, member B 1 1
MIRT658511 ETV3 ets variant 3 1 1
MIRT658576 EPHB2 EPH receptor B2 1 1
MIRT658753 ELAVL3 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) 1 1
MIRT659643 CDK2 cyclin-dependent kinase 2 1 1
MIRT659698 CD200 CD200 molecule 1 1
MIRT660331 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 1
MIRT660804 AIFM2 apoptosis-inducing factor, mitochondrion-associated, 2 1 1
MIRT660969 ABI2 abl-interactor 2 1 1
MIRT662757 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662981 PAK3 p21 protein (Cdc42/Rac)-activated kinase 3 1 1
MIRT663209 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT664897 EMC7 ER membrane protein complex subunit 7 1 1
MIRT667670 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT667678 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT668832 CYCS cytochrome c, somatic 1 1
MIRT669072 CELSR3 cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) 1 1
MIRT669699 ABHD2 abhydrolase domain containing 2 1 1
MIRT673402 WNT7B wingless-type MMTV integration site family, member 7B 1 1
MIRT674108 ZNF829 zinc finger protein 829 1 1
MIRT676443 PLEKHM3 pleckstrin homology domain containing, family M, member 3 1 1
MIRT680195 KIAA1551 KIAA1551 1 1
MIRT683418 ZNF878 zinc finger protein 878 1 1
MIRT686354 USP15 ubiquitin specific peptidase 15 1 1
MIRT690687 PTCHD3 patched domain containing 3 1 1
MIRT698497 THOC2 THO complex 2 1 1
MIRT698668 TEF thyrotrophic embryonic factor 1 1
MIRT703045 HAS2 hyaluronan synthase 2 1 1
MIRT708736 FAM71F2 family with sequence similarity 71, member F2 1 1
MIRT709957 TRUB2 TruB pseudouridine (psi) synthase homolog 2 (E. coli) 1 1
MIRT710030 POLL polymerase (DNA directed), lambda 1 1
MIRT711653 RAB21 RAB21, member RAS oncogene family 1 1
MIRT711848 AMOTL2 angiomotin like 2 1 1
MIRT712174 STK4 serine/threonine kinase 4 1 1
MIRT713934 PIGR polymeric immunoglobulin receptor 1 1
MIRT714918 PPP1R12C protein phosphatase 1, regulatory subunit 12C 1 1
MIRT714992 TSPAN11 tetraspanin 11 1 1
MIRT715729 PIAS2 protein inhibitor of activated STAT, 2 1 1
MIRT717075 ESM1 endothelial cell-specific molecule 1 1 1
MIRT717143 DLEU1 deleted in lymphocytic leukemia 1 (non-protein coding) 1 1
MIRT717375 RBM41 RNA binding motif protein 41 1 1
MIRT717413 ZCCHC24 zinc finger, CCHC domain containing 24 1 1
MIRT717526 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT717915 LRRC15 leucine rich repeat containing 15 1 1
MIRT717970 PXMP4 peroxisomal membrane protein 4, 24kDa 1 1
MIRT717979 MAFK v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) 1 1
MIRT718079 CLIC5 chloride intracellular channel 5 1 1
MIRT718720 ANKRD18A ankyrin repeat domain 18A 1 1
MIRT718743 ATP9A ATPase, class II, type 9A 1 1
MIRT719097 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 1 1
MIRT719143 DPYSL5 dihydropyrimidinase-like 5 1 1
MIRT719222 CAMK4 calcium/calmodulin-dependent protein kinase IV 1 1
MIRT719526 SRCIN1 SRC kinase signaling inhibitor 1 1 1
MIRT719858 KLF2 Kruppel-like factor 2 (lung) 1 1
MIRT719922 PRKAB1 protein kinase, AMP-activated, beta 1 non-catalytic subunit 1 1
MIRT720325 CAMK2G calcium/calmodulin-dependent protein kinase II gamma 1 1
MIRT720720 RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6 1 1
MIRT721002 PNMA3 paraneoplastic Ma antigen 3 1 1
MIRT721454 AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) 1 1
MIRT721594 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT721637 MYLK3 myosin light chain kinase 3 1 1
MIRT722308 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT722483 QSOX1 quiescin Q6 sulfhydryl oxidase 1 1 1
MIRT722603 CCDC152 coiled-coil domain containing 152 1 1
MIRT722612 TEAD1 TEA domain family member 1 (SV40 transcriptional enhancer factor) 1 1
MIRT723663 RPTN repetin 1 1
MIRT723937 SVOP SV2 related protein homolog (rat) 1 1
MIRT724382 NEK8 NIMA (never in mitosis gene a)- related kinase 8 1 1
MIRT724527 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*