Accession ID: MIRT038100 [miRNA, hsa-miR-423-5p :: PDPK1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-423LinkOut: [miRBase ]
Synonyms MIRN423, hsa-mir-423, MIR423
Description Homo sapiens miR-423 stem-loop
Comment miR-423 (renamed miR-423-3p here) is expressed in human promyelocytic leukemia (HL-60) cells .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-423-5p
Mature Sequence 17| UGAGGGGCAGAGAGCGAGACUUU |39
Evidence Experimental
Experiments Cloned
Putative hsa-miR-423-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol PDPK1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms MGC20087, MGC35290, PDK1, PRO0461
Description 3-phosphoinositide dependent protein kinase-1
Transcript NM_0026    LinkOut: [ RefSeq ]
Other Transcripts NM_0312   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on PDPK1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of PDPK1
(miRNA target sites are highlighted)
>PDPK1|NM_0026|3'UTR
   1 TGACGTGGCCTGCGGCCGGGCTGCCCTTCGCTGCCAGGACACCTGCCCCAGCGCGGCTTGGCCGCCATCCGGGACGCTTC
  81 CAGACCACCTGCCAGCCATCACAAGGGGAACGCAGAGGCGGAAACCTTGCAGCATTTTTATTTAAAAGAAAAGAAGAAAA
 161 AAAACACCCAACCACACAAAGAACAAAACCAGTAACAAACACAAAGGAATTCAGGGTCGCTTTGCTTGCTCTCTGTGCTC
 241 CGTGGAGGCCTCCGTGTGCCCTCGTTGCCGTGGGGACCCAGCTCCATGCACGTCAACCCAGTCCCGCCCAGACTAGTGGA
 321 CAGACCTGGTGTCACCAGTTTTTCCTAGCATCAGTCCGAACCATGCGCCCGCCCTGCCCCAACTGTGTGCTGGTCCTGCT
 401 GTGGCCGAGGGGACCGGGTGTGTTTGGCTCTTTATGCCCCTCCCGCTGTGGTCCTGGAACTCTTCACCAGGGAGGGAGCC
 481 CTGCGGGGGCCGCAGCTTTGTGGAGGGAGCCGCCGTGCTTCTGTCACCTGCTCCCTTTCTTGCGTCTCCCTGTGATGGGC
 561 CCTTAGGCCTGGCTGGGCCCATTACATATCCCTGTGGTGGCTCTGGTGGCAGCTTTCTGTGGCCCCTGCTGTGTTGGCAG
 641 GCAGGTTTGCGTGGTGAGGAGCGGGAGGGGTTGGAGTGGTGCGGGAGCAGGCTGCCGAGTGGAGGGTGCCATCGAGGGCT
 721 CCGGATCCCTTATCCTACTTAGCAGTGTTGGTCTCTGGGGCTGGAAGCCGAGCGCATGCTGGGAGCGGTACTGTCAGAAG
 801 TGAGCCCAGTTAGTACCCCGCTGGCTCACTGCACGAGAGAGTCCTGCCCCGAGCCCTAGGTGGGGCCAGGAGGTGCCTTG
 881 GAGAAGCCAGCCAGAGCAGAGAGGGCTGCTGACTTCCGTGTGGAGCAGAGAGGCCTGAGGGCCTCCTAAAAGGTTTAAAT
 961 GTCCACGCCTCTCCAGTTGCTGAAGTAGGGTCTGAGAGAACCCTGGCATCAGCAGACCCAGGGTGCTTCTGTCTCCTGCA
1041 GACCACGCCAGGGAGTGCAGACACCACCGTCACACACGCCCCTTTTGTGTTTTGGTTCAAGTTTCTCAGAGCCCCTCAGA
1121 GCTTCTACATCTGTGCATCAGAAATCTCACAGCCTTCTCATGCTGCCGGCTCATCTGGGCCCATAGAGTGGGCTTTGCCA
1201 GTTGCTGTTGCACAGGAGGCGAGAACAGCACACTTCAACCCCAGCTTGCTGGTCGGCTTTCCTCTAGAGAGAGCCGGTTT
1281 TGGGGCCATTTCCCTTTGATGCTTTGGTGGCCTTGCCCCGCTCTGCAGCACAGACAGGCCAGATGCATTTGTCCTTTGCC
1361 TAGCTACTCCCCAGGTAGAGAGTGCTCCTGGTGGCCTGGCAGGTCTGGGCCCTTCTCTCCCTGCCCAGGTTGTCCCTGGA
1441 GGGCAGCCCTCACTCCCTTTGGGGGAGAGGCAGACATTGCTGCCCACAGACCTGCCTCTGACTCAACTGTGTCCACCCTC
1521 CCTGGTCCCTACCCCCAAGTCACAGGTGACTCAGCAGTGACCCTGTGTGCCAGGCCAGATCCAAACTGAGAGGGAAGGTG
1601 TCGTTTTTACACTGCTAATGACGAGAGTGGCTCTTTTTAGCTAGGCGAGTACAGACGGGGCCTGGGAGGGGGCAGAGATG
1681 TTCCCCAGGCCCTGCCTGTGGTTCCTGCCTGGGCCTTGGCTGCTGCTGTGTGAGAGCTGCATGTGAGCCTGTGACCGTGA
1761 GCTGGGGTGAGCTGGGCCGCACCTACCCTGGGGCCCCAGGGAGCAGGACGCTCCGGGGCCCAGCACGTTGCCCTGGGCCT
1841 GTGGCCGGAGTCGGAGTCCTCTCTCCTCCTCCTGGCTTTTGGAAAGGCTTGGCTGTGTTGGGGAGTCTCTCTTAGCCCTT
1921 TCAGGAATTTCTGTTCAGGCTTCCTCCTCCTCATCAGCTATTTTACCCATCTCAGAACGTCCTGTGTCTCCATGTAGGAG
2001 AGTGGCTCTCTCAGATCTCTCAGGGCGTCTGGTTATAGGGAAACAAGTGGAGCAGGGACGTGGCTTTAATTGGAGCACTC
2081 GGCTGGGCTGCTTGGGGAGACTCTTCCGTGCGTTCTTCCTCTGGATAGAACCACCACCTCCTGGGCGTCACTGACAAGCT
2161 CCATCTTAACCTCCAAAGCCACAGAACTAGGGGCTCAGAGCCAGAGCTGGCAGCCGCCAGCCAAAATGATGCCATTGCCT
2241 GAGCTGACAGCCAAGCCCTTCTGTGGGTCACCTTTCTCCTCACCCAGCCCCTTGCTCTTCCCTTTTGAAAGGCCCGTGTG
2321 TTTTCTTTCCTTACCCTGTGCTTGCTCATGTCTACTCCGGTTTTCTCTACCACATCCTTAGAGCCATCACCTGGCACGCA
2401 GGCGCCTTACATTCTACGGTAGAACGTGGGGTACTGTGTGTGCACATAGACACACTTACGTGGAATTACAGTTGTGGGTT
2481 TATCCAAGATGAGGAAGATTTCACCTGCTGTTTAATAGACTTGGGGCCATGTGCCTCCCCACACATGGGCAAGGACAGGT
2561 GGAATGTCGGGACCACACTGTGCGGCTTCTCGGCACAAAGCGGAGGGAGGCTGTGGTCGCTGCCGGCCTAGGTGTCCCAG
2641 GTGCCCCGCCTTTCTCTGGGACACAGTTGGGGGCTGGCTTCTGAGGGATTCCTTTCTCCCCTCTTTGTGTGGCCCCAGCC
2721 AGGGCGGTGGGCAGTCCTGGTGTAGAGCACAAGCCTCTCCACCCTAGAGAAATGCCTCTGTACCACGGCTACCATGTGGA
2801 ACCTTAACTTGCAGAAGGCTTGTTAACAATTGTTTTGAGAGAGATGGCTGGTCATGCCACAGCTGCTGGGGACTCCGCCT
2881 ACTCCAGCCCTCTTGGGACACACTGTGGGATTTGTGGCCCTTCCCCAGAGGAATTGTGGAGACTGTCCCATGGAACAAAC
2961 CCTCAGGCACCAGCACAGGGCTCTGGGTGACTCAGTAAAACTAACGTTTGTCTCTGACAAGATCAGCTGTAGGCTCACCG
3041 GCCAGAGAAGACCACTGTGAGCATTTTGCCGTATATCCTGCCCTGCCATTTGTTCACTTTTTAAACTAAAATAGGAACAT
3121 CCGACACACACCGTTTGCATCGTCTTCTCCCTTGATATTTTAAGCATTTTCCCATGTCATGAGTTTCTCAGAAACATGTT
3201 TTTAACAATTGTACTATTTAGTCATTGTCCATTTACTATAATTTATCTGACCATTTCCCTACTGTAAAATACTTAAGACG
3281 GTTTCTGATTTTTCCACTATTTAAATAATGCTGTGATGAATATCTTTAAAATCTTCTGATTTCTTACTTTTTTCCCCCTT
3361 AGATGCCTGGAAGTGGTATTTTGAGGTGAAAGAGTTTGTTCATTTTGAAGATATTTCTGTCTCTCTCTCGACCTGATGTG
3441 TAGACGCTCACTTCCAGTAGCAGAACCACCTTAGTTGTGTCTTACAGATTCTGAACAAATCGGTTTCTGATAAGCCATGT
3521 GTTCCAAAGAATGTCTGAATAAGACCGCTCTTTATTTAAATGCTAAGAGGATGTCACTACTGCAATCCATCTGTGGCCGA
3601 TTTTTTCCAAGAGCCAATTTCCTTGTTTTGGTTGCAAGAACCTGGCTCTGCCTGCATGTCAGCTCTCTGCCCTCCCTGCT
3681 GCCGTGGCTTTCAAGCGCTTGGCAGAATCTTGTACTTCGTGTCCACAATGGTACTGAATTTGCATCTGCACAGTCAGCAG
3761 AGATAACAAGTGTTGAACTGACCTTGCCACATGCTTAGTGAGTGATTTGTAATTAAGTTTATAGACTCAGAAGGTATATT
3841 AGGACATTTGGAATCAGTAGCAGAGCAAAGCCTCTTTGAAAAAAACCACGTAGCTGATTGGGTTTTACAAGAGTGCATTT
3921 GTCTCCCCCTTCCACCCGTGGGGCCCCACCTTCAGGTCTTAGTGGTTCACAAGAGCCCAGCAGCCAGGCTGGCTTTTTCA
4001 TTGTAGGGCGTGGTTGTCCCAGCTGGTGTAGATTTCAGGCCGCCCCCCCCAACTCCCTGCCCACAGTGTTGCAGATTGCC
4081 TGGCTGGCAGCAAGTCCAGACCACCCAAATTTGGTTGGATTCTTCATTTCTCCACTGTAGTTGGGGTCCATTGATTGTGC
4161 AGGGGAACGTGCAGGAGGTTTTTCTAGGCACCGTGTTCAGTGCTGCTTCACTCTACCAGAGATTATGGCCAAATTGCACG
4241 GAATTTGGTTTCTTGCCCTCTGAAGCCTGAGGGCCCCCCCTTGCCTGGCTGGTTGACAGACCCGGGGTGGTCACTGCTGA
4321 GACTTCAGAGATCGCAGCTGCTGTGAGAATACGGTGAAGGTACTTTGTTCTGGAAGATGTTGTCATACACTTTTCCCCAG
4401 TTATTTTCAAACTTGACATGAGCCTATGTTGACTCACTGGGTGGGGGTCCCTTCTTACGCAGCACACGTGGCAAGTGCCT
4481 GAATCGGGGCTGGAGGCACTTCAGAGCCTCTGAGGGGCCACCACTTCTGGCCCAAAATTGCAGGGTTGTAGATGAGGCTG
4561 CCTGTGGAGAACTGGTGTGAGGAGGAAGCTGTTTCCAACAAAGAGCACTTTCATCTGTTGAGATGGCTGTGGTGAGCAAC
4641 TGAACGAGCCTACGTGTGTACCTGAATTTTCCCCGTAACTCATTTCTTCCATATGAAGAAACACCAAACTATGTACAGAG
4721 AACTTTTTACAAAAGGCAGACCTTTTTTAAGCTGTGTAACCCACATAGCCTAACCACCTGGCAGAATGACTACGAATAGG
4801 GGTCATTGTGCTGGTAAAAGCCTCTATTACGACTGTAAGTAAGTTGGATGTTGGCAAAATTAAATTGTTACAGTATTTAG
4881 AGCTGCTGTAGCTGTTCCTTCACAACATAAAATAGGATAAATGACTAGTACGTCTTTCAGGTGGGTGGCAAGCAGAACAT
4961 GCGTAATATTCTCTACCTGGTCTGTAGCTGTAACTGTGATGTACAGACAAAGCAAAAATTAAAAGAACTTATGAAAACAA
5041 ATGCAATGATACTAGGATATACACTTTTGTATTTTTATTCTTATATAAGGTTATTTGCTGGCTATTGTTGGCCTCTAGTT
5121 CAGTCTGTGTTATTTAAATTCTAATATATGAATTATTTGAATTGAATTCATGTTCGGGGCCACGTTGTTGTATGTATTGA
5201 TGTACAGCCTTGAATGTGAATAATTATTGTAAACTATATTTTACAACTTTTTTTCTGGCTTTATTATATAAATTTTCTAT
5281 TGGGTCAGTGATTTAATCATATAATTTAATGAATCTGTTTATCCTTTTTTTTTTTCCAAATACTTGTGCTTTAGGTGTAG
5361 TTACCAGATGATGAATTTTCCTCGTATGGTCAGTAGTCTTGTAATAAAAAGCATGTAGAGTGTAAAAAAAAAAAAAAAAA
5441 AA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuuCAGAGCGAGAG--ACGGGGAGu 5'
             ||:| |||||:  |||||||| 
Target 5' tgtGTTTGGCTCTTTATGCCCCTCc 3'
419 - 443 174.00 -25.60
2
miRNA  3' uuUCAGAGCGAGAGACGGGGAGu 5'
            |||:|  |||   ||||||| 
Target 5' caAGTTT--CTCAGAGCCCCTCa 3'
1098 - 1118 157.00 -20.50
3
miRNA  3' uuUCAGAG-CGAGAGA---CGGGGAgu 5'
            :||  | |||:|||   ||||||  
Target 5' ctGGTGGCAGCTTTCTGTGGCCCCTgc 3'
603 - 629 141.00 -20.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-423-5p :: PDPK1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
168 hsa-miR-423-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038011 RABAC1 Rab acceptor 1 (prenylated) 1 1
MIRT038012 NMD3 NMD3 homolog (S. cerevisiae) 1 1
MIRT038013 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT038014 RGPD2 RANBP2-like and GRIP domain containing 2 1 1
MIRT038015 TSPYL6 TSPY-like 6 1 1
MIRT038016 HIST2H2BE histone cluster 2, H2be 1 1
MIRT038017 USP6 ubiquitin specific peptidase 6 (Tre-2 oncogene) 1 1
MIRT038018 PGAM4 phosphoglycerate mutase family member 4 1 1
MIRT038019 DIP2A DIP2 disco-interacting protein 2 homolog A (Drosophila) 1 1
MIRT038020 NOS1AP nitric oxide synthase 1 (neuronal) adaptor protein 1 1
MIRT038021 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 1
MIRT038022 RC3H1 ring finger and CCCH-type zinc finger domains 1 1 1
MIRT038023 KIF1A kinesin family member 1A 1 1
MIRT038024 SRSF11 splicing factor, arginine/serine-rich 11 1 1
MIRT038025 BCLAF1 BCL2-associated transcription factor 1 1 1
MIRT038026 RPS15A ribosomal protein S15a 1 1
MIRT038027 CCNI cyclin I 1 1
MIRT038028 GDF11 growth differentiation factor 11 1 1
MIRT038029 FAM127A family with sequence similarity 127, member A 1 1
MIRT038030 NME2 non-metastatic cells 2, protein (NM23B) expressed in 1 1
MIRT038031 COX1 cytochrome c oxidase subunit I 1 1
MIRT038032 ARPC1A actin related protein 2/3 complex, subunit 1A, 41kDa 1 1
MIRT038033 MYBL2 v-myb myeloblastosis viral oncogene homolog (avian)-like 2 1 1
MIRT038034 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT038035 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT038036 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 1 1
MIRT038037 TDRKH tudor and KH domain containing 1 1
MIRT038038 AKAP13 A kinase (PRKA) anchor protein 13 1 1
MIRT038039 RPS10 ribosomal protein S10 1 1
MIRT038040 PRPF38B PRP38 pre-mRNA processing factor 38 (yeast) domain containing B 1 1
MIRT038041 PPIAL4G peptidylprolyl isomerase A (cyclophilin A)-like 4G 1 1
MIRT038042 MRPL34 mitochondrial ribosomal protein L34 1 1
MIRT038043 NDRG1 N-myc downstream regulated 1 1 1
MIRT038044 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT038045 ATP6 ATP synthase F0 subunit 6 1 1
MIRT038046 ZFP36L1 zinc finger protein 36, C3H type-like 1 1 1
MIRT038047 COQ6 coenzyme Q6 homolog, monooxygenase (S. cerevisiae) 1 1
MIRT038048 EPM2AIP1 EPM2A (laforin) interacting protein 1 1 1
MIRT038049 REPS1 RALBP1 associated Eps domain containing 1 1 1
MIRT038050 AAR2 chromosome 20 open reading frame 4 1 1
MIRT038051 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT038052 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT038053 DDX21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 1 1
MIRT038054 SLC6A6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 1 1
MIRT038055 RPS2 ribosomal protein S2 1 1
MIRT038056 CSTB cystatin B (stefin B) 1 1
MIRT038057 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 1
MIRT038058 PAK1 p21 protein (Cdc42/Rac)-activated kinase 1 1 1
MIRT038059 ERRFI1 ERBB receptor feedback inhibitor 1 1 1
MIRT038060 CEACAM6 carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) 1 1
MIRT038061 FHOD1 formin homology 2 domain containing 1 1 1
MIRT038062 LMNB2 lamin B2 1 1
MIRT038063 NECAP1 NECAP endocytosis associated 1 1 1
MIRT038064 NPLOC4 nuclear protein localization 4 homolog (S. cerevisiae) 1 1
MIRT038065 PMPCA peptidase (mitochondrial processing) alpha 1 1
MIRT038066 C12orf10 chromosome 12 open reading frame 10 1 1
MIRT038067 DDX54 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 1 1
MIRT038068 VAC14 Vac14 homolog (S. cerevisiae) 1 1
MIRT038069 RUNX1 runt-related transcription factor 1 1 1
MIRT038070 FAM98A family with sequence similarity 98, member A 1 1
MIRT038071 EPN1 epsin 1 1 1
MIRT038072 TMUB1 transmembrane and ubiquitin-like domain containing 1 1 1
MIRT038073 UBE2L3 ubiquitin-conjugating enzyme E2L 3 1 1
MIRT038074 FAM110B family with sequence similarity 110, member B 1 1
MIRT038075 MICALL1 MICAL-like 1 1 1
MIRT038076 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT038077 DLX5 distal-less homeobox 5 1 1
MIRT038078 ZNF655 zinc finger protein 655 1 1
MIRT038079 FAAH fatty acid amide hydrolase 1 1
MIRT038080 ATN1 atrophin 1 1 1
MIRT038081 ATP6V1E1 ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 1 1
MIRT038082 SLC9A3R1 solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 1 1
MIRT038083 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT038084 PLCB1 phospholipase C, beta 1 (phosphoinositide-specific) 1 1
MIRT038085 SQSTM1 sequestosome 1 1 1
MIRT038086 CLSTN1 calsyntenin 1 1 1
MIRT038087 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT038088 ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 1 1
MIRT038089 EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) 1 1
MIRT038090 HIST1H1C histone cluster 1, H1c 1 1
MIRT038091 AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) 1 1
MIRT038092 TPGS2 chromosome 18 open reading frame 10 1 1
MIRT038093 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT038094 GNG12 guanine nucleotide binding protein (G protein), gamma 12 1 1
MIRT038095 RPS9 ribosomal protein S9 1 1
MIRT038096 RPL18A ribosomal protein L18a 1 1
MIRT038097 CCND2 cyclin D2 1 1
MIRT038098 PCBP1 poly(rC) binding protein 1 1 1
MIRT038099 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT038100 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT038101 WBP2 WW domain binding protein 2 1 1
MIRT038102 CLSPN claspin homolog (Xenopus laevis) 1 1
MIRT038103 PTTG1 pituitary tumor-transforming 1 1 1
MIRT038104 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT038105 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT038106 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 1 1
MIRT038107 KCTD2 potassium channel tetramerisation domain containing 2 1 1
MIRT038108 RNF139 ring finger protein 139 1 1
MIRT038109 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT038110 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT038111 SAR1B SAR1 homolog B (S. cerevisiae) 1 1
MIRT038112 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT038113 UBE2D3 ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) 1 1
MIRT038114 GTPBP1 GTP binding protein 1 1 1
MIRT038115 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT038116 NUTM1 chromosome 15 open reading frame 55 1 1
MIRT038117 COPS7A COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) 1 1
MIRT038118 POLR3H polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) 1 1
MIRT038119 HIST1H1E histone cluster 1, H1e 1 1
MIRT038120 NFKB2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) 1 1
MIRT038121 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 1
MIRT038122 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT038123 PTMA prothymosin, alpha 1 1
MIRT038124 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT038125 CD81 CD81 molecule 1 1
MIRT038126 CCNF cyclin F 1 1
MIRT038127 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT038128 RCE1 RCE1 homolog, prenyl protein peptidase (S. cerevisiae) 1 1
MIRT038129 FAM83H family with sequence similarity 83, member H 1 1
MIRT038130 HES4 hairy and enhancer of split 4 (Drosophila) 1 1
MIRT038131 FAM189B family with sequence similarity 189, member B 1 1
MIRT038132 SLC48A1 solute carrier family 48 (heme transporter), member 1 1 1
MIRT038133 SNX8 sorting nexin 8 1 1
MIRT038134 ZYX zyxin 1 1
MIRT038135 DRAP1 DR1-associated protein 1 (negative cofactor 2 alpha) 1 1
MIRT038136 TEX2 testis expressed 2 1 1
MIRT038137 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT038138 LRCH4 leucine-rich repeats and calponin homology (CH) domain containing 4 1 1
MIRT038139 CHD8 chromodomain helicase DNA binding protein 8 1 1
MIRT038140 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 1 1
MIRT038141 TRIM28 tripartite motif-containing 28 1 1
MIRT038142 SEPN1 selenoprotein N, 1 1 1
MIRT038143 MIER2 mesoderm induction early response 1, family member 2 1 1
MIRT038144 HOXA7 homeobox A7 1 1
MIRT038145 PRRC2A HLA-B associated transcript 2 1 1
MIRT038146 SRP54 signal recognition particle 54kDa 1 1
MIRT038147 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT038148 SRM spermidine synthase 1 1
MIRT038149 GTF2F1 general transcription factor IIF, polypeptide 1, 74kDa 1 1
MIRT038150 HIPK2 homeodomain interacting protein kinase 2 1 1
MIRT038151 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like 1 1
MIRT038152 COPZ1 coatomer protein complex, subunit zeta 1 1 1
MIRT038153 GLUL glutamate-ammonia ligase 1 1
MIRT038154 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT038155 PKM pyruvate kinase, muscle 1 1
MIRT038156 MTCH2 mitochondrial carrier homolog 2 (C. elegans) 1 1
MIRT038157 ACTG1 actin, gamma 1 1 1
MIRT038158 MTMR3 myotubularin related protein 3 1 1
MIRT038159 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT038160 DDX24 DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 1 1
MIRT038161 TUBB tubulin, beta 1 1
MIRT038162 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT038163 PAX2 paired box 2 1 1
MIRT038164 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT038165 CEBPB CCAAT/enhancer binding protein (C/EBP), beta 1 1
MIRT038166 YARS tyrosyl-tRNA synthetase 1 1
MIRT038167 STRIP2 family with sequence similarity 40, member B 1 1
MIRT038168 KCTD15 potassium channel tetramerisation domain containing 15 1 1
MIRT038169 RPL23A ribosomal protein L23a 1 1
MIRT038170 MFGE8 milk fat globule-EGF factor 8 protein 1 1
MIRT038171 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT038172 RPL10 ribosomal protein L10 1 1
MIRT038173 SALL1 sal-like 1 (Drosophila) 1 1
MIRT038174 BCCIP BRCA2 and CDKN1A interacting protein 1 1
MIRT038175 PSMD6 proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 1 1
MIRT038176 MED28 mediator complex subunit 28 1 1
MIRT038177 MESDC1 mesoderm development candidate 1 1 1
MIRT038178 DAG1 dystroglycan 1 (dystrophin-associated glycoprotein 1) 1 1