Accession ID: MIRT038295 [miRNA, hsa-miR-130b-5p :: BRAT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-130bLinkOut: [miRBase ]
Synonyms MIRN130B, mir-130b, MIR130B
Description Homo sapiens miR-130b stem-loop
Comment This sequence is the predicted human homologue of mouse miR-130b cloned from mouse embryonic stem cells .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-130b-5p
Mature Sequence 13| ACUCUUUCCCUGUUGCACUAC |33
Evidence Experimental
Experiments Cloned
Putative hsa-miR-130b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol BRAT1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BAAT1, C7orf27, RMFSL
Description BRCA1-associated ATM activator 1
Transcript NM_152743    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on BRAT1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of BRAT1
(miRNA target sites are highlighted)
>BRAT1|NM_152743|3'UTR
   1 GCAGAACCAGAGTCTGCCACTGGGGCTCAGGACCAAGGGAGGCAGCACCATGTCCTTCTGTGGGACACTGCCAGCCCCAG
  81 GGCTCCAGCCCAGCCCGGTGGATCCTCTGGGGAAGCCAGGACCAGGAGAGAAGCAAGGTCAAGAAATCCCACAGTTTGAT
 161 GTATTAAAGAAATGACTTATTTCTACTCAAAATAAATGGCATTGAAGTCTTTCTTTAACCCTTTTTGAGTTAATTTAATA
 241 ATAATGATCTGAGACAAGG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' caucaCGUUGUCCCUUUCUca 5'
               | | || |||:|||  
Target 5' agccaGGACCA-GGAGAGAag 3'
114 - 133 115.00 -9.40
2
miRNA  3' caucacguUGUCCCUU--UCUCa 5'
                  :||  |||  |||| 
Target 5' --------GCA--GAACCAGAGt 3'
1 - 13 101.00 -6.60
3
miRNA  3' caUCACGUUGUCCCUUUCUCa 5'
            ||  | | |||||:: || 
Target 5' tcAGGACCA-AGGGAGGCAGc 3'
27 - 46 94.00 -10.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-130b-5p :: BRAT1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' catcACGTTGTCCCTTTCTCa 5'
              | ||:||  |:::||| 
Target 5' --tcTTCAGCA--GGGGGAGt 3'
1 - 17
2
miRNA  3' caTCACGTTGTCCCTTTCtca 5'
            || ||  :  ||::||   
Target 5' ccAGGGCTCTTTGGGGAGcca 3'
23 - 43
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
336 hsa-miR-130b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038280 ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 1 1
MIRT038281 MACC1 metastasis associated in colon cancer 1 1 1
MIRT038282 ADPRHL2 ADP-ribosylhydrolase like 2 1 1
MIRT038283 MYBPC1 myosin binding protein C, slow type 1 1
MIRT038284 NCOR2 nuclear receptor corepressor 2 1 1
MIRT038285 DPYSL5 dihydropyrimidinase-like 5 1 1
MIRT038286 EMC1 ER membrane protein complex subunit 1 1 1
MIRT038287 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 1
MIRT038288 CDC5L CDC5 cell division cycle 5-like (S. pombe) 1 1
MIRT038289 OGDHL oxoglutarate dehydrogenase-like 1 1
MIRT038290 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT038291 POLD3 polymerase (DNA-directed), delta 3, accessory subunit 1 1
MIRT038292 PDS5A PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) 1 1
MIRT038293 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT038294 COPB1 coatomer protein complex, subunit beta 1 1 1
MIRT038295 BRAT1 BRCA1-associated ATM activator 1 1 1
MIRT038296 NOTCH2 notch 2 1 2
MIRT038297 RPL8 ribosomal protein L8 1 1
MIRT038298 HBS1L HBS1-like (S. cerevisiae) 1 1
MIRT038299 MFSD6 major facilitator superfamily domain containing 6 1 1
MIRT038300 SSH2 slingshot homolog 2 (Drosophila) 1 1
MIRT038301 PTPN11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT038302 PAGR1 PAXIP1 associated glutamate-rich protein 1 1 2
MIRT038303 ALDH1B1 aldehyde dehydrogenase 1 family, member B1 1 1
MIRT038304 TTC3 tetratricopeptide repeat domain 3 1 1
MIRT038305 EP300 E1A binding protein p300 1 1
MIRT038306 PCDHGB4 protocadherin gamma subfamily B, 4 1 1
MIRT038307 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 1
MIRT038308 HELZ helicase with zinc finger 1 1
MIRT038309 JMY junction mediating and regulatory protein, p53 cofactor 1 1
MIRT038310 MEIS3 Meis homeobox 3 1 1
MIRT038311 SMG5 smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT038312 FAM72A family with sequence similarity 72, member A 1 1
MIRT038313 CGNL1 cingulin-like 1 1 1
MIRT038314 HNRNPR heterogeneous nuclear ribonucleoprotein R 1 1
MIRT038315 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT038316 HSPA8 heat shock 70kDa protein 8 1 1
MIRT038317 CHD1 chromodomain helicase DNA binding protein 1 1 1
MIRT038318 FASN fatty acid synthase 1 1
MIRT038319 PDHA1 pyruvate dehydrogenase (lipoamide) alpha 1 1 1
MIRT038320 DZIP3 DAZ interacting protein 3, zinc finger 1 1
MIRT038321 CSE1L CSE1 chromosome segregation 1-like (yeast) 1 1
MIRT038322 VCL vinculin 1 1
MIRT038323 RNF10 ring finger protein 10 1 1
MIRT038324 AAMP angio-associated, migratory cell protein 1 1
MIRT038325 SMIM12 chromosome 1 open reading frame 212 1 1
MIRT038326 IKZF2 IKAROS family zinc finger 2 (Helios) 1 1
MIRT038327 RPL36AL ribosomal protein L36a-like 1 1
MIRT038328 MID1 midline 1 (Opitz/BBB syndrome) 1 1
MIRT038329 MTPN myotrophin 1 1
MIRT038330 ND6 NADH dehydrogenase, subunit 6 (complex I) 1 1
MIRT038331 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT038332 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT038333 TMEM167A transmembrane protein 167A 1 1
MIRT038334 SECISBP2 SECIS binding protein 2 1 1
MIRT038335 PTMA prothymosin, alpha 1 1
MIRT038336 PPP1R12C protein phosphatase 1, regulatory subunit 12C 1 1
MIRT097680 ARRDC3 arrestin domain containing 3 1 1
MIRT120585 ANKRD28 ankyrin repeat domain 28 1 1
MIRT134442 KDM5A lysine (K)-specific demethylase 5A 1 1
MIRT162005 TFRC transferrin receptor (p90, CD71) 1 1
MIRT211714 OTUD4 OTU domain containing 4 1 2
MIRT287594 KANSL1 KAT8 regulatory NSL complex subunit 1 1 1
MIRT333938 TMCO1 transmembrane and coiled-coil domains 1 1 2
MIRT339811 ZIC5 Zic family member 5 1 1
MIRT370983 SCOC short coiled-coil protein 1 1
MIRT404962 COA4 cytochrome c oxidase assembly factor 4 homolog (S. cerevisiae) 1 1
MIRT442925 TFDP2 transcription factor Dp-2 (E2F dimerization partner 2) 1 1
MIRT444887 TMEM196 transmembrane protein 196 1 1
MIRT447218 ATXN7 ataxin 7 1 1
MIRT450592 ATIC 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase 1 1
MIRT450608 HLA-DOA major histocompatibility complex, class II, DO alpha 1 1
MIRT462474 FIZ1 FLT3-interacting zinc finger 1 1 1
MIRT471095 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta 1 1
MIRT471562 PATL1 protein associated with topoisomerase II homolog 1 (yeast) 1 3
MIRT482059 ALG9 asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT486040 UBBP4 ubiquitin B pseudogene 4 1 1
MIRT500478 ZC3H11A zinc finger CCCH-type containing 11A 1 1
MIRT500538 XPO4 exportin 4 1 1
MIRT505896 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT512067 DEK DEK oncogene 1 3
MIRT512542 ZNF793 zinc finger protein 793 1 2
MIRT524872 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 2
MIRT529391 NSFL1C NSFL1 (p97) cofactor (p47) 1 1
MIRT530542 SYNPO synaptopodin 1 1
MIRT533816 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 1 3
MIRT536729 IGF1 insulin-like growth factor 1 (somatomedin C) 1 1
MIRT549717 NUP37 nucleoporin 37kDa 1 1
MIRT550783 VAV3 vav 3 guanine nucleotide exchange factor 1 1
MIRT551510 PLP1 proteolipid protein 1 1 1
MIRT553360 TRIM8 tripartite motif containing 8 1 1
MIRT555321 PPP2CB protein phosphatase 2, catalytic subunit, beta isozyme 1 1
MIRT556293 MAP3K5 mitogen-activated protein kinase kinase kinase 5 1 1
MIRT556816 KIAA1161 KIAA1161 1 2
MIRT558194 EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa 1 2
MIRT572484 PRR14L proline rich 14-like 1 1
MIRT607361 TNS1 tensin 1 1 3
MIRT609536 ADPRH ADP-ribosylarginine hydrolase 1 1
MIRT609689 EMX2 empty spiracles homeobox 2 1 1
MIRT609769 PLCL1 phospholipase C-like 1 1 1
MIRT609846 ZNF557 zinc finger protein 557 1 1
MIRT611396 ATP9A ATPase, class II, type 9A 1 1
MIRT611989 WDR59 WD repeat domain 59 1 1
MIRT612747 MYOCD myocardin 1 1
MIRT613417 GOSR2 golgi SNAP receptor complex member 2 1 2
MIRT613455 ZFX zinc finger protein, X-linked 1 1
MIRT613568 YY2 YY2 transcription factor 1 1
MIRT613694 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT613740 GK5 glycerol kinase 5 (putative) 1 2
MIRT614178 FAM53B family with sequence similarity 53, member B 1 1
MIRT614195 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 1 1
MIRT614852 PLEKHA6 pleckstrin homology domain containing, family A member 6 1 1
MIRT615318 MLXIPL MLX interacting protein-like 1 1
MIRT615683 NAV2 neuron navigator 2 1 1
MIRT615745 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT615864 HSPA6 heat shock 70kDa protein 6 (HSP70B') 1 1
MIRT615972 ASCL1 achaete-scute complex homolog 1 (Drosophila) 1 1
MIRT617213 CERS4 ceramide synthase 4 1 1
MIRT617654 RWDD1 RWD domain containing 1 1 1
MIRT617762 C17orf105 chromosome 17 open reading frame 105 1 1
MIRT618224 CST3 cystatin C 1 1
MIRT618405 AGPAT1 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) 1 1
MIRT618610 SHOX short stature homeobox 1 1
MIRT618662 ATP6AP1L ATPase, H+ transporting, lysosomal accessory protein 1-like 1 1
MIRT619266 QRSL1 glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 1 1
MIRT619363 CFHR5 complement factor H-related 5 1 1
MIRT619924 NLRP9 NLR family, pyrin domain containing 9 1 1
MIRT620138 ZNF283 zinc finger protein 283 1 1
MIRT620176 EGFLAM EGF-like, fibronectin type III and laminin G domains 1 1
MIRT620366 CD55 CD55 molecule, decay accelerating factor for complement (Cromer blood group) 1 1
MIRT620637 RFT1 RFT1 homolog (S. cerevisiae) 1 1
MIRT620735 CCL16 chemokine (C-C motif) ligand 16 1 1
MIRT620846 ATG10 autophagy related 10 1 1
MIRT620904 MUT methylmalonyl CoA mutase 1 1
MIRT621212 SULT1C4 sulfotransferase family, cytosolic, 1C, member 4 1 1
MIRT621842 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT622034 STAT5A signal transducer and activator of transcription 5A 1 1
MIRT622118 SPRY3 sprouty homolog 3 (Drosophila) 1 1
MIRT622291 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT622592 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 2
MIRT622604 PROM1 prominin 1 1 1
MIRT622690 PLSCR1 phospholipid scramblase 1 1 1
MIRT622774 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT622853 PDGFA platelet-derived growth factor alpha polypeptide 1 1
MIRT623017 ONECUT3 one cut homeobox 3 1 1
MIRT623102 NLGN4X neuroligin 4, X-linked 1 1
MIRT623420 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT623423 KLHL28 kelch-like 28 (Drosophila) 1 1
MIRT623535 KCNJ6 potassium inwardly-rectifying channel, subfamily J, member 6 1 1
MIRT623958 FBXL16 F-box and leucine-rich repeat protein 16 1 1
MIRT624042 ELAVL3 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) 1 1
MIRT624117 DNAH10OS dynein, axonemal, heavy chain 10 opposite strand 1 1
MIRT624147 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT624368 CDK12 cyclin-dependent kinase 12 1 1
MIRT624408 CCDC171 coiled-coil domain containing 171 1 1
MIRT624459 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT624854 ABI2 abl-interactor 2 1 1
MIRT625452 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT625938 SCYL3 SCY1-like 3 (S. cerevisiae) 1 1
MIRT625949 OLIG3 oligodendrocyte transcription factor 3 1 1
MIRT626291 ZNF85 zinc finger protein 85 1 1
MIRT626907 NRN1 neuritin 1 1 1
MIRT627003 LINC00598 long intergenic non-protein coding RNA 598 1 1
MIRT627031 TMEM109 transmembrane protein 109 1 1
MIRT628152 HIP1 huntingtin interacting protein 1 1 1
MIRT628990 PITPNM3 PITPNM family member 3 1 1
MIRT630432 LHX9 LIM homeobox 9 1 1
MIRT631541 AS3MT arsenic (+3 oxidation state) methyltransferase 1 1
MIRT635194 NFKBID nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta 1 1
MIRT635814 KCNK6 potassium channel, subfamily K, member 6 1 1
MIRT636226 SLC5A12 solute carrier family 5 (sodium/glucose cotransporter), member 12 1 1
MIRT636304 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT636504 GDAP1L1 ganglioside induced differentiation associated protein 1-like 1 1 1
MIRT636830 FSIP2 fibrous sheath interacting protein 2 1 1
MIRT636857 ZSCAN2 zinc finger and SCAN domain containing 2 1 1
MIRT637017 TRABD2A TraB domain containing 2A 1 1
MIRT638338 RCAN1 regulator of calcineurin 1 1 1
MIRT638911 CBLN2 cerebellin 2 precursor 1 1
MIRT639353 TBXA2R thromboxane A2 receptor 1 1
MIRT639416 FAM26E family with sequence similarity 26, member E 1 2
MIRT639532 CD86 CD86 molecule 1 1
MIRT639805 AHCY adenosylhomocysteinase 1 1
MIRT640375 UQCRB ubiquinol-cytochrome c reductase binding protein 1 1
MIRT640605 PPARA peroxisome proliferator-activated receptor alpha 1 1
MIRT641761 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 1
MIRT641794 USP32 ubiquitin specific peptidase 32 1 1
MIRT641879 SREK1 splicing regulatory glutamine/lysine-rich protein 1 1 1
MIRT641987 OXSR1 oxidative-stress responsive 1 1 1
MIRT642352 C19orf40 chromosome 19 open reading frame 40 1 1
MIRT642469 RSL1D1 ribosomal L1 domain containing 1 1 1
MIRT642724 ATXN3 ataxin 3 1 1
MIRT642758 SDHAF2 succinate dehydrogenase complex assembly factor 2 1 1
MIRT642771 FAM9C family with sequence similarity 9, member C 1 1
MIRT643191 HYPK huntingtin interacting protein K 1 1
MIRT643244 PRSS21 protease, serine, 21 (testisin) 1 1
MIRT643901 TCEB2 transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) 1 1
MIRT643957 GALNT13 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13) 1 1
MIRT644161 GIN1 gypsy retrotransposon integrase 1 1 1
MIRT644297 HRH1 histamine receptor H1 1 1
MIRT644374 ZNF286A zinc finger protein 286A 1 1
MIRT644407 FRMD6 FERM domain containing 6 1 1
MIRT644942 ATXN3L ataxin 3-like 1 1
MIRT645143 CUBN cubilin (intrinsic factor-cobalamin receptor) 1 1
MIRT645327 C9orf64 chromosome 9 open reading frame 64 1 1
MIRT645335 DHRS3 dehydrogenase/reductase (SDR family) member 3 1 1
MIRT645469 SPIN3 spindlin family, member 3 1 1
MIRT645496 TRIM63 tripartite motif containing 63, E3 ubiquitin protein ligase 1 1
MIRT645921 PLXNA3 plexin A3 1 1
MIRT645955 TTF2 transcription termination factor, RNA polymerase II 1 1
MIRT646031 S100A7A S100 calcium binding protein A7A 1 1
MIRT646208 DUSP10 dual specificity phosphatase 10 1 1
MIRT647166 TMLHE trimethyllysine hydroxylase, epsilon 1 1
MIRT647288 JAG2 jagged 2 1 1
MIRT647394 FAM181B family with sequence similarity 181, member B 1 1
MIRT647447 SIX6 SIX homeobox 6 1 1
MIRT647455 MC2R melanocortin 2 receptor (adrenocorticotropic hormone) 1 1
MIRT647616 IGSF9B immunoglobulin superfamily, member 9B 1 1
MIRT648105 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 1 1
MIRT648358 AKIP1 A kinase (PRKA) interacting protein 1 1 1
MIRT649541 VAMP8 vesicle-associated membrane protein 8 1 1
MIRT650687 CD82 CD82 molecule 1 1
MIRT650707 KRT32 keratin 32 1 1
MIRT651055 ZNF579 zinc finger protein 579 1 1
MIRT651541 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT651588 WDR26 WD repeat domain 26 1 1
MIRT651634 WASF3 WAS protein family, member 3 1 1
MIRT651739 VEGFB vascular endothelial growth factor B 1 1
MIRT651836 USP37 ubiquitin specific peptidase 37 1 1
MIRT652239 TRAPPC10 trafficking protein particle complex 10 1 1
MIRT652888 SYVN1 synovial apoptosis inhibitor 1, synoviolin 1 1
MIRT652897 SYT2 synaptotagmin II 1 1
MIRT652937 SYNGR1 synaptogyrin 1 1 1
MIRT652963 SVEP1 sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1 1 1
MIRT653469 SLC4A1 solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group) 1 1
MIRT653580 SLC35B3 solute carrier family 35, member B3 1 1
MIRT653626 SLC30A3 solute carrier family 30 (zinc transporter), member 3 1 1
MIRT653669 SLC26A7 solute carrier family 26, member 7 1 1
MIRT653921 SERPINC1 serpin peptidase inhibitor, clade C (antithrombin), member 1 1 1
MIRT654247 RIMS4 regulating synaptic membrane exocytosis 4 1 1
MIRT654269 RGS17 regulator of G-protein signaling 17 1 1
MIRT654347 RBM27 RNA binding motif protein 27 1 1
MIRT654547 RAB1A RAB1A, member RAS oncogene family 1 1
MIRT654617 PTPRM protein tyrosine phosphatase, receptor type, M 1 1
MIRT654732 PRLR prolactin receptor 1 1
MIRT654749 PRKCB protein kinase C, beta 1 1
MIRT654930 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT655446 PALM2-AKAP2 PALM2-AKAP2 readthrough 1 1
MIRT655562 P2RX7 purinergic receptor P2X, ligand-gated ion channel, 7 1 1
MIRT656527 MAGT1 magnesium transporter 1 1 1
MIRT656861 KIN KIN, antigenic determinant of recA protein homolog (mouse) 1 1
MIRT657149 ITGA1 integrin, alpha 1 1 1
MIRT657408 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 1 1
MIRT657436 HHIP hedgehog interacting protein 1 1
MIRT657700 GPC5 glypican 5 1 1
MIRT657863 GJD2 gap junction protein, delta 2, 36kDa 1 1
MIRT658049 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 1
MIRT658094 FOXO1 forkhead box O1 1 1
MIRT658147 STXBP2 syntaxin binding protein 2 1 1
MIRT658179 FBXO9 F-box protein 9 1 1
MIRT658492 EXOC7 exocyst complex component 7 1 1
MIRT658499 EXOC5 exocyst complex component 5 1 1
MIRT658680 EMP2 epithelial membrane protein 2 1 1
MIRT658814 EEF1E1 eukaryotic translation elongation factor 1 epsilon 1 1 1
MIRT659024 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 1 1
MIRT659164 DCTN5 dynactin 5 (p25) 1 2
MIRT659417 COL4A4 collagen, type IV, alpha 4 1 1
MIRT659626 CDON Cdon homolog (mouse) 1 1
MIRT659716 CCDC93 coiled-coil domain containing 93 1 1
MIRT660019 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 1 1
MIRT660043 C15orf61 chromosome 15 open reading frame 61 1 1
MIRT660349 BBX bobby sox homolog (Drosophila) 1 1
MIRT660791 AKAP2 A kinase (PRKA) anchor protein 2 1 1
MIRT660946 ACER3 alkaline ceramidase 3 1 1
MIRT661286 EPPIN epididymal peptidase inhibitor 1 1
MIRT661335 TBC1D15 TBC1 domain family, member 15 1 1
MIRT661568 EPHX2 epoxide hydrolase 2, cytoplasmic 1 1
MIRT661635 UGT2B28 UDP glucuronosyltransferase 2 family, polypeptide B28 1 1
MIRT661644 EPPIN-WFDC6 EPPIN-WFDC6 readthrough 1 1
MIRT661740 DTHD1 death domain containing 1 1 1
MIRT664290 C15orf40 chromosome 15 open reading frame 40 1 1
MIRT664578 CD44 CD44 molecule (Indian blood group) 1 1
MIRT664749 SAMHD1 SAM domain and HD domain 1 1 1
MIRT665300 ZBTB38 zinc finger and BTB domain containing 38 1 1
MIRT666755 RALGPS2 Ral GEF with PH domain and SH3 binding motif 2 1 1
MIRT668007 HCFC2 host cell factor C2 1 1
MIRT668745 DIO2 deiodinase, iodothyronine, type II 1 1
MIRT668871 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT669122 CD84 CD84 molecule 1 1
MIRT669140 CD200 CD200 molecule 1 1
MIRT671844 PDE3A phosphodiesterase 3A, cGMP-inhibited 1 2
MIRT675259 LPP LIM domain containing preferred translocation partner in lipoma 1 1
MIRT685148 TACR3 tachykinin receptor 3 1 1
MIRT686088 PNPLA3 patatin-like phospholipase domain containing 3 1 1
MIRT698994 SPAG9 sperm associated antigen 9 1 1
MIRT704256 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT707224 STAM signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 1 1
MIRT708402 GRIN2A glutamate receptor, ionotropic, N-methyl D-aspartate 2A 1 1
MIRT710458 METTL15 methyltransferase like 15 1 1
MIRT710869 B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) 1 1
MIRT711130 CYYR1 cysteine/tyrosine-rich 1 1 1
MIRT711188 PIGG phosphatidylinositol glycan anchor biosynthesis, class G 1 1
MIRT711604 LHX5 LIM homeobox 5 1 1
MIRT712518 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 1 1
MIRT713086 ZG16 zymogen granule protein 16 homolog (rat) 1 1
MIRT713245 SLC22A3 solute carrier family 22 (extraneuronal monoamine transporter), member 3 1 1
MIRT714209 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 1 1
MIRT714966 N4BP2 NEDD4 binding protein 2 1 1
MIRT715286 TXNL1 thioredoxin-like 1 1 1
MIRT715440 RGS6 regulator of G-protein signaling 6 1 1
MIRT715635 ZBTB8B zinc finger and BTB domain containing 8B 1 1
MIRT716055 C1orf210 chromosome 1 open reading frame 210 1 1
MIRT716895 BTN3A2 butyrophilin, subfamily 3, member A2 1 1
MIRT716988 GPR155 G protein-coupled receptor 155 1 1
MIRT717086 EBF4 early B-cell factor 4 1 1
MIRT717172 UCHL3 ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) 1 1
MIRT717666 THBS2 thrombospondin 2 1 1
MIRT717673 CDC42BPA CDC42 binding protein kinase alpha (DMPK-like) 1 1
MIRT717731 FGF1 fibroblast growth factor 1 (acidic) 1 1
MIRT718685 FZD2 frizzled family receptor 2 1 1
MIRT718907 GALR1 galanin receptor 1 1 1
MIRT719114 MAML1 mastermind-like 1 (Drosophila) 1 1
MIRT719699 STX6 syntaxin 6 1 1
MIRT719833 C22orf24 chromosome 22 open reading frame 24 1 1
MIRT719892 RRP36 ribosomal RNA processing 36 homolog (S. cerevisiae) 1 1
MIRT720159 POU2F2 POU class 2 homeobox 2 1 1
MIRT720310 CSRNP3 cysteine-serine-rich nuclear protein 3 1 1
MIRT720718 RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6 1 1
MIRT721982 RAD50 RAD50 homolog (S. cerevisiae) 1 1
MIRT722357 BAG2 BCL2-associated athanogene 2 1 1
MIRT722552 FGFR1OP FGFR1 oncogene partner 1 1
MIRT723274 TAL2 T-cell acute lymphocytic leukemia 2 1 1
MIRT723795 MUC17 mucin 17, cell surface associated 1 1
MIRT723805 BDKRB2 bradykinin receptor B2 1 1
MIRT724133 MT1A metallothionein 1A 1 1
MIRT724520 LRP6 low density lipoprotein receptor-related protein 6 1 1
MIRT724538 ABCG5 ATP-binding cassette, sub-family G (WHITE), member 5 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*