Accession ID: MIRT038295 [miRNA, hsa-miR-130b-5p :: BRAT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-130bLinkOut: [miRBase ]
Synonyms MIRN130B, mir-130b, MIR130B
Description Homo sapiens miR-130b stem-loop
Comment This sequence is the predicted human homologue of mouse miR-130b cloned from mouse embryonic stem cells .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-130b-5p
Mature Sequence 13| ACUCUUUCCCUGUUGCACUAC |33
Evidence Experimental
Experiments Cloned
Putative hsa-miR-130b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-130b-5p :: BRAT1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' catcACGTTGTCCCTTTCTCa 5'
              | ||:||  |:::||| 
Target 5' --tcTTCAGCA--GGGGGAGt 3'
1 - 17
2
miRNA  3' caTCACGTTGTCCCTTTCtca 5'
            || ||  :  ||::||   
Target 5' ccAGGGCTCTTTGGGGAGcca 3'
23 - 43
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
57 hsa-miR-130b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038280 ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 1 1
MIRT038281 MACC1 metastasis associated in colon cancer 1 1 1
MIRT038282 ADPRHL2 ADP-ribosylhydrolase like 2 1 1
MIRT038283 MYBPC1 myosin binding protein C, slow type 1 1
MIRT038284 NCOR2 nuclear receptor corepressor 2 1 1
MIRT038285 DPYSL5 dihydropyrimidinase-like 5 1 1
MIRT038286 EMC1 KIAA0090 1 1
MIRT038287 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 1
MIRT038288 CDC5L CDC5 cell division cycle 5-like (S. pombe) 1 1
MIRT038289 OGDHL oxoglutarate dehydrogenase-like 1 1
MIRT038290 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT038291 POLD3 polymerase (DNA-directed), delta 3, accessory subunit 1 1
MIRT038292 PDS5A PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) 1 1
MIRT038293 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT038294 COPB1 coatomer protein complex, subunit beta 1 1 1
MIRT038295 BRAT1 chromosome 7 open reading frame 27 1 1
MIRT038296 NOTCH2 Notch homolog 2 (Drosophila) 1 1
MIRT038297 RPL8 ribosomal protein L8 1 1
MIRT038298 HBS1L HBS1-like (S. cerevisiae) 1 1
MIRT038299 MFSD6 major facilitator superfamily domain containing 6 1 1
MIRT038300 SSH2 slingshot homolog 2 (Drosophila) 1 1
MIRT038301 PTPN11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT038302 PAGR1 chromosome 16 open reading frame 53 1 1
MIRT038303 ALDH1B1 aldehyde dehydrogenase 1 family, member B1 1 1
MIRT038304 TTC3 tetratricopeptide repeat domain 3 1 1
MIRT038305 EP300 E1A binding protein p300 1 1
MIRT038306 PCDHGB4 protocadherin gamma subfamily B, 4 1 1
MIRT038307 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 1
MIRT038308 HELZ helicase with zinc finger 1 1
MIRT038309 JMY junction mediating and regulatory protein, p53 cofactor 1 1
MIRT038310 MEIS3 Meis homeobox 3 1 1
MIRT038311 SMG5 Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT038312 FAM72A family with sequence similarity 72, member A 1 1
MIRT038313 CGNL1 cingulin-like 1 1 1
MIRT038314 HNRNPR heterogeneous nuclear ribonucleoprotein R 1 1
MIRT038315 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT038316 HSPA8 heat shock 70kDa protein 8 1 1
MIRT038317 CHD1 chromodomain helicase DNA binding protein 1 1 1
MIRT038318 FASN fatty acid synthase 1 1
MIRT038319 PDHA1 pyruvate dehydrogenase (lipoamide) alpha 1 1 1
MIRT038320 DZIP3 DAZ interacting protein 3, zinc finger 1 1
MIRT038321 CSE1L CSE1 chromosome segregation 1-like (yeast) 1 1
MIRT038322 VCL vinculin 1 1
MIRT038323 RNF10 ring finger protein 10 1 1
MIRT038324 AAMP angio-associated, migratory cell protein 1 1
MIRT038325 SMIM12 chromosome 1 open reading frame 212 1 1
MIRT038326 IKZF2 IKAROS family zinc finger 2 (Helios) 1 1
MIRT038327 RPL36AL ribosomal protein L36a-like 1 1
MIRT038328 MID1 midline 1 (Opitz/BBB syndrome) 1 1
MIRT038329 MTPN myotrophin 1 1
MIRT038330 ND6 NADH dehydrogenase, subunit 6 (complex I) 1 1
MIRT038331 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT038332 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT038333 TMEM167A transmembrane protein 167A 1 1
MIRT038334 SECISBP2 SECIS binding protein 2 1 1
MIRT038335 PTMA prothymosin, alpha 1 1
MIRT038336 PPP1R12C protein phosphatase 1, regulatory (inhibitor) subunit 12C 1 1