Accession ID: MIRT038609 [miRNA, hsa-miR-186-3p :: LDHB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-186LinkOut: [miRBase ]
Synonyms MIRN186, miR-186, MIR186
Description Homo sapiens miR-186 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse. Expression of this miRNA was also verified in a human osteoblast sarcoma cell line .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-186-3p
Mature Sequence 54| GCCCAAAGGUGAAUUUUUUGGG |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-186-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LDHB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms LDH-H, TRG-5
Description lactate dehydrogenase B
Transcript NM_0011740    LinkOut: [ RefSeq ]
Other Transcripts NM_0023   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LDHB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of LDHB
(miRNA target sites are highlighted)
>LDHB|NM_0011740|3'UTR
   1 TGACTAGTGAGCTCTAGGCTGTAGAAATTTAAAAACTACAATGTGATTAACTCGAGCCTTTAGTTTTCATCCATGTACAT
  81 GGATCACAGTTTGCTTTGATCTTCTTCAATATGTGAATTTGGGCTCACAGAATCAAAGCCTATGCTTGGTTTAATGCTTG
 161 CAATCTGAGCTCTTGAACAAATAAAATTAACTATTGTAGTGTGC
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ggGUUUUUUAAGUGGAAACCCg 5'
            ||| | :|  |  |||||| 
Target 5' ttCAATATGTGAA--TTTGGGc 3'
105 - 124 123.00 -10.70
2
miRNA  3' ggguuUUUUAAGUGGAAACccg 5'
               | |:||:: |||||   
Target 5' ggatcACAGTTTG-CTTTGatc 3'
81 - 101 112.00 -14.70
3
miRNA  3' ggGUUUUUUAAG--UGGAAACCcg 5'
            ::|  || ||  :||||| |  
Target 5' tgTGATTAACTCGAGCCTTTAGtt 3'
42 - 65 102.00 -9.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-186-3p :: LDHB    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
9 hsa-miR-186-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038608 KIF3C kinesin family member 3C 1 1
MIRT038609 LDHB lactate dehydrogenase B 1 1
MIRT038610 AADACL3 arylacetamide deacetylase-like 3 1 1
MIRT038611 TTC37 tetratricopeptide repeat domain 37 1 1
MIRT038612 RAI2 retinoic acid induced 2 1 1
MIRT038613 VDAC3 voltage-dependent anion channel 3 1 1
MIRT038614 ECSIT ECSIT homolog (Drosophila) 1 1
MIRT038615 CSAG1 chondrosarcoma associated gene 1 1 1
MIRT038616 TK1 thymidine kinase 1, soluble 1 1