Accession ID: MIRT038609 [miRNA, hsa-miR-186-3p :: LDHB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-186LinkOut: [miRBase ]
Synonyms MIRN186, miR-186, MIR186
Description Homo sapiens miR-186 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse. Expression of this miRNA was also verified in a human osteoblast sarcoma cell line .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-186-3p
Mature Sequence 54| GCCCAAAGGUGAAUUUUUUGGG |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-186-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LDHB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms LDH-B, LDH-H, LDHBD, TRG-5
Description lactate dehydrogenase B
Transcript NM_001174097    LinkOut: [ RefSeq ]
Other Transcripts NM_002300   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LDHB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of LDHB
(miRNA target sites are highlighted)
>LDHB|NM_001174097|3'UTR
   1 CTAGTGAGCTCTAGGCTGTAGAAATTTAAAAACTACAATGTGATTAACTCGAGCCTTTAGTTTTCATCCATGTACATGGA
  81 TCACAGTTTGCTTTGATCTTCTTCAATATGTGAATTTGGGCTCACAGAATCAAAGCCTATGCTTGGTTTAATGCTTGCAA
 161 TCTGAGCTCTTGAACAAATAAAATTAACTATTGTAGTGTGC
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ggGUUUUUUAAGUGGAAACCCg 5'
            ||| | :|  |  |||||| 
Target 5' ttCAATATGTGAA--TTTGGGc 3'
102 - 121 123.00 -10.70
2
miRNA  3' ggguuUUUUAAGUGGAAACccg 5'
               | |:||:: |||||   
Target 5' ggatcACAGTTTG-CTTTGatc 3'
78 - 98 112.00 -14.70
3
miRNA  3' ggGUUUUUUAAG--UGGAAACCcg 5'
            ::|  || ||  :||||| |  
Target 5' tgTGATTAACTCGAGCCTTTAGtt 3'
39 - 62 102.00 -9.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-186-3p :: LDHB    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
424 hsa-miR-186-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038608 KIF3C kinesin family member 3C 1 1
MIRT038609 LDHB lactate dehydrogenase B 1 1
MIRT038610 AADACL3 arylacetamide deacetylase-like 3 1 1
MIRT038611 TTC37 tetratricopeptide repeat domain 37 1 2
MIRT038612 RAI2 retinoic acid induced 2 1 1
MIRT038613 VDAC3 voltage-dependent anion channel 3 1 1
MIRT038614 ECSIT ECSIT homolog (Drosophila) 1 1
MIRT038615 CSAG1 chondrosarcoma associated gene 1 1 1
MIRT038616 TK1 thymidine kinase 1, soluble 1 1
MIRT056765 ARID5B AT rich interactive domain 5B (MRF1-like) 1 1
MIRT130089 TXNIP thioredoxin interacting protein 1 1
MIRT138432 KIF2C kinesin family member 2C 1 1
MIRT158528 TNRC6B trinucleotide repeat containing 6B 1 2
MIRT170498 UBN2 ubinuclein 2 1 1
MIRT186369 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT222129 FOXK1 forkhead box K1 1 1
MIRT254727 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 1 1
MIRT286950 SOCS7 suppressor of cytokine signaling 7 1 1
MIRT293383 ZBTB7A zinc finger and BTB domain containing 7A 1 1
MIRT309001 USP53 ubiquitin specific peptidase 53 1 1
MIRT379947 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT390400 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 1
MIRT441920 FAM217B family with sequence similarity 217, member B 1 1
MIRT447960 WDR77 WD repeat domain 77 1 1
MIRT455475 LYPLA2 lysophospholipase II 1 1
MIRT470696 POGZ pogo transposable element with ZNF domain 1 4
MIRT476230 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 1 1
MIRT479393 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 4
MIRT494865 TOM1L2 target of myb1-like 2 (chicken) 1 1
MIRT495092 SYN3 synapsin III 1 1
MIRT496335 PTPRT protein tyrosine phosphatase, receptor type, T 1 1
MIRT496885 PLA2G16 phospholipase A2, group XVI 1 1
MIRT496984 KALRN kalirin, RhoGEF kinase 1 1
MIRT497089 PAH phenylalanine hydroxylase 1 1
MIRT498439 INO80D INO80 complex subunit D 1 1
MIRT504836 EREG epiregulin 1 1
MIRT508555 CEP72 centrosomal protein 72kDa 1 2
MIRT508724 ZNF682 zinc finger protein 682 1 2
MIRT508816 GPR155 G protein-coupled receptor 155 1 1
MIRT509110 BMP8B bone morphogenetic protein 8b 1 3
MIRT509201 TTF2 transcription termination factor, RNA polymerase II 1 1
MIRT509376 FGD6 FYVE, RhoGEF and PH domain containing 6 1 2
MIRT511535 HMGB1 high mobility group box 1 1 3
MIRT514116 SERF2 small EDRK-rich factor 2 1 1
MIRT514300 FXYD5 FXYD domain containing ion transport regulator 5 1 3
MIRT514930 TRIM73 tripartite motif containing 73 1 1
MIRT514960 SIGLEC11 sialic acid binding Ig-like lectin 11 1 1
MIRT515374 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT515442 TRIM74 tripartite motif containing 74 1 1
MIRT515555 TMEM134 transmembrane protein 134 1 1
MIRT516024 A1CF APOBEC1 complementation factor 1 1
MIRT516039 MED18 mediator complex subunit 18 1 1
MIRT516536 MIXL1 Mix paired-like homeobox 1 1
MIRT516804 ZNF708 zinc finger protein 708 1 2
MIRT516990 COX19 cytochrome c oxidase assembly homolog 19 (S. cerevisiae) 1 2
MIRT517098 CCDC30 coiled-coil domain containing 30 1 3
MIRT517702 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT517795 EFCAB11 EF-hand calcium binding domain 11 1 2
MIRT517995 SLC16A13 solute carrier family 16, member 13 (monocarboxylic acid transporter 13) 1 1
MIRT518475 C8orf37 chromosome 8 open reading frame 37 1 2
MIRT518872 NKD1 naked cuticle homolog 1 (Drosophila) 1 1
MIRT520437 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT520990 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT521529 QSOX1 quiescin Q6 sulfhydryl oxidase 1 1 2
MIRT521646 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT522852 KIAA1551 KIAA1551 1 1
MIRT522974 INTU inturned planar cell polarity effector homolog (Drosophila) 1 1
MIRT523062 HYPK huntingtin interacting protein K 1 1
MIRT523418 GPR157 G protein-coupled receptor 157 1 1
MIRT523582 GGA2 golgi-associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT524275 CYCS cytochrome c, somatic 1 1
MIRT524436 CNKSR3 CNKSR family member 3 1 1
MIRT524754 BCL2L2 BCL2-like 2 1 1
MIRT524964 AGO3 eukaryotic translation initiation factor 2C, 3 1 1
MIRT525603 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT525810 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT525911 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) 1 1
MIRT525952 SLC8A3 solute carrier family 8 (sodium/calcium exchanger), member 3 1 2
MIRT526619 NME6 NME/NM23 nucleoside diphosphate kinase 6 1 1
MIRT528966 FAM19A3 family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 1 1
MIRT529982 TNFAIP8L1 tumor necrosis factor, alpha-induced protein 8-like 1 1 1
MIRT530239 PLXDC1 plexin domain containing 1 1 1
MIRT530463 SULT1B1 sulfotransferase family, cytosolic, 1B, member 1 1 1
MIRT530574 ABHD15 abhydrolase domain containing 15 1 1
MIRT530818 SCNN1G sodium channel, non-voltage-gated 1, gamma subunit 1 1
MIRT531741 TXK TXK tyrosine kinase 1 1
MIRT532029 FHDC1 FH2 domain containing 1 1 1
MIRT534823 RAB30 RAB30, member RAS oncogene family 1 1
MIRT534891 PYGO1 pygopus homolog 1 (Drosophila) 1 1
MIRT535588 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT537225 GAN gigaxonin 1 1
MIRT537518 FAM104A family with sequence similarity 104, member A 1 1
MIRT537948 DSN1 DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT538059 DMD dystrophin 1 1
MIRT540258 FAM89A family with sequence similarity 89, member A 1 1
MIRT540370 MASTL microtubule associated serine/threonine kinase-like 1 1
MIRT540649 ZNF514 zinc finger protein 514 1 1
MIRT542034 PTRF polymerase I and transcript release factor 1 1
MIRT542125 DIS3L DIS3 mitotic control homolog (S. cerevisiae)-like 1 1
MIRT542352 MED16 mediator complex subunit 16 1 1
MIRT544260 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 2
MIRT552240 DUSP3 dual specificity phosphatase 3 1 1
MIRT554357 SFXN5 sideroflexin 5 1 2
MIRT555449 POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa 1 1
MIRT557809 FOXO1 forkhead box O1 1 2
MIRT558514 CTDSPL CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like 1 2
MIRT558812 CDK1 cyclin-dependent kinase 1 1 2
MIRT559599 ANAPC16 anaphase promoting complex subunit 16 1 1
MIRT559889 PODXL podocalyxin-like 1 1
MIRT560836 SUV39H2 suppressor of variegation 3-9 homolog 2 (Drosophila) 1 1
MIRT561796 PAWR PRKC, apoptosis, WT1, regulator 1 1
MIRT564118 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 1 1
MIRT564830 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT565201 TSC22D4 TSC22 domain family, member 4 1 1
MIRT565425 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT565568 SLMO2 slowmo homolog 2 (Drosophila) 1 1
MIRT568130 CCNY cyclin Y 1 1
MIRT572433 ATM ataxia telangiectasia mutated 1 1
MIRT572659 AGMAT agmatine ureohydrolase (agmatinase) 1 2
MIRT572906 RUNDC3B RUN domain containing 3B 1 1
MIRT574858 C12orf73 chromosome 12 open reading frame 73 1 1
MIRT575898 Dis3 DIS3 mitotic control homolog (S. cerevisiae) 1 1
MIRT608732 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT609299 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 1 1
MIRT610292 DIS3 DIS3 mitotic control homolog (S. cerevisiae) 1 1
MIRT610642 PIGM phosphatidylinositol glycan anchor biosynthesis, class M 1 1
MIRT612424 SP1 Sp1 transcription factor 1 1
MIRT612596 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT613615 FAM185A family with sequence similarity 185, member A 1 1
MIRT614245 WDR53 WD repeat domain 53 1 2
MIRT614937 KLF7 Kruppel-like factor 7 (ubiquitous) 1 1
MIRT615160 SPIB Spi-B transcription factor (Spi-1/PU.1 related) 1 1
MIRT615552 TNFSF15 tumor necrosis factor (ligand) superfamily, member 15 1 1
MIRT619057 TTC4 tetratricopeptide repeat domain 4 1 1
MIRT619080 DNAAF3 dynein, axonemal, assembly factor 3 1 1
MIRT619823 POLM polymerase (DNA directed), mu 1 2
MIRT620896 ANO7 anoctamin 7 1 1
MIRT620906 MUT methylmalonyl CoA mutase 1 1
MIRT621665 UBE4B ubiquitination factor E4B 1 1
MIRT621711 TRIP11 thyroid hormone receptor interactor 11 1 1
MIRT622297 SH3BP2 SH3-domain binding protein 2 1 1
MIRT623525 KCNK10 potassium channel, subfamily K, member 10 1 1
MIRT625250 SLC35A3 solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3 1 1
MIRT625819 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT626203 PNRC1 proline-rich nuclear receptor coactivator 1 1 2
MIRT626804 TTPAL tocopherol (alpha) transfer protein-like 1 1
MIRT626913 HIST1H2BG histone cluster 1, H2bg 1 1
MIRT627971 NIPAL1 NIPA-like domain containing 1 1 1
MIRT628221 FGF10 fibroblast growth factor 10 1 1
MIRT628407 C1orf21 chromosome 1 open reading frame 21 1 1
MIRT630114 PNPLA3 patatin-like phospholipase domain containing 3 1 1
MIRT631510 FFAR4 omega-3 fatty acid receptor 1 1 1
MIRT633210 WFDC6 WAP four-disulfide core domain 6 1 1
MIRT634082 APOH apolipoprotein H (beta-2-glycoprotein I) 1 1
MIRT634295 SUGT1 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) 1 1
MIRT634642 HIP1 huntingtin interacting protein 1 1 2
MIRT634888 SENP8 SUMO/sentrin specific peptidase family member 8 1 1
MIRT634939 GTF2H2C general transcription factor IIH, polypeptide 2C 1 1
MIRT635348 RBL1 retinoblastoma-like 1 (p107) 1 1
MIRT635398 VPS45 vacuolar protein sorting 45 homolog (S. cerevisiae) 1 1
MIRT636314 PNO1 partner of NOB1 homolog (S. cerevisiae) 1 1
MIRT636822 ZNF878 zinc finger protein 878 1 2
MIRT637026 RMDN1 family with sequence similarity 82, member B 1 1
MIRT637065 PRKAG1 protein kinase, AMP-activated, gamma 1 non-catalytic subunit 1 1
MIRT637273 KLHL12 kelch-like 12 (Drosophila) 1 1
MIRT638018 TTC31 tetratricopeptide repeat domain 31 1 1
MIRT638110 YPEL1 yippee-like 1 (Drosophila) 1 1
MIRT639215 PPIL2 peptidylprolyl isomerase (cyclophilin)-like 2 1 1
MIRT639820 TCN2 transcobalamin II 1 1
MIRT639860 TBC1D16 TBC1 domain family, member 16 1 1
MIRT639895 SSR3 signal sequence receptor, gamma (translocon-associated protein gamma) 1 1
MIRT639948 PTAFR platelet-activating factor receptor 1 1
MIRT640455 IP6K2 inositol hexakisphosphate kinase 2 1 2
MIRT640767 GLO1 glyoxalase I 1 1
MIRT640827 POLR1D polymerase (RNA) I polypeptide D, 16kDa 1 2
MIRT640897 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT641018 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT641260 C8orf46 chromosome 8 open reading frame 46 1 1
MIRT641763 ZNF207 zinc finger protein 207 1 1
MIRT642331 ZNF573 zinc finger protein 573 1 1
MIRT642476 C16orf58 chromosome 16 open reading frame 58 1 1
MIRT642613 APOPT1 apoptogenic 1, mitochondrial 1 1
MIRT643114 SMIM7 small integral membrane protein 7 1 1
MIRT643646 PLCL1 phospholipase C-like 1 1 1
MIRT643903 TCEB2 transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) 1 1
MIRT644843 SEC14L4 SEC14-like 4 (S. cerevisiae) 1 1
MIRT644905 FREM1 FRAS1 related extracellular matrix 1 1 1
MIRT645373 C9orf47 chromosome 9 open reading frame 47 1 1
MIRT645822 OPALIN oligodendrocytic myelin paranodal and inner loop protein 1 1
MIRT646007 HTRA1 HtrA serine peptidase 1 1 1
MIRT646066 VANGL2 vang-like 2 (van gogh, Drosophila) 1 1
MIRT646727 RHOG ras homolog family member G 1 1
MIRT647791 ASB8 ankyrin repeat and SOCS box containing 8 1 1
MIRT647971 C4orf26 chromosome 4 open reading frame 26 1 1
MIRT648676 ZNF626 zinc finger protein 626 1 1
MIRT648763 WDR66 WD repeat domain 66 1 1
MIRT650159 CACNG6 calcium channel, voltage-dependent, gamma subunit 6 1 1
MIRT650421 FKBP9 FK506 binding protein 9, 63 kDa 1 1
MIRT651029 ZNF699 zinc finger protein 699 1 1
MIRT651606 WDFY2 WD repeat and FYVE domain containing 2 1 1
MIRT652339 TMOD3 tropomodulin 3 (ubiquitous) 1 2
MIRT652353 TMOD2 tropomodulin 2 (neuronal) 1 2
MIRT652405 TMEM33 transmembrane protein 33 1 1
MIRT653289 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT653395 SLFN13 schlafen family member 13 1 1
MIRT653611 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 1
MIRT653859 SHE Src homology 2 domain containing E 1 1
MIRT654010 SCO1 SCO1 cytochrome c oxidase assembly protein 1 1
MIRT654234 RNF165 ring finger protein 165 1 1
MIRT654844 PPM1L protein phosphatase, Mg2+/Mn2+ dependent, 1L 1 1
MIRT655513 PAIP2B poly(A) binding protein interacting protein 2B 1 1
MIRT656187 MON1B MON1 homolog B (yeast) 1 1
MIRT656460 MAPK14 mitogen-activated protein kinase 14 1 1
MIRT658700 EMC3 ER membrane protein complex subunit 3 1 1
MIRT658975 DNAJB5 DnaJ (Hsp40) homolog, subfamily B, member 5 1 2
MIRT659040 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 1 1
MIRT659313 CSTF1 cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa 1 1
MIRT659440 CNPPD1 cyclin Pas1/PHO80 domain containing 1 1 1
MIRT659928 CACNA1A calcium channel, voltage-dependent, P/Q type, alpha 1A subunit 1 1
MIRT661756 ATCAY ataxia, cerebellar, Cayman type 1 2
MIRT661926 MLN motilin 1 1
MIRT662390 ICA1L islet cell autoantigen 1,69kDa-like 1 2
MIRT663593 TRPV2 transient receptor potential cation channel, subfamily V, member 2 1 1
MIRT664209 TBCA tubulin folding cofactor A 1 1
MIRT664900 EMC7 ER membrane protein complex subunit 7 1 1
MIRT665119 DNASE2 deoxyribonuclease II, lysosomal 1 1
MIRT667346 MRTO4 mRNA turnover 4 homolog (S. cerevisiae) 1 1
MIRT668934 COL9A2 collagen, type IX, alpha 2 1 1
MIRT673115 MFSD2A major facilitator superfamily domain containing 2A 1 1
MIRT673548 DEGS1 delta(4)-desaturase, sphingolipid 1 1 1
MIRT674414 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 1 1
MIRT675170 TRIM72 tripartite motif containing 72 1 1
MIRT676077 TIMM50 translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) 1 1
MIRT676147 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT676695 LAIR1 leukocyte-associated immunoglobulin-like receptor 1 1 1
MIRT676767 SNX2 sorting nexin 2 1 1
MIRT676780 NPHS1 nephrosis 1, congenital, Finnish type (nephrin) 1 1
MIRT676790 CXorf38 chromosome X open reading frame 38 1 3
MIRT676940 EMP2 epithelial membrane protein 2 1 1
MIRT676950 S1PR3 sphingosine-1-phosphate receptor 3 1 1
MIRT677076 VMAC vimentin-type intermediate filament associated coiled-coil protein 1 1
MIRT677101 MFSD11 major facilitator superfamily domain containing 11 1 2
MIRT677137 P2RX7 purinergic receptor P2X, ligand-gated ion channel, 7 1 1
MIRT677242 C15orf40 chromosome 15 open reading frame 40 1 1
MIRT677371 HSPA4L heat shock 70kDa protein 4-like 1 1
MIRT677542 TM4SF5 transmembrane 4 L six family member 5 1 1
MIRT677589 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha 1 1
MIRT678729 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT678927 XPOT exportin, tRNA 1 1
MIRT679075 MANEAL mannosidase, endo-alpha-like 1 1
MIRT679602 HILPDA hypoxia inducible lipid droplet-associated 1 1
MIRT679617 RRP36 ribosomal RNA processing 36 homolog (S. cerevisiae) 1 1
MIRT679697 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 2
MIRT679701 MTRNR2L5 MT-RNR2-like 5 1 1
MIRT679718 RPL24 ribosomal protein L24 1 1
MIRT679925 FBLIM1 filamin binding LIM protein 1 1 1
MIRT679939 MCTS1 malignant T cell amplified sequence 1 1 1
MIRT680068 CD96 CD96 molecule 1 1
MIRT680095 SLC35F6 chromosome 2 open reading frame 18 1 2
MIRT680453 PDE6A phosphodiesterase 6A, cGMP-specific, rod, alpha 1 1
MIRT680490 XIAP X-linked inhibitor of apoptosis 1 1
MIRT681821 N4BP2L2 NEDD4 binding protein 2-like 2 1 1
MIRT683313 C19orf40 chromosome 19 open reading frame 40 1 1
MIRT683382 ESR2 estrogen receptor 2 (ER beta) 1 1
MIRT683488 ZNF7 zinc finger protein 7 1 1
MIRT683620 PCP4L1 Purkinje cell protein 4 like 1 1 1
MIRT683685 MICA MHC class I polypeptide-related sequence A 1 1
MIRT683867 OCIAD1 OCIA domain containing 1 1 1
MIRT683940 MYLK3 myosin light chain kinase 3 1 1
MIRT683971 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT684076 TLR7 toll-like receptor 7 1 1
MIRT684128 CEP104 centrosomal protein 104kDa 1 1
MIRT684354 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT684487 GPR137B G protein-coupled receptor 137B 1 1
MIRT684568 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT684611 GTF2IRD2B GTF2I repeat domain containing 2B 1 1
MIRT684706 LRRD1 leucine-rich repeats and death domain containing 1 1 1
MIRT684738 DNAJB13 DnaJ (Hsp40) homolog, subfamily B, member 13 1 1
MIRT684780 MYO1F myosin IF 1 1
MIRT684914 CD28 CD28 molecule 1 1
MIRT685191 DCTN5 dynactin 5 (p25) 1 1
MIRT685240 F2RL1 coagulation factor II (thrombin) receptor-like 1 1 1
MIRT685309 ASB16 ankyrin repeat and SOCS box containing 16 1 1
MIRT685346 CCL5 chemokine (C-C motif) ligand 5 1 1
MIRT685517 MSH3 mutS homolog 3 (E. coli) 1 1
MIRT685542 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 1
MIRT685572 KCNK6 potassium channel, subfamily K, member 6 1 1
MIRT685628 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT685656 C11orf1 chromosome 11 open reading frame 1 1 1
MIRT685704 BHMT2 betaine--homocysteine S-methyltransferase 2 1 1
MIRT685735 C12orf65 chromosome 12 open reading frame 65 1 1
MIRT685777 ZNF426 zinc finger protein 426 1 1
MIRT685877 RTN2 reticulon 2 1 1
MIRT685948 PTGIS prostaglandin I2 (prostacyclin) synthase 1 1
MIRT686101 TNIP3 TNFAIP3 interacting protein 3 1 1
MIRT686150 HS3ST1 heparan sulfate (glucosamine) 3-O-sulfotransferase 1 1 1
MIRT686279 WWC1 WW and C2 domain containing 1 1 1
MIRT686314 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT686357 USP15 ubiquitin specific peptidase 15 1 1
MIRT686386 UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT686437 LINC00598 long intergenic non-protein coding RNA 598 1 1
MIRT686486 TRIOBP TRIO and F-actin binding protein 1 1
MIRT686521 TRAF3IP2 TRAF3 interacting protein 2 1 1
MIRT686690 TIMM10 translocase of inner mitochondrial membrane 10 homolog (yeast) 1 1
MIRT686910 SGTB small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta 1 1
MIRT686978 SERINC1 serine incorporator 1 1 1
MIRT687039 RNF115 ring finger protein 115 1 1
MIRT687073 RABGAP1L RAB GTPase activating protein 1-like 1 1
MIRT687248 PDHB pyruvate dehydrogenase (lipoamide) beta 1 1
MIRT687398 NSUN4 NOP2/Sun domain family, member 4 1 1
MIRT687854 ISCA2 iron-sulfur cluster assembly 2 homolog (S. cerevisiae) 1 1
MIRT687925 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT687977 GTF2IRD2 GTF2I repeat domain containing 2 1 1
MIRT688108 GK5 glycerol kinase 5 (putative) 1 1
MIRT688119 GEMIN8 gem (nuclear organelle) associated protein 8 1 1
MIRT688268 FAM213A family with sequence similarity 213, member A 1 1
MIRT688462 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT688501 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT688631 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2 1 1
MIRT688674 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
MIRT689120 ZBTB25 zinc finger and BTB domain containing 25 1 1
MIRT689168 ZNF665 zinc finger protein 665 1 1
MIRT689793 GTF2H3 general transcription factor IIH, polypeptide 3, 34kDa 1 1
MIRT689840 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT690734 IRAK4 interleukin-1 receptor-associated kinase 4 1 1
MIRT690980 ZNF578 zinc finger protein 578 1 1
MIRT691071 NUGGC nuclear GTPase, germinal center associated 1 1
MIRT691326 KIAA1841 KIAA1841 1 1
MIRT691490 FOXRED2 FAD-dependent oxidoreductase domain containing 2 1 1
MIRT691573 CCDC125 coiled-coil domain containing 125 1 1
MIRT691649 SLC43A3 solute carrier family 43, member 3 1 1
MIRT691855 OSCAR osteoclast associated, immunoglobulin-like receptor 1 1
MIRT692064 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT692207 NOL9 nucleolar protein 9 1 1
MIRT692317 RFK riboflavin kinase 1 1
MIRT692378 LY6G5B lymphocyte antigen 6 complex, locus G5B 1 1
MIRT692439 METTL8 methyltransferase like 8 1 1
MIRT692474 APEX2 APEX nuclease (apurinic/apyrimidinic endonuclease) 2 1 1
MIRT692540 PARD3 par-3 partitioning defective 3 homolog (C. elegans) 1 1
MIRT692602 GDF5OS growth differentiation factor 5 opposite strand 1 1
MIRT692784 SYNPO2L synaptopodin 2-like 1 1
MIRT692814 C1orf50 chromosome 1 open reading frame 50 1 1
MIRT692875 RBM41 RNA binding motif protein 41 1 1
MIRT692986 LGSN lengsin, lens protein with glutamine synthetase domain 1 1
MIRT693348 RNF34 ring finger protein 34, E3 ubiquitin protein ligase 1 1
MIRT694052 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT694094 KIAA0930 KIAA0930 1 1
MIRT694192 ZNF347 zinc finger protein 347 1 1
MIRT694659 C14orf119 chromosome 14 open reading frame 119 1 1
MIRT694813 STX4 syntaxin 4 1 1
MIRT694933 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 1 1
MIRT695179 SLC25A33 solute carrier family 25 (pyrimidine nucleotide carrier), member 33 1 1
MIRT695608 GATAD1 GATA zinc finger domain containing 1 1 1
MIRT695659 MAN2B2 mannosidase, alpha, class 2B, member 2 1 1
MIRT695830 ABCG8 ATP-binding cassette, sub-family G (WHITE), member 8 1 1
MIRT695971 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT696182 GNB5 guanine nucleotide binding protein (G protein), beta 5 1 1
MIRT696332 FAM153B family with sequence similarity 153, member B 1 1
MIRT696859 UBOX5 U-box domain containing 5 1 1
MIRT696901 C14orf105 chromosome 14 open reading frame 105 1 1
MIRT697390 ZMAT3 zinc finger, matrin-type 3 1 1
MIRT698329 TMEM127 transmembrane protein 127 1 1
MIRT698927 SPEM1 spermatid maturation 1 1 1
MIRT699263 SLC6A4 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 1 1
MIRT699316 SLC35F5 solute carrier family 35, member F5 1 2
MIRT699630 SH3BP5 SH3-domain binding protein 5 (BTK-associated) 1 1
MIRT699695 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT699822 SCN2B sodium channel, voltage-gated, type II, beta subunit 1 1
MIRT700045 RPL14 ribosomal protein L14 1 1
MIRT700102 RNF19B ring finger protein 19B 1 1
MIRT700507 PTPN4 protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 1 1
MIRT700753 PLAA phospholipase A2-activating protein 1 1
MIRT700842 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT700855 PERP PERP, TP53 apoptosis effector 1 1
MIRT701294 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT701826 MRPL37 mitochondrial ribosomal protein L37 1 1
MIRT702439 KIAA1549 KIAA1549 1 1
MIRT702523 KCND3 potassium voltage-gated channel, Shal-related subfamily, member 3 1 1
MIRT703037 HAS2 hyaluronan synthase 2 1 2
MIRT703090 GPRIN3 GPRIN family member 3 1 1
MIRT704110 DRAXIN dorsal inhibitory axon guidance protein 1 1
MIRT704145 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT704195 LDHD lactate dehydrogenase D 1 1
MIRT704761 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT705082 C4orf29 chromosome 4 open reading frame 29 1 1
MIRT705348 ATP1B3 ATPase, Na+/K+ transporting, beta 3 polypeptide 1 1
MIRT705735 AMFR autocrine motility factor receptor, E3 ubiquitin protein ligase 1 1
MIRT706025 ZSCAN2 zinc finger and SCAN domain containing 2 1 1
MIRT706041 F2R coagulation factor II (thrombin) receptor 1 1
MIRT706106 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT706348 STAC2 SH3 and cysteine rich domain 2 1 1
MIRT706514 MTMR9 myotubularin related protein 9 1 1
MIRT708367 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT708448 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 1 1
MIRT709072 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT709505 RHOH ras homolog family member H 1 1
MIRT709537 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT709794 CYBRD1 cytochrome b reductase 1 1 1
MIRT710279 FGF1 fibroblast growth factor 1 (acidic) 1 1
MIRT711685 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT711853 AMOTL2 angiomotin like 2 1 1
MIRT714307 ZNF454 zinc finger protein 454 1 1
MIRT714762 ZNF462 zinc finger protein 462 1 1
MIRT715553 FBXL17 F-box and leucine-rich repeat protein 17 1 1
MIRT715798 TBL3 transducin (beta)-like 3 1 1
MIRT716542 GOLGA2 golgin A2 1 1
MIRT716627 CRCP CGRP receptor component 1 1
MIRT716912 CACNB2 calcium channel, voltage-dependent, beta 2 subunit 1 1
MIRT717490 ADRB1 adrenoceptor beta 1 1 1
MIRT718018 JPH1 junctophilin 1 1 1
MIRT718565 CHORDC1 cysteine and histidine-rich domain (CHORD) containing 1 1 1
MIRT718582 ARL4D ADP-ribosylation factor-like 4D 1 1
MIRT719071 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
MIRT719100 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 1 1
MIRT721115 CD109 CD109 molecule 1 1
MIRT721219 DCLK3 doublecortin-like kinase 3 1 1
MIRT722114 RPS6KA1 ribosomal protein S6 kinase, 90kDa, polypeptide 1 1 1
MIRT723576 SWAP70 SWAP switching B-cell complex 70kDa subunit 1 1
MIRT723733 ZHX3 zinc fingers and homeoboxes 3 1 1
MIRT724004 TMEM174 transmembrane protein 174 1 1
MIRT724550 HAUS2 HAUS augmin-like complex, subunit 2 1 1
MIRT724666 NCAN neurocan 1 1
MIRT724840 ATAD2B ATPase family, AAA domain containing 2B 1 1
MIRT725508 FUT9 fucosyltransferase 9 (alpha (1,3) fucosyltransferase) 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*