Accession ID: MIRT038883 [miRNA, hsa-miR-93-3p :: ADSL, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-93LinkOut: [miRBase ]
Synonyms MIRN9, MIRN93, hsa-mir-93, miR-93, MIR93
Description Homo sapiens miR-93 stem-loop
Comment Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-93-7.1 and mir-93-7.2 . The 5' end of the miRNA may be offset with respect to previous annotations.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-93-3p
Mature Sequence 50| ACUGCUGAGCUAGCACUUCCCG |71
Evidence Experimental
Experiments Cloned
Putative hsa-miR-93-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ADSL LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AMPS, ASASE, ASL
Description adenylosuccinate lyase
Transcript NM_0000    LinkOut: [ RefSeq ]
Other Transcripts NM_0011233   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ADSL LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ADSL
(miRNA target sites are highlighted)
>ADSL|NM_0000|3'UTR
   1 TAGAGTTGGAAGAGAATTAAACGAAAATCATTGTTAATTGCTGAGGCATGAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gcccuucacgAUC-GAGUCGUCa 5'
                    |||  |::| || 
Target 5' ----------TAGAGTTGGAAGa 3'
1 - 13 80.00 -6.40
2
miRNA  3' gcccuUCACGAU---CGAGU-CGUca 5'
               | ||:||   ||| | |||  
Target 5' aaatcATTGTTAATTGCTGAGGCAtg 3'
25 - 50 77.00 -5.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-93-3p :: ADSL    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gcccTTCACGATCGAGTCGTCa 5'
              :||||||  |||||||| 
Target 5' ---aGAGTGCTTTCTCAGCAGg 3'
1 - 19
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
197 hsa-miR-93-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038718 MYPOP Myb-related transcription factor, partner of profilin 1 1
MIRT038719 SLC25A23 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 1 1
MIRT038720 GSG2 germ cell associated 2 (haspin) 1 1
MIRT038721 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT038722 ENO2 enolase 2 (gamma, neuronal) 1 1
MIRT038723 SEL1L3 sel-1 suppressor of lin-12-like 3 (C. elegans) 1 1
MIRT038724 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT038725 CSAG1 chondrosarcoma associated gene 1 1 1
MIRT038726 MCM3 minichromosome maintenance complex component 3 1 1
MIRT038727 BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 1 1
MIRT038728 FKBP3 FK506 binding protein 3, 25kDa 1 1
MIRT038729 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT038730 SMC1A structural maintenance of chromosomes 1A 1 1
MIRT038731 RPL5 ribosomal protein L5 1 1
MIRT038732 C1orf21 chromosome 1 open reading frame 21 1 1
MIRT038733 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT038734 GANAB glucosidase, alpha; neutral AB 1 1
MIRT038735 INPP5D inositol polyphosphate-5-phosphatase, 145kDa 1 1
MIRT038736 EIF4ENIF1 eukaryotic translation initiation factor 4E nuclear import factor 1 1 1
MIRT038737 GPR162 G protein-coupled receptor 162 1 1
MIRT038738 SCN1A sodium channel, voltage-gated, type I, alpha subunit 1 1
MIRT038739 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT038740 TULP3 tubby like protein 3 1 1
MIRT038741 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT038742 NASP nuclear autoantigenic sperm protein (histone-binding) 1 1
MIRT038743 AAGAB alpha- and gamma-adaptin binding protein 1 1
MIRT038744 FUK fucokinase 1 1
MIRT038745 FKBP5 FK506 binding protein 5 1 1
MIRT038746 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT038747 SUFU suppressor of fused homolog (Drosophila) 1 1
MIRT038748 OTUB1 OTU domain, ubiquitin aldehyde binding 1 1 1
MIRT038749 UBA2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT038750 MCM7 minichromosome maintenance complex component 7 1 1
MIRT038751 ENAH enabled homolog (Drosophila) 1 1
MIRT038752 OXA1L oxidase (cytochrome c) assembly 1-like 1 1
MIRT038753 RUNDC3B RUN domain containing 3B 1 1
MIRT038754 ZNF44 zinc finger protein 44 1 1
MIRT038755 KIAA1549L chromosome 11 open reading frame 41 1 1
MIRT038756 CUL2 cullin 2 1 1
MIRT038757 LAMA4 laminin, alpha 4 1 1
MIRT038758 RRP12 ribosomal RNA processing 12 homolog (S. cerevisiae) 1 1
MIRT038759 ARHGEF33 Rho guanine nucleotide exchange factor (GEF) 33 1 1
MIRT038760 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT038761 FDXACB1 ferredoxin-fold anticodon binding domain containing 1 1 1
MIRT038762 TLK2 tousled-like kinase 2 1 1
MIRT038763 FAM120A family with sequence similarity 120A 1 1
MIRT038764 PPP1R13B protein phosphatase 1, regulatory (inhibitor) subunit 13B 1 1
MIRT038765 PAMR1 peptidase domain containing associated with muscle regeneration 1 1 1
MIRT038766 TIAM1 T-cell lymphoma invasion and metastasis 1 1 1
MIRT038767 DOCK5 dedicator of cytokinesis 5 1 1
MIRT038768 ACTN1 actinin, alpha 1 1 1
MIRT038769 DHX9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 1 1
MIRT038770 EXOC4 exocyst complex component 4 1 1
MIRT038771 PARP1 poly (ADP-ribose) polymerase 1 1 1
MIRT038772 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT038773 SC5D sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S. cerevisiae)-like 1 1
MIRT038774 CENPF centromere protein F, 350/400ka (mitosin) 1 1
MIRT038775 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 1
MIRT038776 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT038777 HEYL hairy/enhancer-of-split related with YRPW motif-like 1 1
MIRT038778 TESK2 testis-specific kinase 2 1 1
MIRT038779 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT038780 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT038781 ACTB actin, beta 1 1
MIRT038782 TPD52L2 tumor protein D52-like 2 1 1
MIRT038783 EPHB4 EPH receptor B4 1 1
MIRT038784 KLHDC3 kelch domain containing 3 1 1
MIRT038785 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT038786 CTC1 chromosome 17 open reading frame 68 1 1
MIRT038787 CYCS cytochrome c, somatic 1 1
MIRT038788 MAP2K1 mitogen-activated protein kinase kinase 1 1 1
MIRT038789 C1QBP complement component 1, q subcomponent binding protein 1 1
MIRT038790 THUMPD3 THUMP domain containing 3 1 1
MIRT038791 GCAT glycine C-acetyltransferase 1 1
MIRT038792 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT038793 PPP1R12A protein phosphatase 1, regulatory (inhibitor) subunit 12A 1 1
MIRT038794 UTP14C UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) 1 1
MIRT038795 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT038796 DHFR dihydrofolate reductase 1 1
MIRT038797 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT038798 LRRC34 leucine rich repeat containing 34 1 1
MIRT038799 HMMR hyaluronan-mediated motility receptor (RHAMM) 1 1
MIRT038800 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT038801 MYCBP c-myc binding protein 1 1
MIRT038802 GLUD1 glutamate dehydrogenase 1 1 1
MIRT038803 HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 1 1
MIRT038804 TARDBP TAR DNA binding protein 1 1
MIRT038805 SPTAN1 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) 1 1
MIRT038806 CTTNBP2NL CTTNBP2 N-terminal like 1 1
MIRT038807 ATAD5 ATPase family, AAA domain containing 5 1 1
MIRT038808 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT038809 EIF1AD eukaryotic translation initiation factor 1A domain containing 1 1
MIRT038810 SCAP SREBF chaperone 1 1
MIRT038811 STAT5B signal transducer and activator of transcription 5B 1 1
MIRT038812 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT038813 CASP2 caspase 2, apoptosis-related cysteine peptidase 1 1
MIRT038814 ANAPC7 anaphase promoting complex subunit 7 1 1
MIRT038815 FAM50A family with sequence similarity 50, member A 1 1
MIRT038816 MON1B MON1 homolog B (yeast) 1 1
MIRT038817 RAB34 RAB34, member RAS oncogene family 1 1
MIRT038818 KANSL3 KIAA1310 1 1
MIRT038819 NUP62 nucleoporin 62kDa 1 1
MIRT038820 LRP3 low density lipoprotein receptor-related protein 3 1 1
MIRT038821 TRIO triple functional domain (PTPRF interacting) 1 1
MIRT038822 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT038823 ARFGAP3 ADP-ribosylation factor GTPase activating protein 3 1 1
MIRT038824 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT038825 TMEM194A transmembrane protein 194A 1 1
MIRT038826 ZNFX1 zinc finger, NFX1-type containing 1 1 1
MIRT038827 SLC35A4 solute carrier family 35, member A4 1 1
MIRT038828 MTSS1L metastasis suppressor 1-like 1 1
MIRT038829 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT038830 H3F3B H3 histone, family 3B (H3.3B) 1 1
MIRT038831 FAM98A family with sequence similarity 98, member A 1 1
MIRT038832 UNC45A unc-45 homolog A (C. elegans) 1 1
MIRT038833 RBM15B RNA binding motif protein 15B 1 1
MIRT038834 USF1 upstream transcription factor 1 1 1
MIRT038835 FAR1 fatty acyl CoA reductase 1 1 1
MIRT038836 PDS5A PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) 1 1
MIRT038837 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 1 1
MIRT038838 SCRIB scribbled homolog (Drosophila) 1 1
MIRT038839 VARS valyl-tRNA synthetase 1 1
MIRT038840 TEX261 testis expressed 261 1 1
MIRT038841 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT038842 FAM193B family with sequence similarity 193, member B 1 1
MIRT038843 SUCLA2 succinate-CoA ligase, ADP-forming, beta subunit 1 1
MIRT038844 JMJD8 jumonji domain containing 8 1 1
MIRT038845 NCOA4 nuclear receptor coactivator 4 1 1
MIRT038846 KIAA1147 KIAA1147 1 1
MIRT038847 CCNY cyclin Y 1 1
MIRT038848 HSPA5 heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) 1 1
MIRT038849 TAGLN2 transgelin 2 1 1
MIRT038850 ACLY ATP citrate lyase 1 1
MIRT038851 PUF60 poly-U binding splicing factor 60KDa 1 1
MIRT038852 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 1
MIRT038853 DIDO1 death inducer-obliterator 1 1 1
MIRT038854 IKBKAP inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein 1 1
MIRT038855 MAFG v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) 1 1
MIRT038856 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT038857 ANKRD27 ankyrin repeat domain 27 (VPS9 domain) 1 1
MIRT038858 ZNF703 zinc finger protein 703 1 1
MIRT038859 HYOU1 hypoxia up-regulated 1 1 1
MIRT038860 DMTN erythrocyte membrane protein band 4.9 (dematin) 1 1
MIRT038861 PRRC2A HLA-B associated transcript 2 1 1
MIRT038862 SF3B2 splicing factor 3b, subunit 2, 145kDa 1 1
MIRT038863 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT038864 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 1
MIRT038865 RAB13 RAB13, member RAS oncogene family 1 1
MIRT038866 ALS2 amyotrophic lateral sclerosis 2 (juvenile) 1 1
MIRT038867 FAM89B family with sequence similarity 89, member B 1 1
MIRT038868 ADRM1 adhesion regulating molecule 1 1 1
MIRT038869 POMGNT1 protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase 1 1
MIRT038870 CDC20 cell division cycle 20 homolog (S. cerevisiae) 1 1
MIRT038871 MRPL49 mitochondrial ribosomal protein L49 1 1
MIRT038872 DMWD dystrophia myotonica, WD repeat containing 1 1
MIRT038873 DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 1 1
MIRT038874 WASH3P WAS protein family homolog 3 pseudogene 1 1
MIRT038875 WDR77 WD repeat domain 77 1 1
MIRT038876 IFT140 intraflagellar transport 140 homolog (Chlamydomonas) 1 1
MIRT038877 GOT2 glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) 1 1
MIRT038878 TRIM28 tripartite motif-containing 28 1 1
MIRT038879 KIAA1671 KIAA1671 1 1
MIRT038880 PFDN2 prefoldin subunit 2 1 1
MIRT038881 QTRTD1 queuine tRNA-ribosyltransferase domain containing 1 1 1
MIRT038882 CCDC22 coiled-coil domain containing 22 1 1
MIRT038883 ADSL adenylosuccinate lyase 1 1
MIRT038884 PSMD13 proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 1 1
MIRT038885 DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 1 1
MIRT038886 MAPRE1 microtubule-associated protein, RP/EB family, member 1 1 1
MIRT038887 LRRC41 leucine rich repeat containing 41 1 1
MIRT038888 ACSL1 acyl-CoA synthetase long-chain family member 1 1 1
MIRT038889 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT038890 LRBA LPS-responsive vesicle trafficking, beach and anchor containing 1 1
MIRT038891 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT038892 NCSTN nicastrin 1 1
MIRT038893 ATIC 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase 1 1
MIRT038894 SIN3A SIN3 homolog A, transcription regulator (yeast) 1 1
MIRT038895 EIF2AK1 eukaryotic translation initiation factor 2-alpha kinase 1 1 1
MIRT038896 NFKBIL1 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1 1 1
MIRT038897 CBR1 carbonyl reductase 1 1 1
MIRT038898 UBE2R2 ubiquitin-conjugating enzyme E2R 2 1 1
MIRT038899 HACL1 2-hydroxyacyl-CoA lyase 1 1 1
MIRT038900 PARD3 par-3 partitioning defective 3 homolog (C. elegans) 1 1
MIRT038901 ABR active BCR-related gene 1 1
MIRT038902 ITPRIP inositol 1,4,5-triphosphate receptor interacting protein 1 1
MIRT038903 PITRM1 pitrilysin metallopeptidase 1 1 1
MIRT038904 NUP160 nucleoporin 160kDa 1 1
MIRT038905 UBAP2L ubiquitin associated protein 2-like 1 1
MIRT038906 EEF1D eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) 1 1
MIRT038907 SURF4 surfeit 4 1 1
MIRT038908 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT038909 ARFGAP1 ADP-ribosylation factor GTPase activating protein 1 1 1
MIRT038910 FYN FYN oncogene related to SRC, FGR, YES 1 1
MIRT038911 PLEKHG4 pleckstrin homology domain containing, family G (with RhoGef domain) member 4 1 1
MIRT038912 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT038913 TMEM42 transmembrane protein 42 1 1
MIRT038914 DAZAP1 DAZ associated protein 1 1 1