Accession ID: MIRT038926 [miRNA, hsa-miR-92a-1-5p :: RAD51, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-92a-1LinkOut: [miRBase ]
Synonyms MIR92-1, MIRN92-1, MIRN92A-1, MIRN92A1, miRNA92-1, MIR92A1
Description Homo sapiens miR-92a-1 stem-loop
Comment Human miR-92a (previously named miR-92 here) has two predicted hairpin precursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (named mir-92-13 in .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-92a-1-5p
Mature Sequence 11| AGGUUGGGAUCGGUUGCAAUGCU |33
Evidence Experimental
Experiments Cloned
Putative hsa-miR-92a-1-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol RAD51 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BRCC5, HRAD51, HsRad51, HsT16930, MRMV2, RAD51A, RECA
Description RAD51 homolog (S. cerevisiae)
Transcript NM_001164270    LinkOut: [ RefSeq ]
Other Transcripts NM_002875   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on RAD51 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of RAD51
(miRNA target sites are highlighted)
>RAD51|NM_001164270|3'UTR
   1 AACCAGAATCTGCAAAATCTACGACTCTCCCTGTCTTCCTGAAGCTGAAGCTATGTTCGCCATTAATGCAGATGGAGTGG
  81 GAGATGCCAAAGACTGAATCATTGGGTTTTTCCTCTGTTAAAAACCTTAAGTGCTGCAGCCTAATGAGAGTGCACTGCTC
 161 CCTGGGGTTCTCTACAGGCCTCTTCCTGTTGTGACTGCCAGGATAAAGCTTCCGGGAAAACAGCTATTATATCAGCTTTT
 241 CTGATGGTATAAACAGGAGACAGGTCAGTAGTCACAAACTGATCTAAAATGTTTATTCCTTCTGTAGTGTATTAATCTCT
 321 GTGTGTTTTCTTTGGTTTTGGAGGAGGGGTATGAAGTATCTTTGACATGGTGCCTTAGGAATGACTTGGGTTTAACAAGC
 401 TGTCTACTGGACAATCTTATGTTTCCAAGAGAACTAAAGCTGGAGAGACCTGACCCTTCTCTCACTTCTAAATTAATGGT
 481 AAAATAAAATGCCTCAGCTATGTAGCAAAGGGAATGGGTCTGCACAGATTCTTTTTTTCTGTCAGTAAAACTCTCAAGCA
 561 GGTTTTTAAGTTGTCTGTCTGAATGATCTTGTGTAAGGTTTTGGTTATGGAGTCTTGTGCCAAACCTACTAGGCCATTAG
 641 CCCTTCACCATCTACCTGCTTGGTCTTTCATTGCTAAGACTAACTCAAGATAATCCTAGAGTCTTAAAGCATTTCAGGCC
 721 AGTGTGGTGTCTTGCGCCTGTACTCCCAGCACTTTGGGAGGCCGAGGCAGGTGGATCGCTTGAGCCCAGGAGTTTTAAGT
 801 CCAGCTTGGCCAAGGTGGTGAAATCCCATCTCTACAAAAAATGCAGAACTTAATCTGGACACACTGTTACACGTGCCTGT
 881 AGTCCCAGCTACTCGATAGCCTGAGGTGGGAGAATCACTTAAGCCTGGAAGGTGGAAGTTGCAGTGAGTCGAGATTGCAC
 961 TGCTGCATTCCAGCCAGGGTGACAGAGTGAGACCATGTTTCAAACAAGAAACATTTCAGAGGGTAAGTAAACAGATTTGA
1041 TTGTGAGGCTTCTAATAAAGTAGTTATTAGTAGTGAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucgUAACGU--UGGC-UAGGGUUGGa 5'
             ||||||  :|:| ||:|||:|| 
Target 5' gagATTGCACTGCTGCATTCCAGCCa 3'
951 - 976 142.00 -20.10
2
miRNA  3' ucguAACGUUGGC-U-AGGGUUGga 5'
              ||||: |:| | |||||:|  
Target 5' tgtcTTGCGCCTGTACTCCCAGCac 3'
728 - 752 127.00 -18.00
3
miRNA  3' ucguaACGUUGGC--UAGGGUUGGa 5'
               |||  |:|  :|||||:|: 
Target 5' acacgTGC--CTGTAGTCCCAGCTa 3'
869 - 891 120.00 -14.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-92a-1-5p :: RAD51    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' tcgtaACGTTGGCTAGGGTTgga 5'
               ||| :|:||||||||   
Target 5' -----TGCTGCTGATCCCAAaaa 3'
1 - 18
2
miRNA  3' tcGTAACGT------TGGCTA--GGGTtgga 5'
            :|||| |      |:| ||  ||||    
Target 5' ccTATTGGAGGAAATATC-ATCGCCCAt--- 3'
20 - 46
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
65 hsa-miR-92a-1-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038915 IQSEC1 IQ motif and Sec7 domain 1 1 1
MIRT038916 ZWINT ZW10 interactor 1 1
MIRT038917 RPL29 ribosomal protein L29 1 1
MIRT038918 GTPBP4 GTP binding protein 4 1 1
MIRT038919 TUBB tubulin, beta class I 1 1
MIRT038920 PLK1 polo-like kinase 1 1 1
MIRT038921 SLC2A4 solute carrier family 2 (facilitated glucose transporter), member 4 1 1
MIRT038922 MRPS11 mitochondrial ribosomal protein S11 1 1
MIRT038923 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT038924 MBLAC2 metallo-beta-lactamase domain containing 2 1 1
MIRT038925 UBB ubiquitin B 1 1
MIRT038926 RAD51 RAD51 homolog (S. cerevisiae) 1 1
MIRT054145 PTEN phosphatase and tensin homolog 2 1
MIRT054146 CISH cytokine inducible SH2-containing protein 2 1
MIRT100690 TJAP1 tight junction associated protein 1 (peripheral) 1 1
MIRT115512 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT299542 HOXD13 homeobox D13 1 2
MIRT330244 ARL5B ADP-ribosylation factor-like 5B 1 2
MIRT333529 HDGF hepatoma-derived growth factor 1 1
MIRT348351 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT438785 FAS Fas (TNF receptor superfamily, member 6) 1 1
MIRT438790 TP53 tumor protein p53 1 1
MIRT438798 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 1 1
MIRT451537 CIAPIN1 cytokine induced apoptosis inhibitor 1 1 1
MIRT457658 SERINC1 serine incorporator 1 1 1
MIRT460875 UBE2S ubiquitin-conjugating enzyme E2S 1 1
MIRT466230 TMED10 transmembrane emp24-like trafficking protein 10 (yeast) 1 1
MIRT468433 SETD1B SET domain containing 1B 1 1
MIRT469983 PTPN14 protein tyrosine phosphatase, non-receptor type 14 1 1
MIRT470308 PPP6R1 protein phosphatase 6, regulatory subunit 1 1 1
MIRT470702 POGK pogo transposable element with KRAB domain 1 1
MIRT473597 MARK2 MAP/microtubule affinity-regulating kinase 2 1 1
MIRT477943 DPM2 dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit 1 1
MIRT482331 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT482881 CACNA2D3 calcium channel, voltage-dependent, alpha 2/delta subunit 3 1 1
MIRT482970 CSTF2 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa 1 1
MIRT483835 UNC5B unc-5 homolog B (C. elegans) 1 2
MIRT486974 STEAP3 STEAP family member 3, metalloreductase 1 2
MIRT494558 BAK1 BCL2-antagonist/killer 1 1 1
MIRT519879 ZFP30 zinc finger protein 30 homolog (mouse) 1 2
MIRT521679 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 1
MIRT522286 NKAP NFKB activating protein 1 1
MIRT523215 HIST1H3D histone cluster 1, H3d 1 1
MIRT528074 KRTAP4-2 keratin associated protein 4-2 1 1
MIRT529155 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 1 1
MIRT543160 GTF2A1 general transcription factor IIA, 1, 19/37kDa 1 1
MIRT557360 HAND1 heart and neural crest derivatives expressed 1 1 1
MIRT561723 PPP2CA protein phosphatase 2, catalytic subunit, alpha isozyme 1 1
MIRT566022 RFX1 regulatory factor X, 1 (influences HLA class II expression) 1 1
MIRT572872 OPHN1 oligophrenin 1 1 1
MIRT574604 LZIC leucine zipper and CTNNBIP1 domain containing 1 1
MIRT644526 TMEM134 transmembrane protein 134 1 1
MIRT665700 TNFRSF12A tumor necrosis factor receptor superfamily, member 12A 1 1
MIRT666858 PPP1R12B protein phosphatase 1, regulatory subunit 12B 1 1
MIRT670115 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT688985 ATP6AP1 ATPase, H+ transporting, lysosomal accessory protein 1 1 1
MIRT695212 SCAMP3 secretory carrier membrane protein 3 1 1
MIRT705949 ACY1 aminoacylase 1 1 1
MIRT705989 ABHD14A-ACY1 ABHD14A-ACY1 readthrough (non-protein coding) 1 1
MIRT710147 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like 1 1
MIRT710368 CREB5 cAMP responsive element binding protein 5 1 1
MIRT710851 FAM210A family with sequence similarity 210, member A 1 1
MIRT711330 DPYSL5 dihydropyrimidinase-like 5 1 1
MIRT711557 FAM20B family with sequence similarity 20, member B 1 1
MIRT719803 STARD8 StAR-related lipid transfer (START) domain containing 8 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*