Accession ID: MIRT038926 [miRNA, hsa-miR-92a-1-5p :: RAD51, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-92a-1LinkOut: [miRBase ]
Synonyms MIR92-1, MIRN92-1, MIRN92A-1, MIRN92A1, miRNA92-1, MIR92A1
Description Homo sapiens miR-92a-1 stem-loop
Comment Human miR-92a (previously named miR-92 here) has two predicted hairpin precursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (named mir-92-13 in .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-92a-1-5p
Mature Sequence 11| AGGUUGGGAUCGGUUGCAAUGCU |33
Evidence Experimental
Experiments Cloned
Putative hsa-miR-92a-1-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol RAD51 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BRCC5, HRAD51, HsRad51, HsT16930, RAD51A, RECA
Description RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)
Transcript NM_0011642    LinkOut: [ RefSeq ]
Other Transcripts NM_0011642 , NM_0028 , NM_1334   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on RAD51 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of RAD51
(miRNA target sites are highlighted)
>RAD51|NM_0011642|3'UTR
   1 AACCAGAATCTGCAAAATCTACGACTCTCCCTGTCTTCCTGAAGCTGAAGCTATGTTCGCCATTAATGCAGATGGAGTGG
  81 GAGATGCCAAAGACTGAATCATTGGGTTTTTCCTCTGTTAAAAACCTTAAGTGCTGCAGCCTAATGAGAGTGCACTGCTC
 161 CCTGGGGTTCTCTACAGGCCTCTTCCTGTTGTGACTGCCAGGATAAAGCTTCCGGGAAAACAGCTATTATATCAGCTTTT
 241 CTGATGGTATAAACAGGAGACAGGTCAGTAGTCACAAACTGATCTAAAATGTTTATTCCTTCTGTAGTGTATTAATCTCT
 321 GTGTGTTTTCTTTGGTTTTGGAGGAGGGGTATGAAGTATCTTTGACATGGTGCCTTAGGAATGACTTGGGTTTAACAAGC
 401 TGTCTACTGGACAATCTTATGTTTCCAAGAGAACTAAAGCTGGAGAGACCTGACCCTTCTCTCACTTCTAAATTAATGGT
 481 AAAATAAAATGCCTCAGCTATGTAGCAAAGGGAATGGGTCTGCACAGATTCTTTTTTTCTGTCAGTAAAACTCTCAAGCA
 561 GGTTTTTAAGTTGTCTGTCTGAATGATCTTGTGTAAGGTTTTGGTTATGGAGTCTTGTGCCAAACCTACTAGGCCATTAG
 641 CCCTTCACCATCTACCTGCTTGGTCTTTCATTGCTAAGACTAACTCAAGATAATCCTAGAGTCTTAAAGCATTTCAGGCC
 721 AGTGTGGTGTCTTGCGCCTGTACTCCCAGCACTTTGGGAGGCCGAGGCAGGTGGATCGCTTGAGCCCAGGAGTTTTAAGT
 801 CCAGCTTGGCCAAGGTGGTGAAATCCCATCTCTACAAAAAATGCAGAACTTAATCTGGACACACTGTTACACGTGCCTGT
 881 AGTCCCAGCTACTCGATAGCCTGAGGTGGGAGAATCACTTAAGCCTGGAAGGTGGAAGTTGCAGTGAGTCGAGATTGCAC
 961 TGCTGCATTCCAGCCAGGGTGACAGAGTGAGACCATGTTTCAAACAAGAAACATTTCAGAGGGTAAGTAAACAGATTTGA
1041 TTGTGAGGCTTCTAATAAAGTAGTTATTAGTAGTGAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucgUAACGU--UGGC-UAGGGUUGGa 5'
             ||||||  :|:| ||:|||:|| 
Target 5' gagATTGCACTGCTGCATTCCAGCCa 3'
951 - 976 142.00 -20.10
2
miRNA  3' ucguAACGUUGGC-U-AGGGUUGga 5'
              ||||: |:| | |||||:|  
Target 5' tgtcTTGCGCCTGTACTCCCAGCac 3'
728 - 752 127.00 -18.00
3
miRNA  3' ucguaACGUUGGC--UAGGGUUGGa 5'
               |||  |:|  :|||||:|: 
Target 5' acacgTGC--CTGTAGTCCCAGCTa 3'
869 - 891 120.00 -14.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-92a-1-5p :: RAD51    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' tcgtaACGTTGGCTAGGGTTgga 5'
               ||| :|:||||||||   
Target 5' -----TGCTGCTGATCCCAAaaa 3'
1 - 18
2
miRNA  3' tcGTAACGT------TGGCTA--GGGTtgga 5'
            :|||| |      |:| ||  ||||    
Target 5' ccTATTGGAGGAAATATC-ATCGCCCAt--- 3'
20 - 46
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
12 hsa-miR-92a-1-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038915 IQSEC1 IQ motif and Sec7 domain 1 1 1
MIRT038916 ZWINT ZW10 interactor 1 1
MIRT038917 RPL29 ribosomal protein L29 1 1
MIRT038918 GTPBP4 GTP binding protein 4 1 1
MIRT038919 TUBB tubulin, beta 1 1
MIRT038920 PLK1 polo-like kinase 1 (Drosophila) 1 1
MIRT038921 SLC2A4 solute carrier family 2 (facilitated glucose transporter), member 4 1 1
MIRT038922 MRPS11 mitochondrial ribosomal protein S11 1 1
MIRT038923 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT038924 MBLAC2 metallo-beta-lactamase domain containing 2 1 1
MIRT038925 UBB ubiquitin B 1 1
MIRT038926 RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) 1 1