Accession ID: MIRT039024 [miRNA, hsa-miR-766-3p :: LDHB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-766LinkOut: [miRBase ]
Synonyms MIRN766, hsa-mir-766, MIR766
Description Homo sapiens miR-766 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-766-3p
Mature Sequence 65| ACUCCAGCCCCACAGCCUCAGC |86
Evidence Experimental
Experiments Cloned
Putative hsa-miR-766-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LDHB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms LDH-B, LDH-H, LDHBD, TRG-5
Description lactate dehydrogenase B
Transcript NM_001174097    LinkOut: [ RefSeq ]
Other Transcripts NM_002300   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LDHB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of LDHB
(miRNA target sites are highlighted)
>LDHB|NM_001174097|3'UTR
   1 CTAGTGAGCTCTAGGCTGTAGAAATTTAAAAACTACAATGTGATTAACTCGAGCCTTTAGTTTTCATCCATGTACATGGA
  81 TCACAGTTTGCTTTGATCTTCTTCAATATGTGAATTTGGGCTCACAGAATCAAAGCCTATGCTTGGTTTAATGCTTGCAA
 161 TCTGAGCTCTTGAACAAATAAAATTAACTATTGTAGTGTGC
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgACUCCGACACCCCGACCUCa 5'
            ||| ||| |  ||||| || 
Target 5' agTGA-GCTCT-AGGCTGTAGa 3'
3 - 22 126.00 -11.60
2
miRNA  3' cgacuccgacaccccgACCUca 5'
                          ||||  
Target 5' ttttcatccatgtacaTGGAtc 3'
61 - 82 80.00 -6.40
3
miRNA  3' cgACUCCGACACCCCGAccuca 5'
            || |  | | |||||     
Target 5' taTGTGAAT-TTGGGCTcacag 3'
107 - 127 75.00 -9.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-766-3p :: LDHB    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
470 hsa-miR-766-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006264 HNF4A hepatocyte nuclear factor 4, alpha 1 1
MIRT039005 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT039006 TMEM120B transmembrane protein 120B 1 1
MIRT039007 NUP205 nucleoporin 205kDa 1 1
MIRT039008 MPZL1 myelin protein zero-like 1 1 1
MIRT039009 WDR45B WDR45-like 1 1
MIRT039010 ARFGEF2 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) 1 1
MIRT039011 ANAPC7 anaphase promoting complex subunit 7 1 1
MIRT039012 ANKRD52 ankyrin repeat domain 52 1 2
MIRT039013 ZNF48 zinc finger protein 48 1 1
MIRT039014 RPS9 ribosomal protein S9 1 1
MIRT039015 NBPF15 neuroblastoma breakpoint family, member 15 1 1
MIRT039016 COX1 cytochrome c oxidase subunit I 1 1
MIRT039017 GTF2E2 general transcription factor IIE, polypeptide 2, beta 34kDa 1 1
MIRT039018 RPL28 ribosomal protein L28 1 1
MIRT039019 KPNB1 karyopherin (importin) beta 1 1 1
MIRT039020 DNMBP dynamin binding protein 1 1
MIRT039021 PPIE peptidylprolyl isomerase E (cyclophilin E) 1 1
MIRT039022 BDH2 3-hydroxybutyrate dehydrogenase, type 2 1 1
MIRT039023 RPL27 ribosomal protein L27 1 1
MIRT039024 LDHB lactate dehydrogenase B 1 1
MIRT039025 ATXN7L3 ataxin 7-like 3 1 1
MIRT039026 NOMO3 NODAL modulator 3 1 1
MIRT039027 CDK4 cyclin-dependent kinase 4 1 1
MIRT039028 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT039029 HYOU1 hypoxia up-regulated 1 1 1
MIRT039030 PARD3 par-3 partitioning defective 3 homolog (C. elegans) 1 1
MIRT039031 AARS alanyl-tRNA synthetase 1 1
MIRT039032 PKM pyruvate kinase, muscle 1 1
MIRT039033 KAT5 K(lysine) acetyltransferase 5 1 1
MIRT039034 RPL35A ribosomal protein L35a 1 1
MIRT039035 RPLP2 ribosomal protein, large, P2 1 1
MIRT039036 TERF2 telomeric repeat binding factor 2 1 1
MIRT039037 MAPK1 mitogen-activated protein kinase 1 1 4
MIRT039038 CBX7 chromobox homolog 7 1 1
MIRT039039 RPL37A ribosomal protein L37a 1 1
MIRT039040 BICD2 bicaudal D homolog 2 (Drosophila) 1 1
MIRT039041 PPP1R13B protein phosphatase 1, regulatory subunit 13B 1 1
MIRT039042 NOL11 nucleolar protein 11 1 1
MIRT039043 EZH1 enhancer of zeste homolog 1 (Drosophila) 1 1
MIRT039044 SCRIB scribbled homolog (Drosophila) 1 1
MIRT039045 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT039046 ICOSLG inducible T-cell co-stimulator ligand 1 1
MIRT039047 MED24 mediator complex subunit 24 1 1
MIRT039048 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT039049 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT039050 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 1 1
MIRT039051 PFN1 profilin 1 1 1
MIRT039052 CHPF2 chondroitin polymerizing factor 2 1 1
MIRT039053 LAMTOR4 late endosomal/lysosomal adaptor, MAPK and MTOR activator 4 1 1
MIRT039054 SLC25A12 solute carrier family 25 (aspartate/glutamate carrier), member 12 1 1
MIRT039055 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT129699 AGTRAP angiotensin II receptor-associated protein 1 1
MIRT145323 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT296911 PDCL3 phosducin-like 3 1 2
MIRT303547 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT338484 SPRYD4 SPRY domain containing 4 1 1
MIRT390101 NR1D2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT438137 BAX BCL2-associated X protein 4 1
MIRT451847 TXNDC5 thioredoxin domain containing 5 (endoplasmic reticulum) 1 1
MIRT455114 RILPL1 Rab interacting lysosomal protein-like 1 1 1
MIRT455437 ID3 inhibitor of DNA binding 3, dominant negative helix-loop-helix protein 1 1
MIRT456757 TMEM239 transmembrane protein 239 1 2
MIRT457033 S1PR3 sphingosine-1-phosphate receptor 3 1 1
MIRT458174 LYRM4 LYR motif containing 4 1 2
MIRT458246 SLC9A7 solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7 1 1
MIRT461622 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT469382 RER1 RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) 1 1
MIRT469573 RARA retinoic acid receptor, alpha 1 1
MIRT470928 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT473877 MAFK v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) 1 3
MIRT477019 FAM217B family with sequence similarity 217, member B 1 1
MIRT480297 C7orf73 chromosome 7 open reading frame 73 1 2
MIRT480432 C17orf85 chromosome 17 open reading frame 85 1 1
MIRT480760 BMP3 bone morphogenetic protein 3 1 2
MIRT481157 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT487289 AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) 1 1
MIRT493934 FAM127A family with sequence similarity 127, member A 1 3
MIRT495070 PAQR7 progestin and adipoQ receptor family member VII 1 1
MIRT495377 RELT RELT tumor necrosis factor receptor 1 1
MIRT496536 EBI3 Epstein-Barr virus induced 3 1 1
MIRT497351 SOWAHA sosondowah ankyrin repeat domain family member A 1 1
MIRT497880 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT498136 KIAA1671 KIAA1671 1 1
MIRT498412 TXNDC16 thioredoxin domain containing 16 1 2
MIRT499236 VAV3 vav 3 guanine nucleotide exchange factor 1 2
MIRT499468 ZNF669 zinc finger protein 669 1 4
MIRT503660 ZNF138 zinc finger protein 138 1 2
MIRT504598 ZNF440 zinc finger protein 440 1 2
MIRT506240 PEX13 peroxisomal biogenesis factor 13 1 3
MIRT508159 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 4
MIRT508348 HES7 hairy and enhancer of split 7 (Drosophila) 1 4
MIRT512349 ZNF83 zinc finger protein 83 1 4
MIRT512869 STAMBPL1 STAM binding protein-like 1 1 1
MIRT514685 ZNF701 zinc finger protein 701 1 2
MIRT514909 DMKN dermokine 1 2
MIRT515152 ZNF732 zinc finger protein 732 1 3
MIRT515162 ZNF90 zinc finger protein 90 1 1
MIRT515303 C15orf38-AP3S2 C15orf38-AP3S2 readthrough 1 2
MIRT515685 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 1 1
MIRT517287 AP3S2 adaptor-related protein complex 3, sigma 2 subunit 1 2
MIRT517816 UGDH UDP-glucose 6-dehydrogenase 1 3
MIRT519649 ZNF772 zinc finger protein 772 1 2
MIRT522672 MAGI3 membrane associated guanylate kinase, WW and PDZ domain containing 3 1 2
MIRT524322 CRLF3 cytokine receptor-like factor 3 1 2
MIRT526852 KIFC1 kinesin family member C1 1 1
MIRT527819 TMEM74B transmembrane protein 74B 1 1
MIRT529092 ZNF100 zinc finger protein 100 1 1
MIRT529543 ZNF678 zinc finger protein 678 1 1
MIRT529608 H1F0 H1 histone family, member 0 1 1
MIRT532664 APOBEC3D apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D 1 1
MIRT535017 PRMT7 protein arginine methyltransferase 7 1 2
MIRT535727 N4BP1 NEDD4 binding protein 1 1 1
MIRT535938 MID1 midline 1 (Opitz/BBB syndrome) 1 1
MIRT537143 GJD2 gap junction protein, delta 2, 36kDa 1 1
MIRT538996 B3GAT2 beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) 1 1
MIRT539595 SSH2 slingshot homolog 2 (Drosophila) 1 1
MIRT539679 ZBTB44 zinc finger and BTB domain containing 44 1 1
MIRT539732 DNAH10OS dynein, axonemal, heavy chain 10 opposite strand 1 1
MIRT539790 EMC1 ER membrane protein complex subunit 1 1 2
MIRT539848 ZNF766 zinc finger protein 766 1 1
MIRT540058 CEP104 centrosomal protein 104kDa 1 1
MIRT540077 SSH3 slingshot homolog 3 (Drosophila) 1 1
MIRT540094 NPY4R pancreatic polypeptide receptor 1 1 1
MIRT540151 GTF2B general transcription factor IIB 1 2
MIRT540322 PIGR polymeric immunoglobulin receptor 1 1
MIRT540534 ZNF417 zinc finger protein 417 1 1
MIRT540587 ERCC1 excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence) 1 2
MIRT540760 UTP6 UTP6, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT540913 PON1 paraoxonase 1 1 1
MIRT540993 ZNF460 zinc finger protein 460 1 3
MIRT541515 TOR1AIP1 torsin A interacting protein 1 1 1
MIRT541546 HIATL2 hippocampus abundant transcript-like 2 1 1
MIRT541554 SLC35E1 solute carrier family 35, member E1 1 1
MIRT541568 ZNF43 zinc finger protein 43 1 2
MIRT541668 ATP8B3 ATPase, aminophospholipid transporter, class I, type 8B, member 3 1 2
MIRT541723 TFDP2 transcription factor Dp-2 (E2F dimerization partner 2) 1 1
MIRT541788 TBCCD1 TBCC domain containing 1 1 1
MIRT541817 SMU1 smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) 1 1
MIRT541830 SLC24A4 solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 1 2
MIRT541908 VWA7 von Willebrand factor A domain containing 7 1 1
MIRT541926 ORC1 origin recognition complex, subunit 1 1 2
MIRT541958 GABPB1 GA binding protein transcription factor, beta subunit 1 1 1
MIRT541975 ARHGAP11A Rho GTPase activating protein 11A 1 1
MIRT542008 XRCC2 X-ray repair complementing defective repair in Chinese hamster cells 2 1 1
MIRT542079 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 1
MIRT542170 SSTR2 somatostatin receptor 2 1 1
MIRT542287 POLR3K polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa 1 1
MIRT542321 SERPING1 serpin peptidase inhibitor, clade G (C1 inhibitor), member 1 1 1
MIRT542340 LIMD1 LIM domains containing 1 1 1
MIRT542370 PAICS phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase 1 1
MIRT542391 WDR12 WD repeat domain 12 1 1
MIRT542409 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT542429 ZNF331 zinc finger protein 331 1 1
MIRT542443 C3 complement component 3 1 2
MIRT542477 APOC3 apolipoprotein C-III 1 1
MIRT542497 WDR13 WD repeat domain 13 1 1
MIRT542522 PTK6 PTK6 protein tyrosine kinase 6 1 1
MIRT542536 MRPS10 mitochondrial ribosomal protein S10 1 1
MIRT542642 TIMM8A translocase of inner mitochondrial membrane 8 homolog A (yeast) 1 1
MIRT542661 TAF11 TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa 1 1
MIRT542704 RPS15A ribosomal protein S15a 1 1
MIRT542750 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 2
MIRT542823 PDE12 phosphodiesterase 12 1 1
MIRT545762 HS3ST1 heparan sulfate (glucosamine) 3-O-sulfotransferase 1 1 1
MIRT549637 ZNF75A zinc finger protein 75a 1 1
MIRT549990 ZNF695 zinc finger protein 695 1 3
MIRT550335 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT551352 AGBL5 ATP/GTP binding protein-like 5 1 1
MIRT551568 LETM1 leucine zipper-EF-hand containing transmembrane protein 1 1 1
MIRT551786 ZNF117 zinc finger protein 117 1 2
MIRT552271 RAB3D RAB3D, member RAS oncogene family 1 1
MIRT552351 ZNF667 zinc finger protein 667 1 2
MIRT552656 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT554135 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT559702 AEN apoptosis enhancing nuclease 1 1
MIRT559804 ZNF468 zinc finger protein 468 1 2
MIRT559990 ZNF480 zinc finger protein 480 1 2
MIRT560168 ZNF286A zinc finger protein 286A 1 3
MIRT561009 ZNF286B zinc finger protein 286B 1 2
MIRT561226 ZNF791 zinc finger protein 791 1 2
MIRT561268 ZFP69B zinc finger protein 643 1 2
MIRT562808 ZNF611 zinc finger protein 611 1 1
MIRT563133 ZNF215 zinc finger protein 215 1 1
MIRT563620 ZNF277 zinc finger protein 277 1 1
MIRT563647 ZNF675 zinc finger protein 675 1 1
MIRT563677 ZNF254 zinc finger protein 254 1 1
MIRT563690 RPS26 ribosomal protein S26 1 1
MIRT563744 ZNF107 zinc finger protein 107 1 1
MIRT563952 ZNF431 zinc finger protein 431 1 2
MIRT565270 TNRC6C trinucleotide repeat containing 6C 1 1
MIRT566419 PIM3 pim-3 oncogene 1 1
MIRT569747 C2orf71 chromosome 2 open reading frame 71 1 1
MIRT571497 ZNF846 zinc finger protein 846 1 1
MIRT572293 ZNF584 zinc finger protein 584 1 1
MIRT572362 RADIL Ras association and DIL domains 1 1
MIRT572967 PRKD1 protein kinase D1 1 1
MIRT576932 Ing5 inhibitor of growth family, member 5 1 1
MIRT607391 LANCL3 LanC lantibiotic synthetase component C-like 3 (bacterial) 1 1
MIRT607453 ZNF543 zinc finger protein 543 1 1
MIRT607581 TANGO2 chromosome 22 open reading frame 25 1 1
MIRT607749 ANGPT4 angiopoietin 4 1 1
MIRT608705 GMPR guanosine monophosphate reductase 1 1
MIRT608925 REXO2 REX2, RNA exonuclease 2 homolog (S. cerevisiae) 1 4
MIRT609303 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 1 1
MIRT610260 LRRC47 leucine rich repeat containing 47 1 1
MIRT610828 FAM212B family with sequence similarity 212, member B 1 1
MIRT616433 FAM126B family with sequence similarity 126, member B 1 1
MIRT617046 ZNF610 zinc finger protein 610 1 1
MIRT617580 NDUFB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa 1 1
MIRT617615 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT617670 RSRC1 arginine/serine-rich coiled-coil 1 1 1
MIRT617723 TRAPPC2 trafficking protein particle complex 2 1 2
MIRT617983 ZNF234 zinc finger protein 234 1 2
MIRT618435 MYLK3 myosin light chain kinase 3 1 2
MIRT618733 HIST1H2AH histone cluster 1, H2ah 1 1
MIRT619046 CASS4 Cas scaffolding protein family member 4 1 1
MIRT619574 ATAT1 alpha tubulin acetyltransferase 1 1 2
MIRT619672 CYP1A2 cytochrome P450, family 1, subfamily A, polypeptide 2 1 1
MIRT619888 ABHD17B family with sequence similarity 108, member B1 1 1
MIRT620536 AVPR1A arginine vasopressin receptor 1A 1 1
MIRT620997 C19orf52 chromosome 19 open reading frame 52 1 1
MIRT621096 SIX3 SIX homeobox 3 1 1
MIRT621895 TAF13 TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa 1 1
MIRT622087 SRPX2 sushi-repeat containing protein, X-linked 2 1 1
MIRT622397 RRAGC Ras-related GTP binding C 1 1
MIRT622658 POU2F3 POU class 2 homeobox 3 1 2
MIRT623132 NDUFC2 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa 1 1
MIRT623824 GATSL2 GATS protein-like 2 1 1
MIRT624635 ATG2A autophagy related 2A 1 1
MIRT624841 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT625048 MBD3 methyl-CpG binding domain protein 3 1 1
MIRT625060 ZNF556 zinc finger protein 556 1 1
MIRT625322 PTCHD3 patched domain containing 3 1 2
MIRT625575 ANKRD42 ankyrin repeat domain 42 1 1
MIRT626135 SNRNP48 small nuclear ribonucleoprotein 48kDa (U11/U12) 1 1
MIRT626328 LRTOMT leucine rich transmembrane and 0-methyltransferase domain containing 1 1
MIRT626766 CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) 1 1
MIRT627213 ZC3H12B zinc finger CCCH-type containing 12B 1 1
MIRT627257 XKR4 XK, Kell blood group complex subunit-related family, member 4 1 1
MIRT627729 RAPGEF1 Rap guanine nucleotide exchange factor (GEF) 1 1 1
MIRT628467 AHSA2 AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) 1 1
MIRT628628 CCT4 chaperonin containing TCP1, subunit 4 (delta) 1 1
MIRT629041 KLLN killin, p53-regulated DNA replication inhibitor 1 1
MIRT629613 NOL10 nucleolar protein 10 1 1
MIRT630848 ACACB acetyl-CoA carboxylase beta 1 1
MIRT631723 RNASEH2B ribonuclease H2, subunit B 1 1
MIRT631796 FUT1 fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) 1 1
MIRT631873 BBS5 Bardet-Biedl syndrome 5 1 1
MIRT631908 VEGFC vascular endothelial growth factor C 1 1
MIRT631916 RAB19 RAB19, member RAS oncogene family 1 1
MIRT632265 USP1 ubiquitin specific peptidase 1 1 2
MIRT632309 TMEM65 transmembrane protein 65 1 1
MIRT632572 POLQ polymerase (DNA directed), theta 1 1
MIRT632879 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT632943 ELOVL6 ELOVL fatty acid elongase 6 1 2
MIRT633993 SLC35E2 solute carrier family 35, member E2 1 1
MIRT635284 GK5 glycerol kinase 5 (putative) 1 1
MIRT635664 DTX3L deltex 3-like (Drosophila) 1 1
MIRT635679 COX18 cytochrome c oxidase assembly homolog 18 (yeast) 1 2
MIRT635865 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT636252 SEC63 SEC63 homolog (S. cerevisiae) 1 1
MIRT636565 EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) 1 1
MIRT636626 CHAF1B chromatin assembly factor 1, subunit B (p60) 1 2
MIRT636815 TBC1D24 TBC1 domain family, member 24 1 1
MIRT636880 ACOT2 acyl-CoA thioesterase 2 1 1
MIRT637474 DEFB105B defensin, beta 105B 1 2
MIRT637506 DEFB105A defensin, beta 105A 1 2
MIRT637862 SC5D sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S. cerevisiae)-like 1 1
MIRT638082 ZNF652 zinc finger protein 652 1 1
MIRT638097 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT638175 TMED4 transmembrane emp24 protein transport domain containing 4 1 1
MIRT638223 SPATA13 spermatogenesis associated 13 1 1
MIRT638280 SH2B3 SH2B adaptor protein 3 1 1
MIRT638716 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 1
MIRT638853 CLMP CXADR-like membrane protein 1 1
MIRT640880 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT640938 FAM129A family with sequence similarity 129, member A 1 1
MIRT640972 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT641016 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT641932 SLC25A16 solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 1 1
MIRT643379 TRIM16L tripartite motif containing 16-like 1 1
MIRT643729 MCMDC2 minichromosome maintenance domain containing 2 1 1
MIRT645164 NOL9 nucleolar protein 9 1 1
MIRT647904 CIRH1A cirrhosis, autosomal recessive 1A (cirhin) 1 1
MIRT649908 SLFN12L schlafen family member 12-like 1 1
MIRT650225 SIGLEC9 sialic acid binding Ig-like lectin 9 1 1
MIRT650351 TREM1 triggering receptor expressed on myeloid cells 1 1 1
MIRT651712 VGLL3 vestigial like 3 (Drosophila) 1 1
MIRT652840 TACO1 translational activator of mitochondrially encoded cytochrome c oxidase I 1 1
MIRT654090 RSF1 remodeling and spacing factor 1 1 1
MIRT655149 PHF3 PHD finger protein 3 1 1
MIRT655592 OTUD7B OTU domain containing 7B 1 1
MIRT656976 KDM5B lysine (K)-specific demethylase 5B 1 1
MIRT657550 GSTO2 glutathione S-transferase omega 2 1 1
MIRT657655 GPR75 G protein-coupled receptor 75 1 1
MIRT658761 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT659359 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT659380 CREG2 cellular repressor of E1A-stimulated genes 2 1 1
MIRT659466 CLPB ClpB caseinolytic peptidase B homolog (E. coli) 1 1
MIRT660053 C12orf5 chromosome 12 open reading frame 5 1 1
MIRT660722 ALG9 asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT660738 ALG14 asparagine-linked glycosylation 14 homolog (S. cerevisiae) 1 1
MIRT661089 TMEM145 transmembrane protein 145 1 1
MIRT661177 S1PR2 sphingosine-1-phosphate receptor 2 1 1
MIRT661336 TBC1D15 TBC1 domain family, member 15 1 1
MIRT662201 MEI1 meiosis inhibitor 1 1 1
MIRT662271 OR51E2 olfactory receptor, family 51, subfamily E, member 2 1 1
MIRT663047 SLC16A4 solute carrier family 16, member 4 (monocarboxylic acid transporter 5) 1 1
MIRT663477 POFUT2 protein O-fucosyltransferase 2 1 1
MIRT664040 RPL27A ribosomal protein L27a 1 1
MIRT664097 ZDHHC24 zinc finger, DHHC-type containing 24 1 1
MIRT664318 CD209 CD209 molecule 1 1
MIRT664596 HSD17B12 hydroxysteroid (17-beta) dehydrogenase 12 1 2
MIRT665163 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 2
MIRT665215 RBM22 RNA binding motif protein 22 1 1
MIRT665608 TTC39A tetratricopeptide repeat domain 39A 1 1
MIRT665831 TIMELESS timeless homolog (Drosophila) 1 1
MIRT666547 RNF115 ring finger protein 115 1 1
MIRT666603 REEP3 receptor accessory protein 3 1 1
MIRT666887 POLA2 polymerase (DNA directed), alpha 2, accessory subunit 1 1
MIRT667159 NRXN3 neurexin 3 1 1
MIRT667253 NEK9 NIMA (never in mitosis gene a)- related kinase 9 1 1
MIRT667435 METTL8 methyltransferase like 8 1 1
MIRT667691 KNSTRN chromosome 15 open reading frame 23 1 1
MIRT668024 HAUS3 HAUS augmin-like complex, subunit 3 1 1
MIRT668608 EHD4 EH-domain containing 4 1 2
MIRT668695 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT669038 CHEK1 checkpoint kinase 1 1 1
MIRT669157 CCNG1 cyclin G1 1 1
MIRT669195 CCDC113 coiled-coil domain containing 113 1 1
MIRT669729 ZBTB8B zinc finger and BTB domain containing 8B 1 2
MIRT670091 ABCF3 ATP-binding cassette, sub-family F (GCN20), member 3 1 2
MIRT672489 FUS fused in sarcoma 1 1
MIRT673226 KLHDC8A kelch domain containing 8A 1 1
MIRT674233 RAD51 RAD51 homolog (S. cerevisiae) 1 1
MIRT675635 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 1 1
MIRT677914 HIST1H2BN histone cluster 1, H2bn 1 1
MIRT678627 OLFML2A olfactomedin-like 2A 1 1
MIRT678792 NUPL2 nucleoporin like 2 1 1
MIRT679562 LIN9 lin-9 homolog (C. elegans) 1 2
MIRT680744 CA5B carbonic anhydrase VB, mitochondrial 1 1
MIRT680899 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 1
MIRT681033 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 1 1
MIRT682300 RBM28 RNA binding motif protein 28 1 1
MIRT682482 LIX1L Lix1 homolog (mouse)-like 1 2
MIRT682568 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 1 1
MIRT682702 PSMD9 proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 1 1
MIRT682760 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 1
MIRT682812 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT682848 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT682868 C9orf156 chromosome 9 open reading frame 156 1 1
MIRT682897 XIAP X-linked inhibitor of apoptosis 1 1
MIRT682917 FAM73A family with sequence similarity 73, member A 1 1
MIRT682936 ZNF292 zinc finger protein 292 1 1
MIRT682954 RPL12 ribosomal protein L12 1 1
MIRT682973 NF2 neurofibromin 2 (merlin) 1 1
MIRT683034 SUSD5 sushi domain containing 5 1 1
MIRT683083 A1BG alpha-1-B glycoprotein 1 1
MIRT683106 TIMM10B fracture callus 1 homolog (rat) 1 1
MIRT683127 MED28 mediator complex subunit 28 1 1
MIRT683838 ZNF682 zinc finger protein 682 1 1
MIRT684256 TBXA2R thromboxane A2 receptor 1 1
MIRT684324 GTF3C4 general transcription factor IIIC, polypeptide 4, 90kDa 1 1
MIRT684390 MCTS1 malignant T cell amplified sequence 1 1 1
MIRT684424 TUFT1 tuftelin 1 1 1
MIRT686190 ZNF594 zinc finger protein 594 1 1
MIRT686641 TMEM184C transmembrane protein 184C 1 1
MIRT687205 PLXNA3 plexin A3 1 1
MIRT688887 C3orf70 chromosome 3 open reading frame 70 1 1
MIRT689149 IRAK1BP1 interleukin-1 receptor-associated kinase 1 binding protein 1 1 1
MIRT689235 RPS19 ribosomal protein S19 1 1
MIRT689307 C5AR2 G protein-coupled receptor 77 1 1
MIRT689365 ZNF101 zinc finger protein 101 1 1
MIRT689499 SCARF1 scavenger receptor class F, member 1 1 1
MIRT689656 RBM23 RNA binding motif protein 23 1 1
MIRT690151 PPIL6 peptidylprolyl isomerase (cyclophilin)-like 6 1 1
MIRT690602 C17orf105 chromosome 17 open reading frame 105 1 1
MIRT690625 LAX1 lymphocyte transmembrane adaptor 1 1 1
MIRT690806 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT690947 GLG1 golgi glycoprotein 1 1 1
MIRT691409 DNA2 DNA replication helicase 2 homolog (yeast) 1 1
MIRT691996 SGTB small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta 1 1
MIRT692236 ALDH1B1 aldehyde dehydrogenase 1 family, member B1 1 1
MIRT692412 AGMAT agmatine ureohydrolase (agmatinase) 1 1
MIRT692916 EXOSC2 exosome component 2 1 1
MIRT693284 GINM1 glycoprotein integral membrane 1 1 1
MIRT693440 TPGS1 tubulin polyglutamylase complex subunit 1 1 1
MIRT693462 HIST1H2AG histone cluster 1, H2ag 1 1
MIRT693618 CENPL centromere protein L 1 1
MIRT693761 ZNF383 zinc finger protein 383 1 1
MIRT694019 PPIL4 peptidylprolyl isomerase (cyclophilin)-like 4 1 1
MIRT694237 ZNF749 zinc finger protein 749 1 1
MIRT694322 NLRP9 NLR family, pyrin domain containing 9 1 1
MIRT694366 CHST6 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6 1 1
MIRT694431 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 1
MIRT695021 MRPS21 mitochondrial ribosomal protein S21 1 1
MIRT695294 TK1 thymidine kinase 1, soluble 1 1
MIRT696168 TIPIN TIMELESS interacting protein 1 1
MIRT696216 LYZ lysozyme 1 1
MIRT696418 DOCK7 dedicator of cytokinesis 7 1 1
MIRT696999 CCDC80 coiled-coil domain containing 80 1 1
MIRT697233 ZYG11A zyg-11 homolog A (C. elegans) 1 1
MIRT697807 UBXN2A UBX domain protein 2A 1 1
MIRT697945 TVP23C family with sequence similarity 18, member B2 1 1
MIRT698162 TNFRSF13C tumor necrosis factor receptor superfamily, member 13C 1 1
MIRT698779 STK4 serine/threonine kinase 4 1 1
MIRT699363 SLC35A3 solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3 1 1
MIRT699535 SIX4 SIX homeobox 4 1 1
MIRT700005 RPS21 ribosomal protein S21 1 1
MIRT700260 RBM12B RNA binding motif protein 12B 1 1
MIRT700971 PDK3 pyruvate dehydrogenase kinase, isozyme 3 1 1
MIRT701545 NARF nuclear prelamin A recognition factor 1 1
MIRT702458 KIAA1467 KIAA1467 1 1
MIRT702615 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein-like 2 1 1
MIRT702692 IRGQ immunity-related GTPase family, Q 1 1
MIRT702811 HPSE heparanase 1 1
MIRT702935 HMX3 H6 family homeobox 3 1 1
MIRT702992 HERPUD2 HERPUD family member 2 1 1
MIRT704299 DDX19B DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B 1 1
MIRT704374 DAND5 DAN domain family, member 5 1 1
MIRT704702 CHRFAM7A CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion 1 1
MIRT704830 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT705448 ATL2 atlastin GTPase 2 1 1
MIRT705460 ATG9A autophagy related 9A 1 1
MIRT705857 AFF3 AF4/FMR2 family, member 3 1 1
MIRT708869 TMEM151B transmembrane protein 151B 1 1
MIRT709932 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT710070 UBL4A ubiquitin-like 4A 1 1
MIRT710165 MTRF1L mitochondrial translational release factor 1-like 1 1
MIRT710306 NUDT16 nudix (nucleoside diphosphate linked moiety X)-type motif 16 1 1
MIRT710907 KIAA2018 KIAA2018 1 1
MIRT710998 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT712413 MGAT5 mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase 1 1
MIRT712912 MRGPRF MAS-related GPR, member F 1 1
MIRT713200 WNK2 WNK lysine deficient protein kinase 2 1 1
MIRT713205 SOCS6 suppressor of cytokine signaling 6 1 1
MIRT714063 VHLL von Hippel-Lindau tumor suppressor-like 1 1
MIRT714165 SSTR3 somatostatin receptor 3 1 1
MIRT714510 SHE Src homology 2 domain containing E 1 1
MIRT714774 TERF1 telomeric repeat binding factor (NIMA-interacting) 1 1 1
MIRT715268 RNF125 ring finger protein 125, E3 ubiquitin protein ligase 1 1
MIRT715349 VMP1 vacuole membrane protein 1 1 1
MIRT716305 FAM131B family with sequence similarity 131, member B 1 1
MIRT716498 ZNF394 zinc finger protein 394 1 1
MIRT716836 WWC2 WW and C2 domain containing 2 1 1
MIRT717351 RAB40A RAB40A, member RAS oncogene family 1 1
MIRT718013 METTL15 methyltransferase like 15 1 1
MIRT718409 GPR132 G protein-coupled receptor 132 1 1
MIRT718691 BTBD9 BTB (POZ) domain containing 9 1 1
MIRT719026 SHROOM3 shroom family member 3 1 1
MIRT719632 MYO5C myosin VC 1 1
MIRT720004 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 18kDa 1 1
MIRT720089 STK24 serine/threonine kinase 24 1 1
MIRT720448 SLC16A5 solute carrier family 16, member 5 (monocarboxylic acid transporter 6) 1 1
MIRT720722 RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6 1 1
MIRT721073 TGFBI transforming growth factor, beta-induced, 68kDa 1 1
MIRT721234 CRCP CGRP receptor component 1 1
MIRT721264 SH3D19 SH3 domain containing 19 1 1
MIRT721479 BTN3A2 butyrophilin, subfamily 3, member A2 1 1
MIRT722134 TTLL11 tubulin tyrosine ligase-like family, member 11 1 1
MIRT722428 HRNR hornerin 1 1
MIRT722546 AGPAT4 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) 1 1
MIRT722628 C8A complement component 8, alpha polypeptide 1 1
MIRT722818 ELP2 elongator acetyltransferase complex subunit 2 1 1
MIRT722822 KLK2 kallikrein-related peptidase 2 1 1
MIRT723263 SREK1 splicing regulatory glutamine/lysine-rich protein 1 1 1
MIRT724615 SNAP25 synaptosomal-associated protein, 25kDa 1 1
MIRT724889 MVK mevalonate kinase 1 1
MIRT724908 DAO D-amino-acid oxidase 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*