Accession ID: MIRT039024 [miRNA, hsa-miR-766-3p :: LDHB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-766LinkOut: [miRBase ]
Synonyms MIRN766, hsa-mir-766, MIR766
Description Homo sapiens miR-766 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-766-3p
Mature Sequence 65| ACUCCAGCCCCACAGCCUCAGC |86
Evidence Experimental
Experiments Cloned
Putative hsa-miR-766-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LDHB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms LDH-H, TRG-5
Description lactate dehydrogenase B
Transcript NM_0011740    LinkOut: [ RefSeq ]
Other Transcripts NM_0023   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LDHB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of LDHB
(miRNA target sites are highlighted)
>LDHB|NM_0011740|3'UTR
   1 TGACTAGTGAGCTCTAGGCTGTAGAAATTTAAAAACTACAATGTGATTAACTCGAGCCTTTAGTTTTCATCCATGTACAT
  81 GGATCACAGTTTGCTTTGATCTTCTTCAATATGTGAATTTGGGCTCACAGAATCAAAGCCTATGCTTGGTTTAATGCTTG
 161 CAATCTGAGCTCTTGAACAAATAAAATTAACTATTGTAGTGTGC
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgACUCCGACACCCCGACCUCa 5'
            ||| ||| |  ||||| || 
Target 5' agTGA-GCTCT-AGGCTGTAGa 3'
6 - 25 126.00 -11.60
2
miRNA  3' cgacuccgacaccccgACCUca 5'
                          ||||  
Target 5' ttttcatccatgtacaTGGAtc 3'
64 - 85 80.00 -6.40
3
miRNA  3' cgACUCCGACACCCCGAccuca 5'
            || |  | | |||||     
Target 5' taTGTGAAT-TTGGGCTcacag 3'
110 - 130 75.00 -9.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-766-3p :: LDHB    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
52 hsa-miR-766-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006264 HNF4A hepatocyte nuclear factor 4, alpha 1 1
MIRT039005 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT039006 TMEM120B transmembrane protein 120B 1 1
MIRT039007 NUP205 nucleoporin 205kDa 1 1
MIRT039008 MPZL1 myelin protein zero-like 1 1 1
MIRT039009 WDR45B WDR45-like 1 1
MIRT039010 ARFGEF2 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) 1 1
MIRT039011 ANAPC7 anaphase promoting complex subunit 7 1 1
MIRT039012 ANKRD52 ankyrin repeat domain 52 1 1
MIRT039013 ZNF48 zinc finger protein 48 1 1
MIRT039014 RPS9 ribosomal protein S9 1 1
MIRT039015 NBPF15 neuroblastoma breakpoint family, member 15 1 1
MIRT039016 COX1 cytochrome c oxidase subunit I 1 1
MIRT039017 GTF2E2 general transcription factor IIE, polypeptide 2, beta 34kDa 1 1
MIRT039018 RPL28 ribosomal protein L28 1 1
MIRT039019 KPNB1 karyopherin (importin) beta 1 1 1
MIRT039020 DNMBP dynamin binding protein 1 1
MIRT039021 PPIE peptidylprolyl isomerase E (cyclophilin E) 1 1
MIRT039022 BDH2 3-hydroxybutyrate dehydrogenase, type 2 1 1
MIRT039023 RPL27 ribosomal protein L27 1 1
MIRT039024 LDHB lactate dehydrogenase B 1 1
MIRT039025 ATXN7L3 ataxin 7-like 3 1 1
MIRT039026 NOMO3 NODAL modulator 3 1 1
MIRT039027 CDK4 cyclin-dependent kinase 4 1 1
MIRT039028 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT039029 HYOU1 hypoxia up-regulated 1 1 1
MIRT039030 PARD3 par-3 partitioning defective 3 homolog (C. elegans) 1 1
MIRT039031 AARS alanyl-tRNA synthetase 1 1
MIRT039032 PKM pyruvate kinase, muscle 1 1
MIRT039033 KAT5 K(lysine) acetyltransferase 5 1 1
MIRT039034 RPL35A ribosomal protein L35a 1 1
MIRT039035 RPLP2 ribosomal protein, large, P2 1 1
MIRT039036 TERF2 telomeric repeat binding factor 2 1 1
MIRT039037 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT039038 CBX7 chromobox homolog 7 1 1
MIRT039039 RPL37A ribosomal protein L37a 1 1
MIRT039040 BICD2 bicaudal D homolog 2 (Drosophila) 1 1
MIRT039041 PPP1R13B protein phosphatase 1, regulatory (inhibitor) subunit 13B 1 1
MIRT039042 NOL11 nucleolar protein 11 1 1
MIRT039043 EZH1 enhancer of zeste homolog 1 (Drosophila) 1 1
MIRT039044 SCRIB scribbled homolog (Drosophila) 1 1
MIRT039045 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT039046 ICOSLG inducible T-cell co-stimulator ligand 1 1
MIRT039047 MED24 mediator complex subunit 24 1 1
MIRT039048 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT039049 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT039050 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 1 1
MIRT039051 PFN1 profilin 1 1 1
MIRT039052 CHPF2 chondroitin polymerizing factor 2 1 1
MIRT039053 LAMTOR4 chromosome 7 open reading frame 59 1 1
MIRT039054 SLC25A12 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 1 1
MIRT039055 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1