Accession ID: MIRT039125 [miRNA, hsa-miR-769-3p :: POLR3A, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-769LinkOut: [miRBase ]
Synonyms MIRN769, hsa-mir-769, MIR769
Description Homo sapiens miR-769 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-769-3p
Mature Sequence 69| CUGGGAUCUCCGGGGUCUUGGUU |91
Evidence Experimental
Experiments Cloned
Putative hsa-miR-769-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol POLR3A LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ADDH, HLD7, RPC1, RPC155, hRPC155
Description polymerase (RNA) III (DNA directed) polypeptide A, 155kDa
Transcript NM_007055    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on POLR3A LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of POLR3A
(miRNA target sites are highlighted)
>POLR3A|NM_007055|3'UTR
   1 TCCAAAGAAAGAGGGGACCATGCCTGACCTTGACTCCTTGTCCTGTCTCCAGCTGATGTATAAAGAGTTTTGTGCTCCCT
  81 GGGACGGGGGTCCTGAGGTCCCCACCTATGCCAGCAATCAGAGAAGCCCTCTTGGCATCCCCAGGAGCAGCTTCTCCTCT
 161 GATAGGGTGCAGCTCACACCAGTGACCCTGACTGTGCCACGCTGCTCGGGAGAGCTGAGGGTTTTATTGTTTGCTTGCTT
 241 GAAACCTAATCTATAGACGGCCCCACAGCTCGTGCACACACTGCTTCCCTGGACTTAAAGCCCAGCCAGGTGTCATGGTC
 321 CATCCCAGCTCACTGCATACATCCATCGGCTCCCCATGGTGTCTTCACACCTGACGATGAGCCAGGCCTGAGCCCCACAC
 401 AGGCCAGGGCACATTCTTGGATTTTCCATTCCTTGGTCATGCTGGAATCTCTCAATGTGACATACTTATGTAAATATTGT
 481 TACTATTATTTATTTGTTCCATTTGAGGGATTTGGAATTTTTGTTATTTTAGTTTTATTTTTGAAACCAAGCATCTATAG
 561 AAACCAAGAAAGTCAGCATGTAAGCGTCACTGGAAAAACTGGTTTAAGCAAATAGAGCCGTCTGGGATTTGTAACTGAGG
 641 TGCAACTGTCATGAGGCCCAGGCAGCTCTGTAACATCTTCTATAGATGCCCCTGGCTACCCTGTTGTTTTCATCTACCTC
 721 AGACCCCTATCATGGGGCTCTACCCTGTGACAAGAGCCAAACCCATTCTCCATGGCCTATGGAAGCCTCACTGGAGTTTG
 801 GGGCCTGCTGCAATGGGGATGAGATGGTTTTTTGTAGAATTATACTTACGTTCCTTGGATGATCTCTAGTTGATTTTTTA
 881 AGTTCTGAGTTGATGCTGTTAAGGTACCCGGGGTAGCCATTGGTTCTTGGATCTGTGTTAGAATGAGTGCTTTCCCTTCC
 961 TACTGATGTGATTGTGGATTAGGAATTCGTGACCGAGTGATTTTTGGCCAGTGGTTGGGTTTAAAATTCTATTAAAATTT
1041 GTAGTTTGGGCTGGGTGCTGTGGCTCATACCTATAATCCCAGCACTTTGGGAGGCCGAGGGGGGCAGATCACTTGAGCCC
1121 AGGAGTTCGAGAGCAGCCTGGGCAACATGACGAAACCCCGTCTCTACAGAGAATACAAAAATTAGCCAGGCATGGTGGCC
1201 CATGCCTGTAGTACCTGCTATTGGTAAGGCTGAGGTGGAAGGTTCACTTGAGCCTGGGAGGTGGAGGTTGTAGTGAGCCA
1281 AGATCGTGCCACTACACTCCAGCCTGGGCAACAAAGCAAGACCTTGTCTCAAAAAAAAAAAAGAAAAAAATTAAGCGTAA
1361 AAAAAAATTAGTTTTTATAAAAAATTATAGTTTGACCTTTTGATTTCCCTGCATCTACAAGGTAGACCTATTAACTTCTC
1441 TTGGGGTATCAGTGATGTGGAAAAAAAATGCCATTTTTCTTAATGTTTAACCCCCCTTTATCTTTGAATTGAGCTAGAGC
1521 CTGGTTTAGGACAAAGGATTAAGTTTGTTAATGAACACTAATTCAGGGCTTCTACTTGAGACCCCACCGAGATCACCAGT
1601 TCTCATGTAACCTGGGAAGAGCCATAAAGGGGTACCCCCCACCCCAACTGCCTTCCTGGAAGCATGCCTGGGAAGTAAGC
1681 TGTAGGCCTGATCCGAGCCAGGACCACTGGGATCCGTGCAAAGGCCAGGGGAGGGTAGAATTGAATCATAGGAGTGAACT
1761 CCGGCACCTGTTGTCTTCTGCGGGTGACGCACACTTTAAATGGAAGAGAGGTTGTGGCTATAACTTGTGGCTGGGAATAA
1841 TAAAGATGGCACCGCCAAGGAGCCTCACCTTGCGTGAGTGAGTACTCAGTTGGGCGCTGCAGGGTCTGGAGTCTGTGTGA
1921 GACGTGTGTGATTGTGATGGGTGCGAATCAGCGTATAGCACTTGAGAACAAGGCAGACCTTGGAGCAGAATGGTTATGTG
2001 AAGGATCACATCACCCATGGGTAGGGGGGGAAGTCATACGTCCTGGAGGTGCTGGTCCTCCTCCTGGAACTGCCAGCCTT
2081 GCTAGGACTATCAACATCAACAGCATTGCCTGGTAAACCCTACTGTTTGTGCTCCCCACTGTGTCCCATGACTGGTGTTA
2161 AAATTCTCCCTACTTTGATCATCTGCCCTGCCCAGGCCTTGGGCTTTATGCCAGCACAGAGCTCAAAGGCCAGGTAGCAG
2241 CACATCCTCAAGCATGAGAGCTCAAAGGGTTACATTTGAGTCTCTGTACCTGCTTGGAAGAAATAAAAATACGTGTGAAT
2321 TCCATCTCA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuGGUUCUGGG--GCCUCUAG-GGUc 5'
            :::||||||  | |||||| ||| 
Target 5' acTTGAGACCCCACCGAGATCACCAg 3'
1574 - 1599 143.00 -27.80
2
miRNA  3' uuGGUUCUGGGGCCUCUAGGguc 5'
            |||:|||| | |:|||||   
Target 5' agCCAGGACCACTGGGATCCgtg 3'
1696 - 1718 141.00 -27.72
3
miRNA  3' uugGUUCUGGGGCCUCUAGGGuc 5'
             |::|: :|| |||:||||  
Target 5' ggaCGGGGGTCCTGAGGTCCCca 3'
82 - 104 132.00 -24.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-769-3p :: POLR3A    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
156 hsa-miR-769-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT039056 TMEM99 transmembrane protein 99 1 1
MIRT039057 PHAX phosphorylated adaptor for RNA export 1 1
MIRT039058 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT039059 NME4 NME/NM23 nucleoside diphosphate kinase 4 1 1
MIRT039060 PHF20L1 PHD finger protein 20-like 1 1 1
MIRT039061 KIF1C kinesin family member 1C 1 2
MIRT039062 NUP205 nucleoporin 205kDa 1 1
MIRT039063 ZNF598 zinc finger protein 598 1 1
MIRT039064 HIST2H4B histone cluster 2, H4b 1 4
MIRT039065 MXI1 MAX interactor 1 1 1
MIRT039066 NIPA2 non imprinted in Prader-Willi/Angelman syndrome 2 1 1
MIRT039067 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 1
MIRT039068 SIGMAR1 sigma non-opioid intracellular receptor 1 1 1
MIRT039069 STIM1 stromal interaction molecule 1 1 1
MIRT039070 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT039071 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble) 1 1
MIRT039072 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT039073 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT039074 ATXN7L3B ataxin 7-like 3B 1 1
MIRT039075 UBC ubiquitin C 1 1
MIRT039076 RPSA ribosomal protein SA 1 1
MIRT039077 EIF3L eukaryotic translation initiation factor 3, subunit L 1 1
MIRT039078 HOXA9 homeobox A9 1 1
MIRT039079 BRD2 bromodomain containing 2 1 1
MIRT039080 ISOC2 isochorismatase domain containing 2 1 1
MIRT039081 FAM3C family with sequence similarity 3, member C 1 1
MIRT039082 TMEM127 transmembrane protein 127 1 1
MIRT039083 SOD2 superoxide dismutase 2, mitochondrial 1 2
MIRT039084 PEG10 paternally expressed 10 1 1
MIRT039085 CTNNA1 catenin (cadherin-associated protein), alpha 1, 102kDa 1 1
MIRT039086 HIST2H3A histone cluster 2, H3a 1 1
MIRT039087 PAPD5 PAP associated domain containing 5 1 1
MIRT039088 RAI1 retinoic acid induced 1 1 1
MIRT039089 COL4A1 collagen, type IV, alpha 1 1 1
MIRT039090 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT039091 MAP3K5 mitogen-activated protein kinase kinase kinase 5 1 1
MIRT039092 TSPAN14 tetraspanin 14 1 1
MIRT039093 TBC1D9B TBC1 domain family, member 9B (with GRAM domain) 1 1
MIRT039094 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT039095 RPL32 ribosomal protein L32 1 1
MIRT039096 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase, type I, alpha 1 1
MIRT039097 ZNF395 zinc finger protein 395 1 1
MIRT039098 C19orf54 chromosome 19 open reading frame 54 1 1
MIRT039099 PHLDA3 pleckstrin homology-like domain, family A, member 3 1 1
MIRT039100 ADRM1 adhesion regulating molecule 1 1 1
MIRT039101 ELL elongation factor RNA polymerase II 1 1
MIRT039102 AXIN1 axin 1 1 1
MIRT039103 TACC3 transforming, acidic coiled-coil containing protein 3 1 1
MIRT039104 NDUFC2 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa 1 1
MIRT039105 ZNF436 zinc finger protein 436 1 1
MIRT039106 MFSD12 major facilitator superfamily domain containing 12 1 1
MIRT039107 TIAM1 T-cell lymphoma invasion and metastasis 1 1 1
MIRT039108 YY1 YY1 transcription factor 1 1
MIRT039109 RNASEK ribonuclease, RNase K 1 1
MIRT039110 INTS1 integrator complex subunit 1 1 1
MIRT039111 POM121 POM121 transmembrane nucleoporin 1 1
MIRT039112 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT039113 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 1
MIRT039114 METTL13 methyltransferase like 13 1 1
MIRT039115 HNRNPH3 heterogeneous nuclear ribonucleoprotein H3 (2H9) 1 1
MIRT039116 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT039117 C11orf58 chromosome 11 open reading frame 58 1 1
MIRT039118 PLEC plectin 1 1
MIRT039119 ATP6V1F ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F 1 1
MIRT039120 CD81 CD81 molecule 1 1
MIRT039121 MBTPS1 membrane-bound transcription factor peptidase, site 1 1 1
MIRT039122 AP1B1 adaptor-related protein complex 1, beta 1 subunit 1 1
MIRT039123 ACLY ATP citrate lyase 1 1
MIRT039124 HOXA11 homeobox A11 1 1
MIRT039125 POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa 1 1
MIRT039126 ANXA2 annexin A2 1 1
MIRT039127 TRIM37 tripartite motif containing 37 1 1
MIRT039128 RPL13A ribosomal protein L13a 1 1
MIRT039129 CLCN7 chloride channel, voltage-sensitive 7 1 1
MIRT039130 ESF1 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) 1 1
MIRT039131 RNF4 ring finger protein 4 1 1
MIRT039132 TRAP1 TNF receptor-associated protein 1 1 1
MIRT039133 ACTG1 actin, gamma 1 1 1
MIRT039134 EMILIN3 elastin microfibril interfacer 3 1 1
MIRT039135 RPL23A ribosomal protein L23a 1 1
MIRT039136 ZFAND5 zinc finger, AN1-type domain 5 1 1
MIRT039137 DLX4 distal-less homeobox 4 1 1
MIRT091794 GOLGA4 golgin A4 1 1
MIRT100129 HIST1H2AI histone cluster 1, H2ai 1 3
MIRT183607 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 4
MIRT218435 HIST1H2BF histone cluster 1, H2bf 1 2
MIRT266959 LRRC55 leucine rich repeat containing 55 1 2
MIRT326658 ZNF275 zinc finger protein 275 1 2
MIRT367162 HIST2H4A histone cluster 2, H4a 1 3
MIRT458264 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT466893 STMN1 stathmin 1 1 1
MIRT466938 STAU1 staufen, RNA binding protein, homolog 1 (Drosophila) 1 1
MIRT467191 SPRY4 sprouty homolog 4 (Drosophila) 1 1
MIRT474079 LMBR1L limb region 1 homolog (mouse)-like 1 1
MIRT479083 CNNM4 cyclin M4 1 1
MIRT479474 CDK2 cyclin-dependent kinase 2 1 1
MIRT490339 PEX10 peroxisomal biogenesis factor 10 1 1
MIRT490941 PPM1F protein phosphatase, Mg2+/Mn2+ dependent, 1F 1 1
MIRT495155 CNGA2 cyclic nucleotide gated channel alpha 2 1 2
MIRT515994 PRPF4 PRP4 pre-mRNA processing factor 4 homolog (yeast) 1 1
MIRT516984 COX19 cytochrome c oxidase assembly homolog 19 (S. cerevisiae) 1 2
MIRT517130 KCTD21 potassium channel tetramerisation domain containing 21 1 1
MIRT517371 CHST6 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6 1 1
MIRT517989 SLC16A13 solute carrier family 16, member 13 (monocarboxylic acid transporter 13) 1 1
MIRT518769 ZFP14 zinc finger protein 14 homolog (mouse) 1 1
MIRT519182 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT521469 RAB9A RAB9A, member RAS oncogene family 1 1
MIRT522752 LMTK2 lemur tyrosine kinase 2 1 1
MIRT523784 FAM63B family with sequence similarity 63, member B 1 1
MIRT523822 FAM126B family with sequence similarity 126, member B 1 1
MIRT524595 CACYBP calcyclin binding protein 1 1
MIRT525888 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) 1 1
MIRT530077 PACS1 phosphofurin acidic cluster sorting protein 1 1 1
MIRT530431 SULT1B1 sulfotransferase family, cytosolic, 1B, member 1 1 1
MIRT537077 GPR137C G protein-coupled receptor 137C 1 1
MIRT538484 CLOCK clock homolog (mouse) 1 1
MIRT551526 EMB embigin 1 1
MIRT553512 TMEM245 transmembrane protein 245 1 2
MIRT553926 STC2 stanniocalcin 2 1 2
MIRT554902 RB1 retinoblastoma 1 1 1
MIRT567196 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT568747 MTRNR2L1 MT-RNR2-like 1 1 1
MIRT576344 Pxdn peroxidasin homolog (Drosophila) 1 1
MIRT619280 FAM26E family with sequence similarity 26, member E 1 1
MIRT622859 PDF peptide deformylase (mitochondrial) 1 1
MIRT625648 STAG1 stromal antigen 1 1 1
MIRT633600 HMGN5 high mobility group nucleosome binding domain 5 1 2
MIRT633884 UBE2F ubiquitin-conjugating enzyme E2F (putative) 1 2
MIRT635611 ZNF439 zinc finger protein 439 1 1
MIRT635885 SP110 SP110 nuclear body protein 1 1
MIRT636185 TCEB1 transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) 1 1
MIRT648736 FAM46B family with sequence similarity 46, member B 1 1
MIRT651641 WASF2 WAS protein family, member 2 1 1
MIRT653850 SHE Src homology 2 domain containing E 1 1
MIRT654001 SCO1 SCO1 cytochrome c oxidase assembly protein 1 1
MIRT656746 LDHA lactate dehydrogenase A 1 1
MIRT657998 GALNT10 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10) 1 1
MIRT673811 DARS aspartyl-tRNA synthetase 1 2
MIRT680069 THAP1 THAP domain containing, apoptosis associated protein 1 1 1
MIRT683240 WFDC6 WAP four-disulfide core domain 6 1 1
MIRT683676 MICA MHC class I polypeptide-related sequence A 1 1
MIRT685180 DCTN5 dynactin 5 (p25) 1 1
MIRT686568 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 1
MIRT687839 ISCA2 iron-sulfur cluster assembly 2 homolog (S. cerevisiae) 1 1
MIRT698382 TMED2 transmembrane emp24 domain trafficking protein 2 1 1
MIRT701325 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT705244 BRI3BP BRI3 binding protein 1 1
MIRT705945 ACY1 aminoacylase 1 1 1
MIRT705985 ABHD14A-ACY1 ABHD14A-ACY1 readthrough (non-protein coding) 1 1
MIRT708520 TOP2B topoisomerase (DNA) II beta 180kDa 1 1
MIRT712720 NCAPG2 non-SMC condensin II complex, subunit G2 1 1
MIRT714969 RAB21 RAB21, member RAS oncogene family 1 1
MIRT718084 ABHD12 abhydrolase domain containing 12 1 1
MIRT720056 CD4 CD4 molecule 1 1
MIRT722101 RPS6KA1 ribosomal protein S6 kinase, 90kDa, polypeptide 1 1 1
MIRT723710 PEAK1 NKF3 kinase family member 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*