Accession ID: MIRT039145 [miRNA, hsa-miR-769-5p :: MIF, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-769LinkOut: [miRBase ]
Synonyms MIRN769, hsa-mir-769, MIR769
Description Homo sapiens miR-769 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-769-5p
Mature Sequence 30| UGAGACCUCUGGGUUCUGAGCU |51
Evidence Experimental
Experiments Cloned
Putative hsa-miR-769-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MIF LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GIF, GLIF, MMIF
Description macrophage migration inhibitory factor (glycosylation-inhibiting factor)
Transcript NM_0024    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MIF LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MIF
(miRNA target sites are highlighted)
>MIF|NM_0024|3'UTR
   1 TAAGAGCCGCAGGGACCCACGCTGTCTGCGCTGGCTCCACCCGGGAACCCGCCGCACGCTGTGTTCTAGGCCCGCCCACC
  81 CCAACCTTCTGGTGGGGAGAAATAAACGGTTTAGAGACT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucgagUCUUGGGUCUCCAGAgu 5'
               |||| : |  |||:|  
Target 5' tggggAGAAATAAACGGTTTag 3'
93 - 114 89.00 -5.40
2
miRNA  3' ucGAGU-CUUGGGU-CUCCAGAgu 5'
            | || |:||||| |  ||||  
Target 5' gcCGCAGGGACCCACGCTGTCTgc 3'
6 - 29 88.00 -16.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-769-5p :: MIF    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' tcGAGTCTTGGGTC---TCCAGAGt 5'
            | ||| | |::|   ||| | | 
Target 5' caCCCAGCAGCTGGCGCAGGCCACc 3'
12 - 36
2
miRNA  3' tcgagtcttGGGTCTCCAGagt 5'
                   |:| ||| ||   
Target 5' -------ctCTCCGAGCTCacc 3'
1 - 15
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
92 hsa-miR-769-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004869 TRAPPC2P1 trafficking protein particle complex 2 pseudogene 1 2 1
MIRT016090 PPP1CA protein phosphatase 1, catalytic subunit, alpha isozyme 1 1
MIRT016091 SCP2 sterol carrier protein 2 1 1
MIRT016092 FAM126B family with sequence similarity 126, member B 1 1
MIRT016093 TAOK2 TAO kinase 2 1 1
MIRT016094 HIC2 hypermethylated in cancer 2 1 1
MIRT016095 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT016096 ATF7 activating transcription factor 7 1 1
MIRT016097 CKAP2L cytoskeleton associated protein 2-like 1 1
MIRT016098 RGMB RGM domain family, member B 1 1
MIRT016099 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT039138 FBXO45 F-box protein 45 1 1
MIRT039139 CLYBL citrate lyase beta like 1 1
MIRT039140 ATP11A ATPase, class VI, type 11A 1 1
MIRT039141 FANCD2 Fanconi anemia, complementation group D2 1 1
MIRT039142 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT039143 IGSF3 immunoglobulin superfamily, member 3 1 1
MIRT039144 PARP6 poly (ADP-ribose) polymerase family, member 6 1 1
MIRT039145 MIF macrophage migration inhibitory factor (glycosylation-inhibiting factor) 1 1
MIRT039146 NCSTN nicastrin 1 1
MIRT039147 ARHGEF3 Rho guanine nucleotide exchange factor (GEF) 3 1 1
MIRT039148 PSMD3 proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 1 1
MIRT039149 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT039150 GPCPD1 glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae) 1 1
MIRT039151 H2AFY2 H2A histone family, member Y2 1 1
MIRT039152 KIAA1211 KIAA1211 1 1
MIRT039153 LPIN2 lipin 2 1 1
MIRT039154 RPL14 ribosomal protein L14 1 1
MIRT039155 AK1 adenylate kinase 1 1 1
MIRT039156 ZC3H14 zinc finger CCCH-type containing 14 1 1
MIRT039157 MGAT5 mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase 1 1
MIRT039158 TMEM165 transmembrane protein 165 1 1
MIRT039159 AKAP2 A kinase (PRKA) anchor protein 2 1 1
MIRT039160 CNOT6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT039161 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT039162 NCLN nicalin homolog (zebrafish) 1 1
MIRT039163 WDR18 WD repeat domain 18 1 1
MIRT039164 NABP2 oligonucleotide/oligosaccharide-binding fold containing 2B 1 1
MIRT039165 KDM2A lysine (K)-specific demethylase 2A 1 1
MIRT039166 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT039167 RNF40 ring finger protein 40 1 1
MIRT039168 CREBBP CREB binding protein 1 1
MIRT039169 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT039170 GGPS1 geranylgeranyl diphosphate synthase 1 1 1
MIRT039171 ARL1 ADP-ribosylation factor-like 1 1 1
MIRT039172 ADPGK ADP-dependent glucokinase 1 1
MIRT039173 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT039174 NBPF15 neuroblastoma breakpoint family, member 15 1 1
MIRT039175 WDR62 WD repeat domain 62 1 1
MIRT039176 LSM4 LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT039177 ACTN4 actinin, alpha 4 1 1
MIRT039178 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 1 1
MIRT039179 TRMT61A tRNA methyltransferase 61 homolog A (S. cerevisiae) 1 1
MIRT039180 HELLS helicase, lymphoid-specific 1 1
MIRT039181 DPH5 DPH5 homolog (S. cerevisiae) 1 1
MIRT039182 EIF5A eukaryotic translation initiation factor 5A 1 1
MIRT039183 PKM pyruvate kinase, muscle 1 1
MIRT039184 FAM49B family with sequence similarity 49, member B 1 1
MIRT039185 HIST2H4B histone cluster 2, H4b 1 1
MIRT039186 CTC1 chromosome 17 open reading frame 68 1 1
MIRT039187 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT039188 SPAG5 sperm associated antigen 5 1 1
MIRT039189 GART phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase 1 1
MIRT039190 GSE1 KIAA0182 1 1
MIRT039191 TRIM59 tripartite motif-containing 59 1 1
MIRT039192 EIF4E eukaryotic translation initiation factor 4E 1 1
MIRT039193 GOT1 glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) 1 1
MIRT039194 BARX2 BARX homeobox 2 1 1
MIRT039195 BCAT1 branched chain amino-acid transaminase 1, cytosolic 1 1
MIRT039196 TFRC transferrin receptor (p90, CD71) 1 1
MIRT039197 PRUNE2 prune homolog 2 (Drosophila) 1 1
MIRT039198 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT039199 SPIRE1 spire homolog 1 (Drosophila) 1 1
MIRT039200 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 1 1
MIRT039201 CAPNS1 calpain, small subunit 1 1 1
MIRT039202 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT039203 LRBA LPS-responsive vesicle trafficking, beach and anchor containing 1 1
MIRT039204 MTG2 GTP binding protein 5 (putative) 1 1
MIRT039205 MCCC2 methylcrotonoyl-CoA carboxylase 2 (beta) 1 1
MIRT039206 GLA galactosidase, alpha 1 1
MIRT039207 FOXK2 forkhead box K2 1 1
MIRT039208 DDX24 DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 1 1
MIRT039209 UBQLN4 ubiquilin 4 1 1
MIRT039210 PRDX4 peroxiredoxin 4 1 1
MIRT039211 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT039212 TCERG1 transcription elongation regulator 1 1 1
MIRT039213 QRSL1 glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 1 1
MIRT039214 INTS1 integrator complex subunit 1 1 1
MIRT039215 SRSF4 splicing factor, arginine/serine-rich 4 1 1
MIRT039216 FAM21B family with sequence similarity 21, member B 1 1
MIRT039217 FKRP fukutin related protein 1 1
MIRT039218 TMEM97 transmembrane protein 97 1 1