Accession ID: MIRT039331 [miRNA, hsa-miR-425-5p :: HSP90AA1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-425LinkOut: [miRBase ]
Synonyms MIRN425, hsa-mir-425, MIR425
Description Homo sapiens miR-425 stem-loop
Comment The mature sequences were previously named miR-425-5p and miR-425-3p in .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-425-5p
Mature Sequence 14| AAUGACACGAUCACUCCCGUUGA |36
Evidence Experimental
Experiments Cloned
Putative hsa-miR-425-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol HSP90AA1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ31884, HSP86, HSP89A, HSP90A, HSP90N, HSPC1, HSPCA, HSPCAL1, HSPCAL4, HSPN, Hsp89, Hsp90, LAP2
Description heat shock protein 90kDa alpha (cytosolic), class A member 1
Transcript NM_0010179    LinkOut: [ RefSeq ]
Other Transcripts NM_0053   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on HSP90AA1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of HSP90AA1
(miRNA target sites are highlighted)
>HSP90AA1|NM_0010179|3'UTR
   1 TAATCTCTGGCTGAGGGATGACTTACCTGTTCAGTACTCTACAATTCCTCTGATAATATATTTTCAAGGATGTTTTTCTT
  81 TATTTTTGTTAATATTAAAAAGTCTGTATGGCATGACAACTACTTTAAGGGGAAGATAAGATTTCTGTCTACTAAGTGAT
 161 GCTGTGATACCTTAGGCACTAAAGCAGAGCTAGTAATGCTTTTTGAGTTTCATGTTGGTTTATTTTCACAGATTGGGGTA
 241 ACGTGCACTGTAAGACGTATGTAACATGATGTTAACTTTGTGGTCTAAAGTGTTTAGCTGTCAAGCCGGATGCCTAAGTA
 321 GACCAAATCTTGTTATTGAAGTGTTCTGAGCTGTATCTTGATGTTTAGAAAAGTATTCGTTACATCTTGTAGGATCTACT
 401 TTTTGAACTTTTCATTCCCTGTAGTTGACAATTCTGCATGTACTAGTCCTCTAGAAATAGGTTAAACTGAAGCAACTTGA
 481 TGGAAGGATCTCTCCACAGGGCTTGTTTTCCAAAGAAAAGTATTGTTTGGAGGAGCAAAGTTAAAAGCCTACCTAAGCAT
 561 ATCGTAAAGCTGTTCAAAAATAACTCAGACCCAGTCTTGTGGATGGAAATGTAGTGCTCGAGTCACATTCTGCTTAAAGT
 641 TGTAACAAATACAGATGAGTTAAAAGATATTGTGTGACAGTGTCTTATTTAGGGGGAAAGGGGAGTATCTGGATGACAGT
 721 TAGTGCCAAAATGTAAAACATGAGGCGCTAGCAGGAGATGGTTAAACACTAGCTGCTCCAAGGGTTGACATGGTCTTCCC
 801 AGCATGTACTCAGCAGGTGTGGGGTGGAGCACACGTAGGCACAGAAAACAGGAATGCAGACAACATGCATCCCCTGCGTC
 881 CATGAGTTACATGTGTTCTCTTAGTGTCCACGTTGTTTTGATGTTATTCATGGAATACCTTCTGTGTTAAATACAGTCAC
 961 TTAATTCCTTGGCCTTAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aguugccCUCACUAGCACAGUAa 5'
                 | ||||  ||||| | 
Target 5' agatattGTGTGACAGTGTCTTa 3'
665 - 687 124.00 -10.40
2
miRNA  3' agUUGCCCUCACUAGCACAGUaa 5'
            ||  | |||| ||| ||||  
Target 5' ggAAATGTAGTGCTCGAGTCAca 3'
605 - 627 121.00 -12.70
3
miRNA  3' aguugcCCUCACU---AG-CACAGUaa 5'
                ||| | |   || ||||:|  
Target 5' attcatGGAAT-ACCTTCTGTGTTAaa 3'
926 - 951 108.00 -7.72
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-425-5p :: HSP90AA1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
79 hsa-miR-425-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT016648 ZNF700 zinc finger protein 700 1 1
MIRT016649 FAM89A family with sequence similarity 89, member A 1 1
MIRT016650 FAM122B family with sequence similarity 122B 1 1
MIRT016651 ZNF417 zinc finger protein 417 1 1
MIRT016652 BHLHB9 basic helix-loop-helix domain containing, class B, 9 1 1
MIRT016653 DHCR7 7-dehydrocholesterol reductase 1 1
MIRT016654 MIDN midnolin 1 1
MIRT016655 SHCBP1 SHC SH2-domain binding protein 1 1 1
MIRT016656 BIRC5 baculoviral IAP repeat-containing 5 1 1
MIRT016657 PPP2CB protein phosphatase 2, catalytic subunit, beta isozyme 1 1
MIRT016658 CCND1 cyclin D1 1 1
MIRT016659 YRDC yrdC domain containing (E. coli) 1 1
MIRT016660 AP3D1 adaptor-related protein complex 3, delta 1 subunit 1 1
MIRT016661 DDX6 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 1 1
MIRT016662 LRRC40 leucine rich repeat containing 40 1 1
MIRT016663 FAM122A family with sequence similarity 122A 1 1
MIRT016664 ZNF805 zinc finger protein 805 1 1
MIRT016665 PPP1R15B protein phosphatase 1, regulatory (inhibitor) subunit 15B 1 1
MIRT016666 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase, type II, alpha 1 1
MIRT016667 BEX4 brain expressed, X-linked 4 1 1
MIRT016668 CELF2 CUGBP, Elav-like family member 2 1 1
MIRT016669 WRB tryptophan rich basic protein 1 1
MIRT016670 MAP2K6 mitogen-activated protein kinase kinase 6 1 1
MIRT016671 TAOK1 TAO kinase 1 1 1
MIRT016672 MZT1 chromosome 13 open reading frame 37 1 1
MIRT016673 KAT6A MYST histone acetyltransferase (monocytic leukemia) 3 1 1
MIRT016674 SFT2D1 SFT2 domain containing 1 1 1
MIRT016675 BCOR BCL6 corepressor 1 1
MIRT016676 MED4 mediator complex subunit 4 1 1
MIRT016677 DICER1 dicer 1, ribonuclease type III 1 1
MIRT016678 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT039301 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT039302 PDZD8 PDZ domain containing 8 1 1
MIRT039303 IGSF1 immunoglobulin superfamily, member 1 1 1
MIRT039304 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT039305 KIFAP3 kinesin-associated protein 3 1 1
MIRT039306 PLOD2 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 1 1
MIRT039307 TXN2 thioredoxin 2 1 1
MIRT039308 RUSC1 RUN and SH3 domain containing 1 1 1
MIRT039309 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT039310 LRP11 low density lipoprotein receptor-related protein 11 1 1
MIRT039311 PRR13 proline rich 13 1 1
MIRT039312 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 1
MIRT039313 ZBTB21 zinc finger protein 295 1 1
MIRT039314 CCDC144NL coiled-coil domain containing 144 family, N-terminal like 1 1
MIRT039315 PPRC1 peroxisome proliferator-activated receptor gamma, coactivator-related 1 1 1
MIRT039316 QKI quaking homolog, KH domain RNA binding (mouse) 1 1
MIRT039317 COPS7B COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) 1 1
MIRT039318 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT039319 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT039320 DENR density-regulated protein 1 1
MIRT039321 CLU clusterin 1 1
MIRT039322 EIF3G eukaryotic translation initiation factor 3, subunit G 1 1
MIRT039323 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 1 1
MIRT039324 USMG5 up-regulated during skeletal muscle growth 5 homolog (mouse) 1 1
MIRT039325 WASF2 WAS protein family, member 2 1 1
MIRT039326 ZNF148 zinc finger protein 148 1 1
MIRT039327 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT039328 THOP1 thimet oligopeptidase 1 1 1
MIRT039329 CKS1B CDC28 protein kinase regulatory subunit 1B 1 1
MIRT039330 FOXK2 forkhead box K2 1 1
MIRT039331 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT039332 PPAT phosphoribosyl pyrophosphate amidotransferase 1 1
MIRT039333 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT039334 VPS39 vacuolar protein sorting 39 homolog (S. cerevisiae) 1 1
MIRT039335 NPNT nephronectin 1 1
MIRT039336 RABL6 chromosome 9 open reading frame 86 1 1
MIRT039337 RUFY2 RUN and FYVE domain containing 2 1 1
MIRT039338 SNRNP200 small nuclear ribonucleoprotein 200kDa (U5) 1 1
MIRT039339 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT039340 MED22 mediator complex subunit 22 1 1
MIRT039341 RPS28 ribosomal protein S28 1 1
MIRT039342 RRM2 ribonucleotide reductase M2 1 1
MIRT039343 PSMD8 proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 1 1
MIRT039344 INPP5E inositol polyphosphate-5-phosphatase, 72 kDa 1 1
MIRT039345 SLC25A3 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 1 1
MIRT039346 GNB5 guanine nucleotide binding protein (G protein), beta 5 1 1
MIRT039347 WDR6 WD repeat domain 6 1 1
MIRT039348 NADK NAD kinase 1 1