Accession ID: MIRT039416 [miRNA, hsa-miR-421 :: HSP90AA1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-421LinkOut: [miRBase ]
Synonyms MIRN421, hsa-mir-421, MIR421
Description Homo sapiens miR-421 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-421
Mature Sequence 48| AUCAACAGACAUUAAUUGGGCGC |70
Evidence Experimental
Experiments Microarray
Putative hsa-miR-421 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol HSP90AA1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ31884, HSP86, HSP89A, HSP90A, HSP90N, HSPC1, HSPCA, HSPCAL1, HSPCAL4, HSPN, Hsp89, Hsp90, LAP2
Description heat shock protein 90kDa alpha (cytosolic), class A member 1
Transcript NM_0010179    LinkOut: [ RefSeq ]
Other Transcripts NM_0053   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on HSP90AA1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of HSP90AA1
(miRNA target sites are highlighted)
>HSP90AA1|NM_0010179|3'UTR
   1 TAATCTCTGGCTGAGGGATGACTTACCTGTTCAGTACTCTACAATTCCTCTGATAATATATTTTCAAGGATGTTTTTCTT
  81 TATTTTTGTTAATATTAAAAAGTCTGTATGGCATGACAACTACTTTAAGGGGAAGATAAGATTTCTGTCTACTAAGTGAT
 161 GCTGTGATACCTTAGGCACTAAAGCAGAGCTAGTAATGCTTTTTGAGTTTCATGTTGGTTTATTTTCACAGATTGGGGTA
 241 ACGTGCACTGTAAGACGTATGTAACATGATGTTAACTTTGTGGTCTAAAGTGTTTAGCTGTCAAGCCGGATGCCTAAGTA
 321 GACCAAATCTTGTTATTGAAGTGTTCTGAGCTGTATCTTGATGTTTAGAAAAGTATTCGTTACATCTTGTAGGATCTACT
 401 TTTTGAACTTTTCATTCCCTGTAGTTGACAATTCTGCATGTACTAGTCCTCTAGAAATAGGTTAAACTGAAGCAACTTGA
 481 TGGAAGGATCTCTCCACAGGGCTTGTTTTCCAAAGAAAAGTATTGTTTGGAGGAGCAAAGTTAAAAGCCTACCTAAGCAT
 561 ATCGTAAAGCTGTTCAAAAATAACTCAGACCCAGTCTTGTGGATGGAAATGTAGTGCTCGAGTCACATTCTGCTTAAAGT
 641 TGTAACAAATACAGATGAGTTAAAAGATATTGTGTGACAGTGTCTTATTTAGGGGGAAAGGGGAGTATCTGGATGACAGT
 721 TAGTGCCAAAATGTAAAACATGAGGCGCTAGCAGGAGATGGTTAAACACTAGCTGCTCCAAGGGTTGACATGGTCTTCCC
 801 AGCATGTACTCAGCAGGTGTGGGGTGGAGCACACGTAGGCACAGAAAACAGGAATGCAGACAACATGCATCCCCTGCGTC
 881 CATGAGTTACATGTGTTCTCTTAGTGTCCACGTTGTTTTGATGTTATTCATGGAATACCTTCTGTGTTAAATACAGTCAC
 961 TTAATTCCTTGGCCTTAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgcggGUUAAUUACAGACAACUa 5'
               | | ||||| :| |||| 
Target 5' cagagCTAGTAATGCTTTTTGAg 3'
185 - 207 118.00 -6.70
2
miRNA  3' cgCGGGUUAAUUAC---A--GACAACUa 5'
            | |::|  :|||   |  ||||| | 
Target 5' ctGGCTGAGGGATGACTTACCTGTTCAg 3'
7 - 34 115.00 -5.84
3
miRNA  3' cgCGGGU-UAA--UUACAGACA-ACUa 5'
            |:: | |||  || |||||| ||: 
Target 5' ttGTTAATATTAAAAAGTCTGTATGGc 3'
86 - 112 115.00 -9.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-421 :: HSP90AA1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
144 hsa-miR-421 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001103 RBMXL1 RNA binding motif protein, X-linked-like 1 3 1
MIRT001104 CBX7 chromobox homolog 7 3 1
MIRT003215 ATM ataxia telangiectasia mutated 4 1
MIRT006190 SMAD4 SMAD family member 4 3 1
MIRT016100 NSL1 NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT016101 SRSF7 splicing factor, arginine/serine-rich 7, 35kDa 1 1
MIRT016102 GID8 chromosome 20 open reading frame 11 1 1
MIRT016103 EIF3K eukaryotic translation initiation factor 3, subunit K 1 1
MIRT016104 MAPK8 mitogen-activated protein kinase 8 1 2
MIRT016105 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT016106 ZNF30 zinc finger protein 30 1 1
MIRT016107 GID4 chromosome 17 open reading frame 39 1 1
MIRT016108 DDX39A DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 1 2
MIRT016109 ZNF678 zinc finger protein 678 1 1
MIRT016110 MIS18BP1 chromosome 14 open reading frame 106 1 1
MIRT016111 NXPE3 family with sequence similarity 55, member C 1 1
MIRT016112 RNF138 ring finger protein 138 1 1
MIRT016113 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT016114 RGMB RGM domain family, member B 1 1
MIRT016115 SREK1IP1 SFRS12-interacting protein 1 1 1
MIRT016116 TAF9 TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa 1 1
MIRT016117 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT016118 CD46 CD46 molecule, complement regulatory protein 1 1
MIRT016119 NDC1 transmembrane protein 48 1 1
MIRT016120 CREBZF CREB/ATF bZIP transcription factor 1 1
MIRT016121 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 1
MIRT016122 CEBPB CCAAT/enhancer binding protein (C/EBP), beta 1 1
MIRT016123 FAM160B1 family with sequence similarity 160, member B1 1 1
MIRT016124 VAPA VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa 1 1
MIRT016125 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 1
MIRT016126 CREBRF chromosome 5 open reading frame 41 1 1
MIRT016127 FAM122A family with sequence similarity 122A 1 1
MIRT016128 DNAJC27 DnaJ (Hsp40) homolog, subfamily C, member 27 1 1
MIRT016129 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 1
MIRT016130 RND3 Rho family GTPase 3 1 1
MIRT016131 ATG2B ATG2 autophagy related 2 homolog B (S. cerevisiae) 1 1
MIRT016132 TTC37 tetratricopeptide repeat domain 37 1 1
MIRT016133 RBBP7 retinoblastoma binding protein 7 1 1
MIRT016134 AFF4 AF4/FMR2 family, member 4 1 1
MIRT016135 NIPBL Nipped-B homolog (Drosophila) 1 1
MIRT039353 LMCD1 LIM and cysteine-rich domains 1 1 1
MIRT039354 RANBP2 RAN binding protein 2 1 1
MIRT039355 USO1 USO1 vesicle docking protein homolog (yeast) 1 1
MIRT039356 AP3B1 adaptor-related protein complex 3, beta 1 subunit 1 1
MIRT039357 PAXBP1 GC-rich sequence DNA-binding factor 1 1 1
MIRT039358 PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha 1 1
MIRT039359 FAT2 FAT tumor suppressor homolog 2 (Drosophila) 1 1
MIRT039360 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT039361 GCSH glycine cleavage system protein H (aminomethyl carrier) 1 1
MIRT039362 LARS2 leucyl-tRNA synthetase 2, mitochondrial 1 1
MIRT039363 RPL18A ribosomal protein L18a 1 1
MIRT039364 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT039365 DUSP3 dual specificity phosphatase 3 1 1
MIRT039366 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 1
MIRT039367 HIST2H4B histone cluster 2, H4b 1 1
MIRT039368 DDX20 DEAD (Asp-Glu-Ala-Asp) box polypeptide 20 1 1
MIRT039369 CAP1 CAP, adenylate cyclase-associated protein 1 (yeast) 1 1
MIRT039370 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT039371 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT039372 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT039373 CEP57 centrosomal protein 57kDa 1 1
MIRT039374 RPL26L1 ribosomal protein L26-like 1 1 1
MIRT039375 PCNXL4 chromosome 14 open reading frame 135 1 1
MIRT039376 SENP7 SUMO1/sentrin specific peptidase 7 1 1
MIRT039377 DOK4 docking protein 4 1 1
MIRT039378 OTUD1 OTU domain containing 1 1 1
MIRT039379 CDC42SE2 CDC42 small effector 2 1 1
MIRT039380 MRPL38 mitochondrial ribosomal protein L38 1 1
MIRT039381 ATXN2L ataxin 2-like 1 1
MIRT039382 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 1
MIRT039383 GFOD2 glucose-fructose oxidoreductase domain containing 2 1 1
MIRT039384 RAB2B RAB2B, member RAS oncogene family 1 1
MIRT039385 PPP1R13B protein phosphatase 1, regulatory (inhibitor) subunit 13B 1 1
MIRT039386 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT039387 PARP10 poly (ADP-ribose) polymerase family, member 10 1 1
MIRT039388 PQLC2 PQ loop repeat containing 2 1 1
MIRT039389 SLC25A6 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 1 1
MIRT039390 PRR7 proline rich 7 (synaptic) 1 1
MIRT039391 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT039392 FBXO11 F-box protein 11 1 1
MIRT039393 AHNAK AHNAK nucleoprotein 1 1
MIRT039394 GRK6 G protein-coupled receptor kinase 6 1 1
MIRT039395 SLIT1 slit homolog 1 (Drosophila) 1 1
MIRT039396 SLC9A6 solute carrier family 9 (sodium/hydrogen exchanger), member 6 1 1
MIRT039397 FAM172A family with sequence similarity 172, member A 1 1
MIRT039398 SPECC1L cytospin A 1 1
MIRT039399 SEPT2 septin 2 1 1
MIRT039400 CTC1 chromosome 17 open reading frame 68 1 1
MIRT039401 CDC37 cell division cycle 37 homolog (S. cerevisiae) 1 1
MIRT039402 ZNF280C zinc finger protein 280C 1 1
MIRT039403 ISY1 ISY1 splicing factor homolog (S. cerevisiae) 1 1
MIRT039404 ZMYND8 zinc finger, MYND-type containing 8 1 1
MIRT039405 SRP9 signal recognition particle 9kDa 1 1
MIRT039406 GAREML family with sequence similarity 59, member B 1 1
MIRT039407 INPP4A inositol polyphosphate-4-phosphatase, type I, 107kDa 1 1
MIRT039408 MLXIP MLX interacting protein 1 1
MIRT039409 DUS3L dihydrouridine synthase 3-like (S. cerevisiae) 1 1
MIRT039410 FKBP8 FK506 binding protein 8, 38kDa 1 1
MIRT039411 DNAJC16 DnaJ (Hsp40) homolog, subfamily C, member 16 1 1
MIRT039412 COPRS chromosome 17 open reading frame 79 1 1
MIRT039413 TUBA1B tubulin, alpha 1b 1 1
MIRT039414 CASP2 caspase 2, apoptosis-related cysteine peptidase 1 1
MIRT039415 RPS18 ribosomal protein S18 1 1
MIRT039416 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT039417 COPA coatomer protein complex, subunit alpha 1 1
MIRT039418 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT039419 RHOB ras homolog gene family, member B 1 1
MIRT039420 PSME1 proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) 1 1
MIRT039421 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT039422 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT039423 ZC3H7B zinc finger CCCH-type containing 7B 1 1
MIRT039424 AMZ2 archaelysin family metallopeptidase 2 1 1
MIRT039425 HTT huntingtin 1 1
MIRT039426 LBR lamin B receptor 1 1
MIRT039427 NCDN neurochondrin 1 1
MIRT039428 RASL10B RAS-like, family 10, member B 1 1
MIRT039429 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT039430 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT039431 ITPK1 inositol 1,3,4-triphosphate 5/6 kinase 1 1
MIRT039432 RPS10 ribosomal protein S10 1 1
MIRT039433 SRPR signal recognition particle receptor (docking protein) 1 1
MIRT039434 FAM168B family with sequence similarity 168, member B 1 1
MIRT039435 CMAS cytidine monophosphate N-acetylneuraminic acid synthetase 1 1
MIRT039436 TRIM27 tripartite motif-containing 27 1 1
MIRT039437 NR3C1 nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) 1 1
MIRT039438 ATP6V0C ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c 1 1
MIRT039439 ZXDA zinc finger, X-linked, duplicated A 1 1
MIRT039440 SFXN1 sideroflexin 1 1 1
MIRT039441 DFFB DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase) 1 1
MIRT039442 RASAL1 RAS protein activator like 1 (GAP1 like) 1 1
MIRT039443 KIAA0100 KIAA0100 1 1
MIRT039444 CD276 CD276 molecule 1 1
MIRT039445 RHOBTB2 Rho-related BTB domain containing 2 1 1
MIRT039446 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT039447 FAM32A family with sequence similarity 32, member A 1 1
MIRT039448 RAB26 RAB26, member RAS oncogene family 1 1
MIRT039449 TMEM109 transmembrane protein 109 1 1
MIRT039450 NCAPG non-SMC condensin I complex, subunit G 1 1
MIRT039451 PRCC papillary renal cell carcinoma (translocation-associated) 1 1
MIRT039452 PPP2CB protein phosphatase 2, catalytic subunit, beta isozyme 1 1
MIRT039453 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT039454 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 1
MIRT039455 HADHA hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit 1 1
MIRT039456 LEPREL4 synaptonemal complex protein SC65 1 1