Accession ID: MIRT039602 [miRNA, hsa-miR-616-5p :: ATP7B, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-616LinkOut: [miRBase ]
Synonyms MIRN616, hsa-mir-616, MIR616
Description Homo sapiens miR-616 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-616-5p
Mature Sequence 16| ACUCAAAACCCUUCAGUGACUU |37
Evidence Experimental
Experiments SAGE
Putative hsa-miR-616-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ATP7B LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms PWD, WC1, WD, WND
Description ATPase, Cu++ transporting, beta polypeptide
Transcript NM_000053    LinkOut: [ RefSeq ]
Other Transcripts NM_001005918   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ATP7B LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ATP7B
(miRNA target sites are highlighted)
>ATP7B|NM_000053|3'UTR
   1 TGACTTCAGGCAGGCGGGCCGGGGCAGGGACTTGCCTCCACTCACCACAAGCTGAGCAGGACAGCCAGCAGCAGGATGGG
  81 CTGAGCTAGCCTCCAGCTTTGGGGACTTCCGCTCCCTGGATATGTCCAGTCATCCTGCCCTGCAGCACGCGGCCTTGTCT
 161 GGGTGCAGCTGGGCTTGGCCTGGAGAGGACGGCCCTGCCTGCCTCTTGGCCTCACGGGACCGTCAGCATGGGCTTTGTCT
 241 TGGACTCTAGTCCTTGGCTGGACTGTAGAAGGTGAGAGGCGAGTCACCCTCCTCACAGACCTCTGCTTGGAGTATTTAGG
 321 ATGACTGCTGTGAAATGGAGAACAGTTTCATCAGGACCAAAAAACCTCACTGGGCCTTTCCAGAGAACTGCAGACCTCAC
 401 TGTCAGGGTCTTTCTGATGACGCCTGTCTGTGTGCATCATGTTTCTGAGACCACAGTTTACCTCAGGTGTGCCTGTTGCT
 481 TTCTTCCTGCATAGTCTGTTCCTTTCTTCGTACATAGTCTGTTCCTTTTCTCTCCTGTGTGCTTGTCAGTGGGGACCCCT
 561 CGCAACCCTGCCTGTCACCTGGGAGGGTGGGACCAATGTCCTTGTGGTCTTTGCTGCTGCTCTCAGGCGCTTCTCCAATG
 641 CTCTGGAGTGTGCATTTCAGCTTGAACCTGCTTCCTGGCTCACACATCCCCAGCCAGGGAGCTTGCCACACTCTTCTTCA
 721 AGTTGAGGAGAGTTCTTTTTTGCTTAAAGCCCCCTTCTCCATGGAGTGTTGGCTTCTCAATAGAGTGTTGTTGCTGACCA
 801 GCTGGAGTGAGGGCCTCAGAGCCTGACCTGAGAGTCCGTACTCGGCTTCCTGTGGGGTGTAGGTTCTCGCGATTCAGGAC
 881 GTCCTTCCATATCCCTGCCCAGCCTGTGGTGCTTGAAACGTTTGCCCCATGGGAAACGTATGTGTGCAGGAGCCTCCCTG
 961 CACGGCCCAAGGGGCTTCGTTTTCAGTCTTCTGACTGTCACCTCGTGGGGTTCAGTAGAGAATTCATGTGACTAGCGCCT
1041 GGCCTTGTGTGGCTTGGAGGAAATGGTACTGCCCAAATAGGAGGAAAACACAGCCTCCCTGAGCCTGCATTCTGCACGCT
1121 GCCCAGGGGCTTCAGAAAAGGAGTGGCCACAGCACCCCGAAGGGAGCATCTGTTTACCTGGCAGTGGCTCTCAGAGCAGC
1201 AGAACGGGTTCAGTTTTAGACTCTGAAGTTGGTTGTGATTGACAGAACCCTTTGGGAGCAAACTAGTAGAGTTGGATTAA
1281 ATTCTGGGTGAAACCCTTTTCTCCCACACAAAATAGTTTTAGTGATTTTTTTCATTGTCCATTACTTGCCAGGGGCAGTT
1361 TTAGCAGCACTTTTGATAGATTACGTCTAATCCTCCCAACCAACCAGCAGGGTAGCTATTACTGTCCACATTTTACAGGC
1441 AAGGAAACAGGCTCCAAGAGGCTGAGGACTTTGCCCAGGATGACATAGCCAATGGACAAGCAGTGTCTGTCAGCTGTGAA
1521 GGCTTCACTCTTATTGTCCTTCTACCTTGAATAGAAGTTTTCCTGATAAGAATAAACGAGGAAAAGGTCCTTGCCTCCTG
1601 GAAGAACAAATCTACCAGGTGATCTATTCATTGTTTCAACTCAGAATGCACTTGATTCAGGAGGTCATCTGACCTTCACC
1681 TTGGATGGTTAGTTTCACTTTTTACATATAGTTTTTGCAGGGTTTTATTTTATAAAATCCAAGCGCGCTGTTGATTGTGT
1761 TTTCCTTGTTTTCAGCCCCCCCACTCCAGCCCGCAGCACATTTCCGCTGTCCGTCAGTAATTGTGTCCTCTCTTTATGCT
1841 TGCTTGGGGAATGTTGTTTTCTGACTAGGCTGATCATTATCTAAAGAATCTAATTCTGTTGATTTTTAAAACTTTTAGGA
1921 CCATAAACGTTGTGTTCATATATGGACATGGAAATATTTATATAATTTTATAGAAAATAACCTTTTAGATGGTCAAAGTG
2001 TAAGGAGTTTTTTTGTCAGATAATCATTTCTACTTCAAAAACATTTCATGCAATATTAGAATAAAGTTCCTGTCATTCCT
2081 CTAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuCAGUGACUUC--CCAAAACUca 5'
            | | ||||||  |||| |||  
Target 5' taGACTCTGAAGTTGGTTGTGAtt 3'
1217 - 1240 122.00 -11.70
2
miRNA  3' uucaGUGAC---UUCC------CAAAACUCa 5'
              ||| |   ||||      ||||| || 
Target 5' cctgCACGGCCCAAGGGGCTTCGTTTTCAGt 3'
957 - 987 120.00 -10.00
3
miRNA  3' uucAGUGACUUCCCAAAAC-UCa 5'
             |:||  |  | ||||| || 
Target 5' tttTTACATATAGTTTTTGCAGg 3'
1699 - 1721 119.00 -7.69
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-616-5p :: ATP7B    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ttcagtgacttCCCAAAACTCa 5'
                     |||||||||| 
Target 5' ----------tGGGTTTTGAGg 3'
1 - 12
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
329 hsa-miR-616-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT039602 ATP7B ATPase, Cu++ transporting, beta polypeptide 1 1
MIRT039603 DRG2 developmentally regulated GTP binding protein 2 1 1
MIRT055806 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT056770 ARID5B AT rich interactive domain 5B (MRF1-like) 1 1
MIRT082263 RPS16 ribosomal protein S16 1 1
MIRT142439 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT161602 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT168691 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 3
MIRT173655 RAD23B RAD23 homolog B (S. cerevisiae) 1 1
MIRT182044 SLC35E2 solute carrier family 35, member E2 1 1
MIRT189160 DCUN1D2 DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) 1 1
MIRT241596 AMOTL1 angiomotin like 1 1 1
MIRT250459 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 2
MIRT252656 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 1
MIRT323456 PAG1 phosphoprotein associated with glycosphingolipid microdomains 1 1 1
MIRT323960 PTBP3 polypyrimidine tract binding protein 3 1 2
MIRT363886 MCM4 minichromosome maintenance complex component 4 1 1
MIRT402360 CDK6 cyclin-dependent kinase 6 1 3
MIRT408461 MTX3 metaxin 3 1 1
MIRT441346 TOM1L2 target of myb1-like 2 (chicken) 1 1
MIRT442435 CACNG8 calcium channel, voltage-dependent, gamma subunit 8 1 2
MIRT443091 PTPRN2 protein tyrosine phosphatase, receptor type, N polypeptide 2 1 1
MIRT443959 S1PR2 sphingosine-1-phosphate receptor 2 1 1
MIRT444576 NCOA4 nuclear receptor coactivator 4 1 1
MIRT446706 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT446895 MCM9 minichromosome maintenance complex component 9 1 1
MIRT450286 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT475563 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT496195 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT496411 PARVB parvin, beta 1 1
MIRT497382 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 1 2
MIRT497747 OXGR1 oxoglutarate (alpha-ketoglutarate) receptor 1 1 1
MIRT497962 TWISTNB TWIST neighbor 1 1
MIRT498754 RPL37A ribosomal protein L37a 1 2
MIRT507458 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 1
MIRT508705 SMAD4 SMAD family member 4 1 3
MIRT509386 ASH2L ash2 (absent, small, or homeotic)-like (Drosophila) 1 3
MIRT512588 ZNF223 zinc finger protein 223 1 1
MIRT512696 SLC38A9 solute carrier family 38, member 9 1 2
MIRT522372 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT523343 GUCD1 chromosome 22 open reading frame 13 1 2
MIRT525337 CNGB1 cyclic nucleotide gated channel beta 1 1 1
MIRT525500 ZNF878 zinc finger protein 878 1 1
MIRT525844 FAR2 fatty acyl CoA reductase 2 1 2
MIRT526250 DROSHA drosha, ribonuclease type III 1 1
MIRT526431 PARP15 poly (ADP-ribose) polymerase family, member 15 1 2
MIRT526507 POU5F1B POU class 5 homeobox 1B 1 1
MIRT526776 DNTTIP2 deoxynucleotidyltransferase, terminal, interacting protein 2 1 2
MIRT527292 IFRD1 interferon-related developmental regulator 1 1 2
MIRT528095 UCHL3 ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) 1 1
MIRT529017 HIST1H3E histone cluster 1, H3e 1 2
MIRT529225 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT529868 PSMG1 proteasome (prosome, macropain) assembly chaperone 1 1 2
MIRT530399 SULT1B1 sulfotransferase family, cytosolic, 1B, member 1 1 1
MIRT531384 TXNDC16 thioredoxin domain containing 16 1 2
MIRT532164 SEC14L5 SEC14-like 5 (S. cerevisiae) 1 2
MIRT532209 NAA38 N(alpha)-acetyltransferase 38, NatC auxiliary subunit 1 2
MIRT532237 KLF2 Kruppel-like factor 2 (lung) 1 1
MIRT533995 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 1
MIRT534431 SEC22C SEC22 vesicle trafficking protein homolog C (S. cerevisiae) 1 1
MIRT534650 RNF20 ring finger protein 20, E3 ubiquitin protein ligase 1 1
MIRT535566 OMD osteomodulin 1 1
MIRT536125 MAPK8 mitogen-activated protein kinase 8 1 1
MIRT536147 MAP7 microtubule-associated protein 7 1 1
MIRT536250 LPP LIM domain containing preferred translocation partner in lipoma 1 1
MIRT536291 LIMA1 LIM domain and actin binding 1 1 1
MIRT536768 HOOK3 hook homolog 3 (Drosophila) 1 2
MIRT537189 GDE1 glycerophosphodiester phosphodiesterase 1 1 2
MIRT537622 ERI1 exoribonuclease 1 1 1
MIRT538170 DCDC2 doublecortin domain containing 2 1 1
MIRT539816 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT540590 ERCC1 excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence) 1 2
MIRT542082 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 1
MIRT542302 QTRTD1 queuine tRNA-ribosyltransferase domain containing 1 1 1
MIRT543537 C17orf105 chromosome 17 open reading frame 105 1 1
MIRT544445 ZNF860 zinc finger protein 860 1 1
MIRT545457 CSE1L CSE1 chromosome segregation 1-like (yeast) 1 1
MIRT546744 RNF115 ring finger protein 115 1 1
MIRT548252 FBXO28 F-box protein 28 1 1
MIRT548610 DCTN6 dynactin 6 1 1
MIRT549314 ARHGAP12 Rho GTPase activating protein 12 1 2
MIRT549377 AMOT angiomotin 1 1
MIRT550515 PLCXD1 phosphatidylinositol-specific phospholipase C, X domain containing 1 1 1
MIRT552474 ZNF24 zinc finger protein 24 1 1
MIRT552915 VPS37A vacuolar protein sorting 37 homolog A (S. cerevisiae) 1 2
MIRT553693 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 1
MIRT556632 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT556883 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 1 1
MIRT558156 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT559259 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 1 1
MIRT559730 ACVR1B activin A receptor, type IB 1 1
MIRT559947 TRMT112 tRNA methyltransferase 11-2 homolog (S. cerevisiae) 1 1
MIRT560146 RNPS1 RNA binding protein S1, serine-rich domain 1 1
MIRT560327 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT561392 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT563920 STAT2 signal transducer and activator of transcription 2, 113kDa 1 1
MIRT564028 CEBPB CCAAT/enhancer binding protein (C/EBP), beta 1 1
MIRT564440 PLEKHG3 pleckstrin homology domain containing, family G (with RhoGef domain) member 3 1 2
MIRT564756 ZMAT3 zinc finger, matrin-type 3 1 1
MIRT567614 FAM60A family with sequence similarity 60, member A 1 1
MIRT568229 C11orf24 chromosome 11 open reading frame 24 1 1
MIRT572279 RNF103-CHMP3 RNF103-CHMP3 readthrough 1 1
MIRT573169 CHMP3 charged multivesicular body protein 3 1 1
MIRT574182 TMPO thymopoietin 1 1
MIRT576017 Dhodh dihydroorotate dehydrogenase 1 1
MIRT607584 TANGO2 chromosome 22 open reading frame 25 1 1
MIRT607752 ANGPT4 angiopoietin 4 1 1
MIRT607910 SPRYD4 SPRY domain containing 4 1 1
MIRT609897 SMS spermine synthase 1 1
MIRT609958 ATF7IP2 activating transcription factor 7 interacting protein 2 1 1
MIRT610181 TMEM44 transmembrane protein 44 1 1
MIRT611999 UTP20 UTP20, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT613721 SLC24A4 solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 1 2
MIRT614032 INTS7 integrator complex subunit 7 1 1
MIRT615278 FGF5 fibroblast growth factor 5 1 1
MIRT615808 COQ7 coenzyme Q7 homolog, ubiquinone (yeast) 1 2
MIRT616297 FAM117B family with sequence similarity 117, member B 1 1
MIRT616723 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT617391 C11orf74 chromosome 11 open reading frame 74 1 1
MIRT617583 NDUFB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa 1 1
MIRT617679 JRKL jerky homolog-like (mouse) 1 1
MIRT618208 C22orf39 chromosome 22 open reading frame 39 1 1
MIRT619729 FPR2 formyl peptide receptor 2 1 1
MIRT620236 CCDC65 coiled-coil domain containing 65 1 1
MIRT620271 SLCO3A1 solute carrier organic anion transporter family, member 3A1 1 1
MIRT620343 TLN1 talin 1 1 1
MIRT621009 RPL3L ribosomal protein L3-like 1 1
MIRT621191 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT622947 OTUD7B OTU domain containing 7B 1 1
MIRT623054 NRXN1 neurexin 1 1 1
MIRT623827 GATSL2 GATS protein-like 2 1 1
MIRT624067 EDEM1 ER degradation enhancer, mannosidase alpha-like 1 1 1
MIRT624349 CHRM3 cholinergic receptor, muscarinic 3 1 1
MIRT624393 CD3D CD3d molecule, delta (CD3-TCR complex) 1 1
MIRT625004 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 1 1
MIRT625033 SPC24 SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT625167 CCS copper chaperone for superoxide dismutase 1 1
MIRT625762 DFFA DNA fragmentation factor, 45kDa, alpha polypeptide 1 1
MIRT626076 CWF19L1 CWF19-like 1, cell cycle control (S. pombe) 1 1
MIRT626542 EMCN endomucin 1 1
MIRT627094 GOLGA3 golgin A3 1 1
MIRT627231 ZBTB7A zinc finger and BTB domain containing 7A 1 1
MIRT627239 ZBTB3 zinc finger and BTB domain containing 3 1 1
MIRT627306 WDR31 WD repeat domain 31 1 1
MIRT627501 STK17B serine/threonine kinase 17b 1 1
MIRT627537 SP4 Sp4 transcription factor 1 1
MIRT627662 RRAGC Ras-related GTP binding C 1 1
MIRT627703 RFFL ring finger and FYVE-like domain containing E3 ubiquitin protein ligase 1 1
MIRT627756 RAD51L3-RFFL RAD51L3-RFFL readthrough 1 1
MIRT628208 FREM2 FRAS1 related extracellular matrix protein 2 1 1
MIRT628398 C8orf37 chromosome 8 open reading frame 37 1 1
MIRT628451 ANAPC16 anaphase promoting complex subunit 16 1 1
MIRT631096 UQCRB ubiquinol-cytochrome c reductase binding protein 1 1
MIRT631285 SGSM1 small G protein signaling modulator 1 1 1
MIRT631322 CARHSP1 calcium regulated heat stable protein 1, 24kDa 1 1
MIRT631828 TMEM154 transmembrane protein 154 1 1
MIRT631842 CMBL carboxymethylenebutenolidase homolog (Pseudomonas) 1 1
MIRT632290 TTPAL tocopherol (alpha) transfer protein-like 1 1
MIRT632395 SLC4A1 solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group) 1 1
MIRT632504 RAB13 RAB13, member RAS oncogene family 1 1
MIRT632781 LZIC leucine zipper and CTNNBIP1 domain containing 1 1
MIRT632954 EIF4E eukaryotic translation initiation factor 4E 1 1
MIRT633559 DLEU1 deleted in lymphocytic leukemia 1 (non-protein coding) 1 1
MIRT633662 SLC28A1 solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 1 1
MIRT633684 ZNF576 zinc finger protein 576 1 1
MIRT634231 TMEM132B transmembrane protein 132B 1 1
MIRT634719 DDX19B DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B 1 1
MIRT634987 TFDP2 transcription factor Dp-2 (E2F dimerization partner 2) 1 1
MIRT635131 RAD51 RAD51 homolog (S. cerevisiae) 1 1
MIRT635754 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha 1 1
MIRT635972 TTC31 tetratricopeptide repeat domain 31 1 1
MIRT635999 EHD4 EH-domain containing 4 1 1
MIRT636629 CHAF1B chromatin assembly factor 1, subunit B (p60) 1 1
MIRT637099 CXorf23 chromosome X open reading frame 23 1 1
MIRT637324 FAM9B family with sequence similarity 9, member B 1 1
MIRT637477 DEFB105B defensin, beta 105B 1 1
MIRT637509 DEFB105A defensin, beta 105A 1 1
MIRT637547 CHST6 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6 1 1
MIRT637744 POLR3K polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa 1 1
MIRT638406 PRR11 proline rich 11 1 1
MIRT638548 KIAA0101 KIAA0101 1 1
MIRT638681 GCLM glutamate-cysteine ligase, modifier subunit 1 1
MIRT638742 FAXC failed axon connections homolog (Drosophila) 1 1
MIRT639040 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT639263 FLYWCH2 FLYWCH family member 2 1 1
MIRT639428 PKP1 plakophilin 1 (ectodermal dysplasia/skin fragility syndrome) 1 1
MIRT640358 C1orf210 chromosome 1 open reading frame 210 1 1
MIRT640695 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT641077 TGIF1 TGFB-induced factor homeobox 1 1 1
MIRT641098 C16orf72 chromosome 16 open reading frame 72 1 1
MIRT641209 TRIB1 tribbles homolog 1 (Drosophila) 1 2
MIRT641266 TM4SF20 transmembrane 4 L six family member 20 1 1
MIRT642118 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT643784 DCLK3 doublecortin-like kinase 3 1 1
MIRT644317 NFKBID nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta 1 1
MIRT644348 MPV17L MPV17 mitochondrial membrane protein-like 1 1
MIRT644811 VLDLR very low density lipoprotein receptor 1 1
MIRT644895 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT647035 KLHL25 kelch-like 25 (Drosophila) 1 1
MIRT647260 PTGDR2 prostaglandin D2 receptor 2 1 1
MIRT647534 CCDC121 coiled-coil domain containing 121 1 1
MIRT648061 TRMT10C tRNA methyltransferase 10 homolog C (S. cerevisiae) 1 1
MIRT648435 MYOZ3 myozenin 3 1 1
MIRT650144 ZNF426 zinc finger protein 426 1 1
MIRT650571 YIPF4 Yip1 domain family, member 4 1 1
MIRT650588 ATIC 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase 1 1
MIRT651792 UTP6 UTP6, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT653821 SIM2 single-minded homolog 2 (Drosophila) 1 1
MIRT655203 PHAX phosphorylated adaptor for RNA export 1 1
MIRT655376 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT657845 GJD3 gap junction protein, delta 3, 31.9kDa 1 1
MIRT658744 ELAVL4 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 1 1
MIRT659450 CLSPN claspin 1 1
MIRT661387 RHCG Rh family, C glycoprotein 1 1
MIRT662009 ZNF445 zinc finger protein 445 1 1
MIRT662695 SPIRE2 spire homolog 2 (Drosophila) 1 1
MIRT662971 ZSWIM1 zinc finger, SWIM-type containing 1 1 1
MIRT663763 ZNF285 zinc finger protein 285 1 1
MIRT663928 ZNF554 zinc finger protein 554 1 1
MIRT664008 LOH12CR1 loss of heterozygosity, 12, chromosomal region 1 1 1
MIRT664562 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT664867 SLC19A3 solute carrier family 19, member 3 1 1
MIRT665135 DHODH dihydroorotate dehydrogenase (quinone) 1 1
MIRT665284 ZFP14 zinc finger protein 14 homolog (mouse) 1 1
MIRT665565 TXNL1 thioredoxin-like 1 1 1
MIRT666219 SLC39A9 solute carrier family 39 (zinc transporter), member 9 1 1
MIRT666386 SHMT1 serine hydroxymethyltransferase 1 (soluble) 1 1
MIRT666797 PSMD1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 1 1
MIRT668835 CYCS cytochrome c, somatic 1 1
MIRT669705 AAK1 AP2 associated kinase 1 1 1
MIRT669815 STOML1 stomatin (EPB72)-like 1 1 1
MIRT669955 FBXL2 F-box and leucine-rich repeat protein 2 1 1
MIRT670103 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 1 1
MIRT670460 RSBN1L round spermatid basic protein 1-like 1 1
MIRT670571 GLTP glycolipid transfer protein 1 1
MIRT670612 NPHP1 nephronophthisis 1 (juvenile) 1 1
MIRT670889 CYTIP cytohesin 1 interacting protein 1 1
MIRT670940 LIPG lipase, endothelial 1 1
MIRT671066 KIF1B kinesin family member 1B 1 1
MIRT671310 RABGAP1L RAB GTPase activating protein 1-like 1 1
MIRT671814 WISP3 WNT1 inducible signaling pathway protein 3 1 1
MIRT671994 OSTF1 osteoclast stimulating factor 1 1 1
MIRT672093 WDR5B WD repeat domain 5B 1 1
MIRT672277 SHE Src homology 2 domain containing E 1 1
MIRT673229 KLHDC8A kelch domain containing 8A 1 1
MIRT673511 TNFAIP8L1 tumor necrosis factor, alpha-induced protein 8-like 1 1 2
MIRT674057 ATXN3 ataxin 3 1 1
MIRT674104 MELK maternal embryonic leucine zipper kinase 1 1
MIRT674479 BCL2L15 BCL2-like 15 1 1
MIRT675383 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 1 2
MIRT675524 RPL37 ribosomal protein L37 1 1
MIRT676246 PARP2 poly (ADP-ribose) polymerase 2 1 1
MIRT676683 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT676748 SGTB small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta 1 1
MIRT676884 ENSA endosulfine alpha 1 1
MIRT676908 PHLDA3 pleckstrin homology-like domain, family A, member 3 1 1
MIRT677053 ZNF34 zinc finger protein 34 1 1
MIRT677327 PIGO phosphatidylinositol glycan anchor biosynthesis, class O 1 1
MIRT677411 ARPC2 actin related protein 2/3 complex, subunit 2, 34kDa 1 1
MIRT678949 MYADM myeloid-associated differentiation marker 1 1
MIRT679479 PAICS phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase 1 1
MIRT679653 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 1 1
MIRT680111 ARHGEF39 Rho guanine nucleotide exchange factor (GEF) 39 1 1
MIRT682683 CPM carboxypeptidase M 1 1
MIRT684112 MCM10 minichromosome maintenance complex component 10 1 1
MIRT685295 COX18 cytochrome c oxidase assembly homolog 18 (yeast) 1 1
MIRT686644 TMEM184C transmembrane protein 184C 1 1
MIRT689314 C5AR2 G protein-coupled receptor 77 1 1
MIRT689459 NXN nucleoredoxin 1 1
MIRT689639 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT690776 PLA2G2C phospholipase A2, group IIC 1 1
MIRT690826 SGSM2 small G protein signaling modulator 2 1 1
MIRT691604 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT691730 LARS leucyl-tRNA synthetase 1 1
MIRT692919 EXOSC2 exosome component 2 1 1
MIRT692950 ORC1 origin recognition complex, subunit 1 1 1
MIRT693621 CENPL centromere protein L 1 1
MIRT693672 MXRA7 matrix-remodelling associated 7 1 1
MIRT693826 BACE2 beta-site APP-cleaving enzyme 2 1 1
MIRT695556 CLPB ClpB caseinolytic peptidase B homolog (E. coli) 1 1
MIRT695602 TMEM199 transmembrane protein 199 1 1
MIRT695917 ZNF174 zinc finger protein 174 1 1
MIRT696219 LYZ lysozyme 1 1
MIRT696314 NIP7 nuclear import 7 homolog (S. cerevisiae) 1 1
MIRT696439 SUGP1 SURP and G patch domain containing 1 1 1
MIRT697979 TSPAN6 tetraspanin 6 1 1
MIRT698165 TNFRSF13C tumor necrosis factor receptor superfamily, member 13C 1 1
MIRT698636 TES testis derived transcript (3 LIM domains) 1 1
MIRT698703 TBC1D15 TBC1 domain family, member 15 1 1
MIRT700077 RNF38 ring finger protein 38 1 1
MIRT701947 MITF microphthalmia-associated transcription factor 1 1
MIRT703021 HEATR5A HEAT repeat containing 5A 1 1
MIRT703382 GABPB1 GA binding protein transcription factor, beta subunit 1 1 1
MIRT703503 FNBP1 formin binding protein 1 1 1
MIRT704685 CHST2 carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2 1 1
MIRT704833 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT707305 GLRX2 glutaredoxin 2 1 1
MIRT708403 GRIN2A glutamate receptor, ionotropic, N-methyl D-aspartate 2A 1 1
MIRT708489 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT708657 LYRM7 LYR motif containing 7 1 1
MIRT709320 HMBOX1 homeobox containing 1 1 1
MIRT709791 CYBRD1 cytochrome b reductase 1 1 1
MIRT710524 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT710779 PHF7 PHD finger protein 7 1 1
MIRT710910 KIAA2018 KIAA2018 1 1
MIRT712205 SCOC short coiled-coil protein 1 1
MIRT712393 MTF1 metal-regulatory transcription factor 1 1 1
MIRT712677 KLHL36 kelch-like 36 (Drosophila) 1 1
MIRT712925 RPF2 ribosome production factor 2 homolog (S. cerevisiae) 1 1
MIRT713802 KCNK5 potassium channel, subfamily K, member 5 1 1
MIRT714030 SYDE2 synapse defective 1, Rho GTPase, homolog 2 (C. elegans) 1 1
MIRT714240 WIPF2 WAS/WASL interacting protein family, member 2 1 1
MIRT714383 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT714393 FBXO31 F-box protein 31 1 1
MIRT714847 ADAMTS17 ADAM metallopeptidase with thrombospondin type 1 motif, 17 1 1
MIRT714893 COQ10B coenzyme Q10 homolog B (S. cerevisiae) 1 1
MIRT716765 TRABD2A TraB domain containing 2A 1 1
MIRT718923 TRIM66 tripartite motif containing 66 1 1
MIRT719179 KCNS2 potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2 1 1
MIRT719412 B4GALNT3 beta-1,4-N-acetyl-galactosaminyl transferase 3 1 1
MIRT720663 C11orf54 chromosome 11 open reading frame 54 1 1
MIRT721100 UNC80 unc-80 homolog (C. elegans) 1 1
MIRT721265 SH3D19 SH3 domain containing 19 1 1
MIRT722744 NUDT16 nudix (nucleoside diphosphate linked moiety X)-type motif 16 1 1
MIRT722761 SIRPB2 signal-regulatory protein beta 2 1 1
MIRT723300 MOGAT1 monoacylglycerol O-acyltransferase 1 1 1
MIRT724640 PKDREJ polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin) 1 1
MIRT724707 CRAMP1L Crm, cramped-like (Drosophila) 1 1
MIRT724864 RIMBP2 RIMS binding protein 2 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*