Accession ID: MIRT039602 [miRNA, hsa-miR-616-5p :: ATP7B, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-616LinkOut: [miRBase ]
Synonyms MIRN616, hsa-mir-616, MIR616
Description Homo sapiens miR-616 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-616-5p
Mature Sequence 16| ACUCAAAACCCUUCAGUGACUU |37
Evidence Experimental
Experiments SAGE
Putative hsa-miR-616-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ATP7B LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms PWD, WC1, WD, WND
Description ATPase, Cu++ transporting, beta polypeptide
Transcript NM_0000    LinkOut: [ RefSeq ]
Other Transcripts NM_0010059   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ATP7B LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ATP7B
(miRNA target sites are highlighted)
>ATP7B|NM_0000|3'UTR
   1 TGACTTCAGGCAGGCGGGCCGGGGCAGGGACTTGCCTCCACTCACCACAAGCTGAGCAGGACAGCCAGCAGCAGGATGGG
  81 CTGAGCTAGCCTCCAGCTTTGGGGACTTCCGCTCCCTGGATATGTCCAGTCATCCTGCCCTGCAGCACGCGGCCTTGTCT
 161 GGGTGCAGCTGGGCTTGGCCTGGAGAGGACGGCCCTGCCTGCCTCTTGGCCTCACGGGACCGTCAGCATGGGCTTTGTCT
 241 TGGACTCTAGTCCTTGGCTGGACTGTAGAAGGTGAGAGGCGAGTCACCCTCCTCACAGACCTCTGCTTGGAGTATTTAGG
 321 ATGACTGCTGTGAAATGGAGAACAGTTTCATCAGGACCAAAAAACCTCACTGGGCCTTTCCAGAGAACTGCAGACCTCAC
 401 TGTCAGGGTCTTTCTGATGACGCCTGTCTGTGTGCATCATGTTTCTGAGACCACAGTTTACCTCAGGTGTGCCTGTTGCT
 481 TTCTTCCTGCATAGTCTGTTCCTTTCTTCGTACATAGTCTGTTCCTTTTCTCTCCTGTGTGCTTGTCAGTGGGGACCCCT
 561 CGCAACCCTGCCTGTCACCTGGGAGGGTGGGACCAATGTCCTTGTGGTCTTTGCTGCTGCTCTCAGGCGCTTCTCCAATG
 641 CTCTGGAGTGTGCATTTCAGCTTGAACCTGCTTCCTGGCTCACACATCCCCAGCCAGGGAGCTTGCCACACTCTTCTTCA
 721 AGTTGAGGAGAGTTCTTTTTTGCTTAAAGCCCCCTTCTCCATGGAGTGTTGGCTTCTCAATAGAGTGTTGTTGCTGACCA
 801 GCTGGAGTGAGGGCCTCAGAGCCTGACCTGAGAGTCCGTACTCGGCTTCCTGTGGGGTGTAGGTTCTCGCGATTCAGGAC
 881 GTCCTTCCATATCCCTGCCCAGCCTGTGGTGCTTGAAACGTTTGCCCCATGGGAAACGTATGTGTGCAGGAGCCTCCCTG
 961 CACGGCCCAAGGGGCTTCGTTTTCAGTCTTCTGACTGTCACCTCGTGGGGTTCAGTAGAGAATTCATGTGACTAGCGCCT
1041 GGCCTTGTGTGGCTTGGAGGAAATGGTACTGCCCAAATAGGAGGAAAACACAGCCTCCCTGAGCCTGCATTCTGCACGCT
1121 GCCCAGGGGCTTCAGAAAAGGAGTGGCCACAGCACCCCGAAGGGAGCATCTGTTTACCTGGCAGTGGCTCTCAGAGCAGC
1201 AGAACGGGTTCAGTTTTAGACTCTGAAGTTGGTTGTGATTGACAGAACCCTTTGGGAGCAAACTAGTAGAGTTGGATTAA
1281 ATTCTGGGTGAAACCCTTTTCTCCCACACAAAATAGTTTTAGTGATTTTTTTCATTGTCCATTACTTGCCAGGGGCAGTT
1361 TTAGCAGCACTTTTGATAGATTACGTCTAATCCTCCCAACCAACCAGCAGGGTAGCTATTACTGTCCACATTTTACAGGC
1441 AAGGAAACAGGCTCCAAGAGGCTGAGGACTTTGCCCAGGATGACATAGCCAATGGACAAGCAGTGTCTGTCAGCTGTGAA
1521 GGCTTCACTCTTATTGTCCTTCTACCTTGAATAGAAGTTTTCCTGATAAGAATAAACGAGGAAAAGGTCCTTGCCTCCTG
1601 GAAGAACAAATCTACCAGGTGATCTATTCATTGTTTCAACTCAGAATGCACTTGATTCAGGAGGTCATCTGACCTTCACC
1681 TTGGATGGTTAGTTTCACTTTTTACATATAGTTTTTGCAGGGTTTTATTTTATAAAATCCAAGCGCGCTGTTGATTGTGT
1761 TTTCCTTGTTTTCAGCCCCCCCACTCCAGCCCGCAGCACATTTCCGCTGTCCGTCAGTAATTGTGTCCTCTCTTTATGCT
1841 TGCTTGGGGAATGTTGTTTTCTGACTAGGCTGATCATTATCTAAAGAATCTAATTCTGTTGATTTTTAAAACTTTTAGGA
1921 CCATAAACGTTGTGTTCATATATGGACATGGAAATATTTATATAATTTTATAGAAAATAACCTTTTAGATGGTCAAAGTG
2001 TAAGGAGTTTTTTTGTCAGATAATCATTTCTACTTCAAAAACATTTCATGCAATATTAGAATAAAGTTCCTGTCATTCCT
2081 CTAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuCAGUGACUUC--CCAAAACUca 5'
            | | ||||||  |||| |||  
Target 5' taGACTCTGAAGTTGGTTGTGAtt 3'
1217 - 1240 122.00 -11.70
2
miRNA  3' uucaGUGAC---UUCC------CAAAACUCa 5'
              ||| |   ||||      ||||| || 
Target 5' cctgCACGGCCCAAGGGGCTTCGTTTTCAGt 3'
957 - 987 120.00 -10.00
3
miRNA  3' uucAGUGACUUCCCAAAAC-UCa 5'
             |:||  |  | ||||| || 
Target 5' tttTTACATATAGTTTTTGCAGg 3'
1699 - 1721 119.00 -7.69
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-616-5p :: ATP7B    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ttcagtgacttCCCAAAACTCa 5'
                     |||||||||| 
Target 5' ----------tGGGTTTTGAGg 3'
1 - 12
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
2 hsa-miR-616-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT039602 ATP7B ATPase, Cu++ transporting, beta polypeptide 1 1
MIRT039603 DRG2 developmentally regulated GTP binding protein 2 1 1