Accession ID: MIRT039671 [miRNA, hsa-miR-615-3p :: MSH6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-615LinkOut: [miRBase ]
Synonyms MIRN615, hsa-mir-615, MIR615
Description Homo sapiens miR-615 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-615-3p
Mature Sequence 61| UCCGAGCCUGGGUCUCCCUCUU |82
Evidence Experimental
Experiments RT-PCR
Putative hsa-miR-615-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MSH6 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GTBP, HNPCC5, HSAP
Description mutS homolog 6 (E. coli)
Transcript NM_0001    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MSH6 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MSH6
(miRNA target sites are highlighted)
>MSH6|NM_0001|3'UTR
   1 TAGACTGACTACATTGGAAGCTTTGAGTTGACTTCTGACAAAGGTGGTAAATTCAGACAACATTATGATCTAATAAACTT
  81 TATTTTTTAAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
 161 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uucucccucugggucCGAGCCu 5'
                         |||: | 
Target 5' ctgactacattggaaGCTTTGa 3'
5 - 26 72.00 -6.86
2
miRNA  3' uucucccuCUGGGUCCGAGCCU 5'
                  |||  |||  :|| 
Target 5' tgacttctGACAAAGG--TGGT 3'
29 - 48 58.00 -9.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-615-3p :: MSH6    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
882 hsa-miR-615-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT007027 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT016143 KIF14 kinesin family member 14 1 1
MIRT016144 CDC37 cell division cycle 37 homolog (S. cerevisiae) 1 1
MIRT016145 KLHL42 kelch domain containing 5 1 1
MIRT016146 PBX3 pre-B-cell leukemia homeobox 3 1 1
MIRT016147 TRIP10 thyroid hormone receptor interactor 10 1 1
MIRT016148 C19orf54 chromosome 19 open reading frame 54 1 1
MIRT016149 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT016150 BVES blood vessel epicardial substance 1 1
MIRT016151 DIXDC1 DIX domain containing 1 1 1
MIRT016152 ENAH enabled homolog (Drosophila) 1 1
MIRT039604 FBXO28 F-box protein 28 1 1
MIRT039605 CCDC127 coiled-coil domain containing 127 1 1
MIRT039606 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT039607 TRAFD1 TRAF-type zinc finger domain containing 1 1 1
MIRT039608 HIST2H4B histone cluster 2, H4b 1 1
MIRT039609 PRKCD protein kinase C, delta 1 1
MIRT039610 CEP152 centrosomal protein 152kDa 1 1
MIRT039611 TLE1 transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) 1 1
MIRT039612 DCAF12 DDB1 and CUL4 associated factor 12 1 1
MIRT039613 UBA52 ubiquitin A-52 residue ribosomal protein fusion product 1 1 1
MIRT039614 PRR12 proline rich 12 1 1
MIRT039615 ATP6 ATP synthase F0 subunit 6 1 1
MIRT039616 CHRNA5 cholinergic receptor, nicotinic, alpha 5 1 1
MIRT039617 RPL9 ribosomal protein L9 1 1
MIRT039618 TRPC1 transient receptor potential cation channel, subfamily C, member 1 1 1
MIRT039619 TUFM Tu translation elongation factor, mitochondrial 1 1
MIRT039620 GTF3C4 general transcription factor IIIC, polypeptide 4, 90kDa 1 1
MIRT039621 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 1
MIRT039622 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT039623 GNL3 guanine nucleotide binding protein-like 3 (nucleolar) 1 1
MIRT039624 ZNF235 zinc finger protein 235 1 1
MIRT039625 KIAA1429 KIAA1429 1 1
MIRT039626 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT039627 PABPC4 poly(A) binding protein, cytoplasmic 4 (inducible form) 1 1
MIRT039628 RHBDF2 rhomboid 5 homolog 2 (Drosophila) 1 1
MIRT039629 CTSZ cathepsin Z 1 1
MIRT039630 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT039631 PTPRK protein tyrosine phosphatase, receptor type, K 1 1
MIRT039632 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT039633 HNRNPL heterogeneous nuclear ribonucleoprotein L 1 1
MIRT039634 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT039635 FAM53B family with sequence similarity 53, member B 1 1
MIRT039636 SLC1A4 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 1 1
MIRT039637 ELF4 E74-like factor 4 (ets domain transcription factor) 1 1
MIRT039638 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT039639 CORO1A coronin, actin binding protein, 1A 1 1
MIRT039640 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 1
MIRT039641 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT039642 PPP1R15B protein phosphatase 1, regulatory (inhibitor) subunit 15B 1 1
MIRT039643 SSR3 signal sequence receptor, gamma (translocon-associated protein gamma) 1 1
MIRT039644 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT039645 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
MIRT039646 BCOR BCL6 corepressor 1 1
MIRT039647 CPSF4 cleavage and polyadenylation specific factor 4, 30kDa 1 1
MIRT039648 NPRL3 nitrogen permease regulator-like 3 (S. cerevisiae) 1 1
MIRT039649 SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 1 1
MIRT039650 VPS72 vacuolar protein sorting 72 homolog (S. cerevisiae) 1 1
MIRT039651 PANK2 pantothenate kinase 2 1 1
MIRT039652 KIF2A kinesin heavy chain member 2A 1 1
MIRT039653 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT039654 NXF1 nuclear RNA export factor 1 1 1
MIRT039655 PVRL1 poliovirus receptor-related 1 (herpesvirus entry mediator C) 1 1
MIRT039656 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT039657 PRPSAP1 phosphoribosyl pyrophosphate synthetase-associated protein 1 1 1
MIRT039658 TCP1 t-complex 1 1 1
MIRT039659 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT039660 KHSRP KH-type splicing regulatory protein 1 1
MIRT039661 WDR4 WD repeat domain 4 1 1
MIRT039662 TMPO thymopoietin 1 1
MIRT039663 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT039664 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT039665 SIPA1L3 signal-induced proliferation-associated 1 like 3 1 1
MIRT039666 CUEDC2 CUE domain containing 2 1 1
MIRT039667 CBX6 chromobox homolog 6 1 1
MIRT039668 HSPA8 heat shock 70kDa protein 8 1 1
MIRT039669 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT039670 PTMA prothymosin, alpha 1 1
MIRT039671 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT039672 PSMF1 proteasome (prosome, macropain) inhibitor subunit 1 (PI31) 1 1
MIRT039673 VDAC1 voltage-dependent anion channel 1 1 1
MIRT039674 CTNNA1 catenin (cadherin-associated protein), alpha 1, 102kDa 1 1
MIRT039675 YIPF6 Yip1 domain family, member 6 1 1
MIRT039676 SLC30A1 solute carrier family 30 (zinc transporter), member 1 1 1
MIRT039677 TMUB1 transmembrane and ubiquitin-like domain containing 1 1 1
MIRT039678 SEC24C SEC24 family, member C (S. cerevisiae) 1 1
MIRT039679 BRD2 bromodomain containing 2 1 1
MIRT039680 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT039681 KIAA1109 KIAA1109 1 1
MIRT039682 RPL15 ribosomal protein L15 1 1
MIRT039683 GNAS GNAS complex locus 1 1
MIRT039684 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT039685 EBNA1BP2 EBNA1 binding protein 2 1 1
MIRT039686 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT039687 SYPL2 synaptophysin-like 2 1 1
MIRT039688 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT039689 DAZAP1 DAZ associated protein 1 1 1
MIRT039690 RPN2 ribophorin II 1 1
MIRT039691 CDC7 cell division cycle 7 homolog (S. cerevisiae) 1 1
MIRT039692 SVIL supervillin 1 1
MIRT039693 ENO1 enolase 1, (alpha) 1 1
MIRT039694 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 1
MIRT039695 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT039696 ABT1 activator of basal transcription 1 1 1
MIRT039697 PRR3 proline rich 3 1 1
MIRT039698 EIF2B3 eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa 1 1
MIRT039699 TJP1 tight junction protein 1 (zona occludens 1) 1 1
MIRT039700 RBM10 RNA binding motif protein 10 1 1
MIRT039701 MRFAP1 Mof4 family associated protein 1 1 1
MIRT039702 DPH7 WD repeat domain 85 1 1
MIRT039703 TROAP trophinin associated protein (tastin) 1 1
MIRT039704 HDAC1 histone deacetylase 1 1 1
MIRT039705 FOXO4 forkhead box O4 1 1
MIRT039706 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 1 1
MIRT039707 MRPL21 mitochondrial ribosomal protein L21 1 1
MIRT039708 EP300 E1A binding protein p300 1 1
MIRT039709 RASAL3 RAS protein activator like 3 1 1
MIRT039710 TPST2 tyrosylprotein sulfotransferase 2 1 1
MIRT039711 UBC ubiquitin C 1 1
MIRT039712 CCND3 cyclin D3 1 1
MIRT039713 INTS1 integrator complex subunit 1 1 1
MIRT039714 EXOC2 exocyst complex component 2 1 1
MIRT039715 SYPL1 synaptophysin-like 1 1 1
MIRT039716 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 1
MIRT039717 CHAMP1 zinc finger protein 828 1 1
MIRT039718 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT039719 RAPGEF1 Rap guanine nucleotide exchange factor (GEF) 1 1 1
MIRT039720 HELLS helicase, lymphoid-specific 1 1
MIRT039721 HSPA4 heat shock 70kDa protein 4 1 1
MIRT039722 FAM13A family with sequence similarity 13, member A 1 1
MIRT039723 SALL2 sal-like 2 (Drosophila) 1 1
MIRT039724 MORF4L1 mortality factor 4 like 1 1 1
MIRT039725 PCNA proliferating cell nuclear antigen 1 1
MIRT039726 RNF25 ring finger protein 25 1 1
MIRT039727 RPSA ribosomal protein SA 1 1
MIRT039728 PHGDH phosphoglycerate dehydrogenase 1 1
MIRT039729 SUPT20H family with sequence similarity 48, member A 1 1
MIRT039730 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT039731 RPL37A ribosomal protein L37a 1 1
MIRT039732 RPS3 ribosomal protein S3 1 1
MIRT039733 ANP32A acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 1 1
MIRT039734 CNOT10 CCR4-NOT transcription complex, subunit 10 1 1
MIRT039735 BACH2 BTB and CNC homology 1, basic leucine zipper transcription factor 2 1 1
MIRT039736 MSTO1 misato homolog 1 (Drosophila) 1 1
MIRT039737 YBX1 Y box binding protein 1 1 1
MIRT039738 MAP1A microtubule-associated protein 1A 1 1
MIRT039739 SERINC3 serine incorporator 3 1 1
MIRT039740 DIDO1 death inducer-obliterator 1 1 1
MIRT039741 PARP1 poly (ADP-ribose) polymerase 1 1 1
MIRT039742 HGSNAT heparan-alpha-glucosaminide N-acetyltransferase 1 1
MIRT039743 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT039744 RANBP10 RAN binding protein 10 1 1
MIRT039745 RPS15 ribosomal protein S15 1 1
MIRT039746 RPL23 ribosomal protein L23 1 1
MIRT039747 COCH coagulation factor C homolog, cochlin (Limulus polyphemus) 1 1
MIRT039748 CDC34 cell division cycle 34 homolog (S. cerevisiae) 1 1
MIRT039749 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT039750 RPA1 replication protein A1, 70kDa 1 1
MIRT039751 ST14 suppression of tumorigenicity 14 (colon carcinoma) 1 1
MIRT039752 ZC3H3 zinc finger CCCH-type containing 3 1 1
MIRT039753 PRDX2 peroxiredoxin 2 1 1
MIRT039754 TPI1 triosephosphate isomerase 1 1 1
MIRT039755 MCM2 minichromosome maintenance complex component 2 1 1
MIRT039756 RALGDS ral guanine nucleotide dissociation stimulator 1 1
MIRT039757 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT039758 ATP13A2 ATPase type 13A2 1 1
MIRT039759 HEATR6 HEAT repeat containing 6 1 1
MIRT039760 MCM10 minichromosome maintenance complex component 10 1 1
MIRT039761 UQCRFS1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 1 1
MIRT039762 TONSL nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2 1 1
MIRT039763 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 1 1
MIRT039764 KPNB1 karyopherin (importin) beta 1 1 1
MIRT039765 MANBAL mannosidase, beta A, lysosomal-like 1 1
MIRT039766 ZNF146 zinc finger protein 146 1 1
MIRT039767 MED13L mediator complex subunit 13-like 1 1
MIRT039768 ISLR2 immunoglobulin superfamily containing leucine-rich repeat 2 1 1
MIRT039769 HMGN4 high mobility group nucleosomal binding domain 4 1 1
MIRT039770 HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 1 1
MIRT039771 RPL3 ribosomal protein L3 1 1
MIRT039772 CBFB core-binding factor, beta subunit 1 1
MIRT039773 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT039774 DHODH dihydroorotate dehydrogenase 1 1
MIRT039775 FAM127B family with sequence similarity 127, member B 1 1
MIRT039776 CACFD1 chromosome 9 open reading frame 7 1 1
MIRT039777 FAM107B family with sequence similarity 107, member B 1 1
MIRT039778 HDLBP high density lipoprotein binding protein 1 1
MIRT039779 EIF3B eukaryotic translation initiation factor 3, subunit B 1 1
MIRT039780 ATP7B ATPase, Cu++ transporting, beta polypeptide 1 1
MIRT039781 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT039782 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT039783 RPS17 ribosomal protein S17 1 1
MIRT039784 RPL13 ribosomal protein L13 1 1
MIRT039785 TNPO2 transportin 2 1 1
MIRT039786 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT039787 ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 1 1
MIRT039788 HOXC13 homeobox C13 1 1
MIRT039789 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT039790 UBB ubiquitin B 1 1
MIRT039791 SF3B2 splicing factor 3b, subunit 2, 145kDa 1 1
MIRT039792 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT039793 RPS12 ribosomal protein S12 1 1
MIRT039794 NKX2-5 NK2 transcription factor related, locus 5 (Drosophila) 1 1
MIRT039795 RAPGEF2 Rap guanine nucleotide exchange factor (GEF) 2 1 1
MIRT039796 PRDX4 peroxiredoxin 4 1 1
MIRT039797 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT039798 FLNA filamin A, alpha 1 1
MIRT039799 TMEM132A transmembrane protein 132A 1 1
MIRT039800 ZCCHC12 zinc finger, CCHC domain containing 12 1 1
MIRT039801 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT039802 TPRN taperin 1 1
MIRT039803 BTN3A2 butyrophilin, subfamily 3, member A2 1 1
MIRT039804 BTN3A3 butyrophilin, subfamily 3, member A3 1 1
MIRT039805 NUDT9 nudix (nucleoside diphosphate linked moiety X)-type motif 9 1 1
MIRT039806 GART phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase 1 1
MIRT039807 PLXNB2 plexin B2 1 1
MIRT039808 RPL36 ribosomal protein L36 1 1
MIRT039809 MUT methylmalonyl CoA mutase 1 1
MIRT039810 PRKAB2 protein kinase, AMP-activated, beta 2 non-catalytic subunit 1 1
MIRT039811 CD2BP2 CD2 (cytoplasmic tail) binding protein 2 1 1
MIRT039812 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT039813 FUBP1 far upstream element (FUSE) binding protein 1 1 1
MIRT039814 CCT8 chaperonin containing TCP1, subunit 8 (theta) 1 1
MIRT039815 PFDN2 prefoldin subunit 2 1 1
MIRT039816 DGKE diacylglycerol kinase, epsilon 64kDa 1 1
MIRT039817 SHPK sedoheptulokinase 1 1
MIRT039818 BSDC1 BSD domain containing 1 1 1
MIRT039819 IARS isoleucyl-tRNA synthetase 1 1
MIRT039820 DPH2 DPH2 homolog (S. cerevisiae) 1 1
MIRT039821 PITPNA phosphatidylinositol transfer protein, alpha 1 1
MIRT039822 NACA nascent polypeptide-associated complex alpha subunit 1 1
MIRT039823 KIAA1967 KIAA1967 1 1
MIRT039824 FASN fatty acid synthase 1 1
MIRT039825 DVL3 dishevelled, dsh homolog 3 (Drosophila) 1 1
MIRT039826 AARS alanyl-tRNA synthetase 1 1
MIRT039827 STK40 serine/threonine kinase 40 1 1
MIRT039828 DDX19A DEAD (Asp-Glu-Ala-As) box polypeptide 19A 1 1
MIRT039829 COG4 component of oligomeric golgi complex 4 1 1
MIRT039830 RPL36AL ribosomal protein L36a-like 1 1
MIRT039831 CLSPN claspin homolog (Xenopus laevis) 1 1
MIRT039832 DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) 1 1
MIRT039833 MAD2L1BP MAD2L1 binding protein 1 1
MIRT039834 SGK196 protein kinase-like protein SgK196 1 1
MIRT039835 CLPP ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) 1 1
MIRT039836 KLHL22 kelch-like 22 (Drosophila) 1 1
MIRT039837 WSB2 WD repeat and SOCS box-containing 2 1 1
MIRT039839 CDK20 cyclin-dependent kinase 20 1 1
MIRT039840 SART1 squamous cell carcinoma antigen recognized by T cells 1 1
MIRT039841 RPA3 replication protein A3, 14kDa 1 1
MIRT039842 ARHGAP22 Rho GTPase activating protein 22 1 1
MIRT039843 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) 1 1
MIRT039844 ST3GAL2 ST3 beta-galactoside alpha-2,3-sialyltransferase 2 1 1
MIRT039845 ZNF609 zinc finger protein 609 1 1
MIRT039846 DNAJC9 DnaJ (Hsp40) homolog, subfamily C, member 9 1 1
MIRT039847 MORC2 MORC family CW-type zinc finger 2 1 1
MIRT039848 BICD2 bicaudal D homolog 2 (Drosophila) 1 1
MIRT039849 EPHA7 EPH receptor A7 1 1
MIRT039850 RHBDL3 rhomboid, veinlet-like 3 (Drosophila) 1 1
MIRT039851 GLA galactosidase, alpha 1 1
MIRT039852 ZFYVE16 zinc finger, FYVE domain containing 16 1 1
MIRT039853 NUBP1 nucleotide binding protein 1 (MinD homolog, E. coli) 1 1
MIRT039854 SDE2 chromosome 1 open reading frame 55 1 1
MIRT039855 SELRC1 chromosome 1 open reading frame 163 1 1
MIRT039856 CWC22 CWC22 spliceosome-associated protein homolog (S. cerevisiae) 1 1
MIRT039857 KAT2A K(lysine) acetyltransferase 2A 1 1
MIRT039858 THOC5 THO complex 5 1 1
MIRT039859 GADD45A growth arrest and DNA-damage-inducible, alpha 1 1
MIRT039860 BAG6 HLA-B associated transcript 3 1 1
MIRT039861 MYO19 myosin XIX 1 1
MIRT039862 DESI1 PPPDE peptidase domain containing 2 1 1
MIRT039863 COMMD2 COMM domain containing 2 1 1
MIRT039864 VPS4A vacuolar protein sorting 4 homolog A (S. cerevisiae) 1 1
MIRT039865 WDR1 WD repeat domain 1 1 1
MIRT039866 CTDSP2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 1 1
MIRT039867 ACTN1 actinin, alpha 1 1 1
MIRT039868 PCCB propionyl CoA carboxylase, beta polypeptide 1 1
MIRT039869 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT039870 WDR5 WD repeat domain 5 1 1
MIRT039871 ATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit 1 1
MIRT039872 PRRC2A HLA-B associated transcript 2 1 1
MIRT039873 RARA retinoic acid receptor, alpha 1 1
MIRT039874 SNRNP70 small nuclear ribonucleoprotein 70kDa (U1) 1 1
MIRT039875 ELOVL6 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) 1 1
MIRT039876 ARRB2 arrestin, beta 2 1 1
MIRT039877 SPAG7 sperm associated antigen 7 1 1
MIRT039878 HECTD3 HECT domain containing 3 1 1
MIRT039879 POLR3H polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) 1 1
MIRT039880 MCM3AP minichromosome maintenance complex component 3 associated protein 1 1
MIRT039881 UHRF1 ubiquitin-like with PHD and ring finger domains 1 1 1
MIRT039882 TIMM50 translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) 1 1
MIRT039883 MRPL23 mitochondrial ribosomal protein L23 1 1
MIRT039884 EXOC8 exocyst complex component 8 1 1
MIRT039885 ERLIN1 ER lipid raft associated 1 1 1
MIRT039886 E2F4 E2F transcription factor 4, p107/p130-binding 1 1
MIRT039887 LAMP1 lysosomal-associated membrane protein 1 1 1
MIRT039888 HEATR1 HEAT repeat containing 1 1 1
MIRT039889 TAGLN2 transgelin 2 1 1
MIRT039890 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT039891 NDUFA10 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa 1 1
MIRT039892 EDF1 endothelial differentiation-related factor 1 1 1
MIRT039893 HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 1 1
MIRT039894 PPP5C protein phosphatase 5, catalytic subunit 1 1
MIRT039895 LUZP1 leucine zipper protein 1 1 1
MIRT039896 COL6A1 collagen, type VI, alpha 1 1 1
MIRT039897 RPL7A ribosomal protein L7a 1 1
MIRT039898 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase, type I, alpha 1 1
MIRT039899 COX1 cytochrome c oxidase subunit I 1 1
MIRT039900 PUM2 pumilio homolog 2 (Drosophila) 1 1
MIRT039901 PIM3 pim-3 oncogene 1 1
MIRT039902 EFCAB14 KIAA0494 1 1
MIRT039903 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT039904 ZC3HAV1 zinc finger CCCH-type, antiviral 1 1 1
MIRT039905 RECQL4 RecQ protein-like 4 1 1
MIRT039906 DENR density-regulated protein 1 1
MIRT039907 HSPA9 heat shock 70kDa protein 9 (mortalin) 1 1
MIRT039908 BIRC6 baculoviral IAP repeat-containing 6 1 1
MIRT039909 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 1
MIRT039910 DNM1 dynamin 1 1 1
MIRT039911 DNM1L dynamin 1-like 1 1
MIRT039912 ALKBH5 alkB, alkylation repair homolog 5 (E. coli) 1 1
MIRT039913 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT039914 ACADVL acyl-CoA dehydrogenase, very long chain 1 1
MIRT039915 ZNF33A zinc finger protein 33A 1 1
MIRT039916 NBPF15 neuroblastoma breakpoint family, member 15 1 1
MIRT039917 MRPL46 mitochondrial ribosomal protein L46 1 1
MIRT039918 LRRC42 leucine rich repeat containing 42 1 1
MIRT039919 DBN1 drebrin 1 1 1
MIRT039920 AFF1 AF4/FMR2 family, member 1 1 1
MIRT039921 PPP6R3 SAPS domain family, member 3 1 1
MIRT039922 NOMO3 NODAL modulator 3 1 1
MIRT039923 APOPT1 chromosome 14 open reading frame 153 1 1
MIRT039924 DNAJA2 DnaJ (Hsp40) homolog, subfamily A, member 2 1 1
MIRT039925 RNF149 ring finger protein 149 1 1
MIRT039926 HK1 hexokinase 1 1 1
MIRT039927 CHMP2A chromatin modifying protein 2A 1 1
MIRT039928 SLC25A1 solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 1 1
MIRT039929 MLH3 mutL homolog 3 (E. coli) 1 1
MIRT039930 APBA2 amyloid beta (A4) precursor protein-binding, family A, member 2 1 1
MIRT039931 MRPL54 mitochondrial ribosomal protein L54 1 1
MIRT039932 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT039933 CDC42EP1 CDC42 effector protein (Rho GTPase binding) 1 1 1
MIRT039934 PKN3 protein kinase N3 1 1
MIRT039935 YIPF3 Yip1 domain family, member 3 1 1
MIRT039936 VIM vimentin 1 1
MIRT039937 GPSM1 G-protein signaling modulator 1 (AGS3-like, C. elegans) 1 1
MIRT039938 POLG polymerase (DNA directed), gamma 1 1
MIRT039939 ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) 1 1
MIRT039940 CHD8 chromodomain helicase DNA binding protein 8 1 1
MIRT039941 DDX23 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 1 1
MIRT039942 ESRRA estrogen-related receptor alpha 1 1
MIRT039943 ZNF837 zinc finger protein 837 1 1
MIRT039944 PDCD5 programmed cell death 5 1 1
MIRT039945 NCLN nicalin homolog (zebrafish) 1 1
MIRT039946 CUL4A cullin 4A 1 1
MIRT039947 NCL nucleolin 1 1
MIRT039948 XYLT2 xylosyltransferase II 1 1
MIRT039949 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT039950 PLBD2 phospholipase B domain containing 2 1 1
MIRT039951 MOGS mannosyl-oligosaccharide glucosidase 1 1
MIRT039952 MDH2 malate dehydrogenase 2, NAD (mitochondrial) 1 1
MIRT039953 ZDHHC7 zinc finger, DHHC-type containing 7 1 1
MIRT039954 HEXA hexosaminidase A (alpha polypeptide) 1 1
MIRT039955 SEPHS2 selenophosphate synthetase 2 1 1
MIRT039956 C12orf57 chromosome 12 open reading frame 57 1 1
MIRT039957 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT039958 FNBP1 formin binding protein 1 1 1
MIRT039959 HDGF hepatoma-derived growth factor 1 1
MIRT039960 MBOAT7 membrane bound O-acyltransferase domain containing 7 1 1
MIRT039961 FRAT2 frequently rearranged in advanced T-cell lymphomas 2 1 1
MIRT039962 HIST1H4B histone cluster 1, H4b 1 1
MIRT039963 CAMLG calcium modulating ligand 1 1
MIRT039964 SUPT6H suppressor of Ty 6 homolog (S. cerevisiae) 1 1
MIRT039965 HLA-B major histocompatibility complex, class I, B 1 1
MIRT039966 ALDH1A2 aldehyde dehydrogenase 1 family, member A2 1 1
MIRT039967 JUP junction plakoglobin 1 1
MIRT039968 UQCR11 ubiquinol-cytochrome c reductase, complex III subunit XI 1 1
MIRT039969 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 1
MIRT039970 THG1L tRNA-histidine guanylyltransferase 1-like (S. cerevisiae) 1 1
MIRT039971 NBR1 neighbor of BRCA1 gene 1 1 1
MIRT039972 USP28 ubiquitin specific peptidase 28 1 1
MIRT039973 PWWP2A PWWP domain containing 2A 1 1
MIRT039974 RPP30 ribonuclease P/MRP 30kDa subunit 1 1
MIRT039975 FOXO3 forkhead box O3 1 1
MIRT039976 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 1 1
MIRT039977 TMEM126B transmembrane protein 126B 1 1
MIRT039978 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT039979 FURIN furin (paired basic amino acid cleaving enzyme) 1 1
MIRT039980 TIMELESS timeless homolog (Drosophila) 1 1
MIRT039981 ELAC2 elaC homolog 2 (E. coli) 1 1
MIRT039982 BTG3 BTG family, member 3 1 1
MIRT039983 VPS18 vacuolar protein sorting 18 homolog (S. cerevisiae) 1 1
MIRT039984 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT039985 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 1 1
MIRT039986 PFKP phosphofructokinase, platelet 1 1
MIRT039987 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 1
MIRT039988 PQBP1 polyglutamine binding protein 1 1 1
MIRT039989 SMG1 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT039990 NMT1 N-myristoyltransferase 1 1 1
MIRT039991 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT039992 RFX3 regulatory factor X, 3 (influences HLA class II expression) 1 1
MIRT039993 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT039994 LSM12 LSM12 homolog (S. cerevisiae) 1 1
MIRT039995 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT039996 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT039997 PPP4C protein phosphatase 4, catalytic subunit 1 1
MIRT039998 TMED2 transmembrane emp24 domain trafficking protein 2 1 1
MIRT039999 IFRD2 interferon-related developmental regulator 2 1 1
MIRT040000 CDK6 cyclin-dependent kinase 6 1 1
MIRT040001 KHDRBS1 KH domain containing, RNA binding, signal transduction associated 1 1 1
MIRT040002 TPR translocated promoter region (to activated MET oncogene) 1 1
MIRT040003 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT040004 IPO13 importin 13 1 1
MIRT040005 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT040006 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT040007 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT040008 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT040009 SMDT1 chromosome 22 open reading frame 32 1 1
MIRT040010 ITGA7 integrin, alpha 7 1 1
MIRT040011 SOCS7 suppressor of cytokine signaling 7 1 1
MIRT040012 SMC1A structural maintenance of chromosomes 1A 1 1
MIRT040013 RAVER2 ribonucleoprotein, PTB-binding 2 1 1
MIRT040014 TBP TATA box binding protein 1 1
MIRT040015 CLCC1 chloride channel CLIC-like 1 1 1
MIRT040016 GLUL glutamate-ammonia ligase 1 1
MIRT040017 PCNT pericentrin 1 1
MIRT040018 CBS cystathionine-beta-synthase 1 1
MIRT040019 EIF3M eukaryotic translation initiation factor 3, subunit M 1 1
MIRT040020 TOMM7 translocase of outer mitochondrial membrane 7 homolog (yeast) 1 1
MIRT040021 BCAT2 branched chain amino-acid transaminase 2, mitochondrial 1 1
MIRT040022 CANX calnexin 1 1
MIRT040023 NPTX1 neuronal pentraxin I 1 1
MIRT040024 RPL21 ribosomal protein L21 1 1
MIRT040025 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT040026 HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase 1 1
MIRT040027 EPDR1 ependymin related protein 1 (zebrafish) 1 1
MIRT040028 ACTN4 actinin, alpha 4 1 1
MIRT040029 RPL29 ribosomal protein L29 1 1
MIRT040030 YDJC YdjC homolog (bacterial) 1 1
MIRT040031 MAU2 KIAA0892 1 1
MIRT040032 HEATR2 HEAT repeat containing 2 1 1
MIRT040033 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT040034 DYNC1H1 dynein, cytoplasmic 1, heavy chain 1 1 1
MIRT040035 SFPQ splicing factor proline/glutamine-rich 1 1
MIRT040036 UBE2F ubiquitin-conjugating enzyme E2F (putative) 1 1
MIRT040037 PPP2R5D protein phosphatase 2, regulatory subunit B', delta 1 1
MIRT040038 FOXK1 forkhead box K1 1 1
MIRT040039 IMMT inner membrane protein, mitochondrial 1 1
MIRT040040 RTCA RNA terminal phosphate cyclase domain 1 1 1
MIRT040041 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT040042 STOML2 stomatin (EPB72)-like 2 1 1
MIRT040043 MED8 mediator complex subunit 8 1 1
MIRT040044 FBN2 fibrillin 2 1 1
MIRT040045 EHMT1 euchromatic histone-lysine N-methyltransferase 1 1 1
MIRT040046 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT040047 PROSER1 chromosome 13 open reading frame 23 1 1
MIRT040048 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like 1 1
MIRT040049 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 1
MIRT040050 AP3D1 adaptor-related protein complex 3, delta 1 subunit 1 1
MIRT040051 UNKL unkempt homolog (Drosophila)-like 1 1
MIRT040052 LRRC41 leucine rich repeat containing 41 1 1
MIRT040053 RPL7 ribosomal protein L7 1 1
MIRT040054 YTHDF2 YTH domain family, member 2 1 1
MIRT040055 BEX4 brain expressed, X-linked 4 1 1
MIRT040056 PHTF1 putative homeodomain transcription factor 1 1 1
MIRT040057 MTSS1L metastasis suppressor 1-like 1 1
MIRT040058 TECR trans-2,3-enoyl-CoA reductase 1 1
MIRT040059 MSN moesin 1 1
MIRT040060 CCDC142 coiled-coil domain containing 142 1 1
MIRT040061 PCBP2 poly(rC) binding protein 2 1 1
MIRT040062 MRPS15 mitochondrial ribosomal protein S15 1 1
MIRT040063 ARF1 ADP-ribosylation factor 1 1 1
MIRT040064 PSMD13 proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 1 1
MIRT040065 SEPHS1 selenophosphate synthetase 1 1 1
MIRT040066 PEX14 peroxisomal biogenesis factor 14 1 1
MIRT040067 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT040068 ZER1 zer-1 homolog (C. elegans) 1 1
MIRT040069 SDHC succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa 1 1
MIRT040070 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 1 1
MIRT040071 APEH N-acylaminoacyl-peptide hydrolase 1 1
MIRT040072 PDXDC1 pyridoxal-dependent decarboxylase domain containing 1 1 1
MIRT040073 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT040074 THOP1 thimet oligopeptidase 1 1 1
MIRT040075 HDAC7 histone deacetylase 7 1 1
MIRT040076 ANKRD36B ankyrin repeat domain 36B 1 1
MIRT040077 NUP62 nucleoporin 62kDa 1 1
MIRT040078 SCARB1 scavenger receptor class B, member 1 1 1
MIRT040079 BAG5 BCL2-associated athanogene 5 1 1
MIRT040080 MEGF8 multiple EGF-like-domains 8 1 1
MIRT040081 C16orf59 chromosome 16 open reading frame 59 1 1
MIRT040082 ZFYVE27 zinc finger, FYVE domain containing 27 1 1
MIRT040083 WTIP Wilms tumor 1 interacting protein 1 1
MIRT040084 LRP12 low density lipoprotein receptor-related protein 12 1 1
MIRT040085 CCNF cyclin F 1 1
MIRT040086 EIF3D eukaryotic translation initiation factor 3, subunit D 1 1
MIRT040087 SEMA3E sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E 1 1
MIRT040088 RNF19A ring finger protein 19A 1 1
MIRT040089 MXI1 MAX interactor 1 1 1
MIRT040090 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative function) 1 1
MIRT040091 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT040092 NR1I2 nuclear receptor subfamily 1, group I, member 2 1 1
MIRT040093 KLHL8 kelch-like 8 (Drosophila) 1 1
MIRT040094 TOMM40 translocase of outer mitochondrial membrane 40 homolog (yeast) 1 1
MIRT040095 SOLH small optic lobes homolog (Drosophila) 1 1
MIRT040096 ARPC5L actin related protein 2/3 complex, subunit 5-like 1 1
MIRT040097 PSMD8 proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 1 1
MIRT040098 USP36 ubiquitin specific peptidase 36 1 1
MIRT040099 PDCD7 programmed cell death 7 1 1
MIRT040100 NDUFAB1 NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa 1 1
MIRT040101 TACO1 translational activator of mitochondrially encoded cytochrome c oxidase I 1 1
MIRT040102 TRAPPC10 trafficking protein particle complex 10 1 1
MIRT040103 FKBP15 FK506 binding protein 15, 133kDa 1 1
MIRT040104 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT040105 CCDC137 coiled-coil domain containing 137 1 1
MIRT040106 TRAP1 TNF receptor-associated protein 1 1 1
MIRT040107 PCNXL3 pecanex-like 3 (Drosophila) 1 1
MIRT040108 KIAA0100 KIAA0100 1 1
MIRT040109 HADHA hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit 1 1
MIRT040110 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT040111 RBAK RB-associated KRAB zinc finger 1 1
MIRT040112 ACAD9 acyl-CoA dehydrogenase family, member 9 1 1
MIRT040113 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT040114 CNP 2',3'-cyclic nucleotide 3' phosphodiesterase 1 1
MIRT040115 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT040116 ITPRIPL2 inositol 1,4,5-triphosphate receptor interacting protein-like 2 1 1
MIRT040117 PAPD4 PAP associated domain containing 4 1 1
MIRT040118 LONRF2 LON peptidase N-terminal domain and ring finger 2 1 1
MIRT040119 WDR6 WD repeat domain 6 1 1
MIRT040120 PRRC2B HLA-B associated transcript 2-like 1 1 1
MIRT040121 UBA6 ubiquitin-like modifier activating enzyme 6 1 1
MIRT040122 RAD51D RAD51-like 3 (S. cerevisiae) 1 1
MIRT040123 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 1 1
MIRT040124 UBXN1 UBX domain protein 1 1 1
MIRT040125 RTEL1 regulator of telomere elongation helicase 1 1 1
MIRT040126 EXOC7 exocyst complex component 7 1 1
MIRT040127 PDRG1 p53 and DNA-damage regulated 1 1 1
MIRT040128 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT040129 HIST2H2BE histone cluster 2, H2be 1 1
MIRT040130 C9orf89 chromosome 9 open reading frame 89 1 1
MIRT040131 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT040132 SIRPA signal-regulatory protein alpha 1 1
MIRT040133 PTPN21 protein tyrosine phosphatase, non-receptor type 21 1 1
MIRT040134 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT040135 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT040136 NR1H2 nuclear receptor subfamily 1, group H, member 2 1 1
MIRT040137 SHMT2 serine hydroxymethyltransferase 2 (mitochondrial) 1 1
MIRT040138 MAGOH mago-nashi homolog, proliferation-associated (Drosophila) 1 1
MIRT040139 ATRX alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) 1 1
MIRT040140 WDR67 WD repeat domain 67 1 1
MIRT040141 TMEM66 transmembrane protein 66 1 1
MIRT040142 CLTC clathrin, heavy chain (Hc) 1 1
MIRT040143 REXO4 REX4, RNA exonuclease 4 homolog (S. cerevisiae) 1 1
MIRT040144 HNRNPR heterogeneous nuclear ribonucleoprotein R 1 1
MIRT040145 PDCD11 programmed cell death 11 1 1
MIRT040146 RAD23A RAD23 homolog A (S. cerevisiae) 1 1
MIRT040147 SYVN1 synovial apoptosis inhibitor 1, synoviolin 1 1
MIRT040148 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 1 1
MIRT040149 UVRAG UV radiation resistance associated gene 1 1
MIRT040150 SF3A3 splicing factor 3a, subunit 3, 60kDa 1 1
MIRT040151 TUBB tubulin, beta 1 1
MIRT040152 PRDM16 PR domain containing 16 1 1
MIRT040153 MRPS18B mitochondrial ribosomal protein S18B 1 1
MIRT040154 PRICKLE4 prickle homolog 4 (Drosophila) 1 1
MIRT040155 TMEM115 transmembrane protein 115 1 1
MIRT040156 FREM2 FRAS1 related extracellular matrix protein 2 1 1
MIRT040157 CDC6 cell division cycle 6 homolog (S. cerevisiae) 1 1
MIRT040158 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 1
MIRT040159 SALL3 sal-like 3 (Drosophila) 1 1
MIRT040160 ALYREF THO complex 4 1 1
MIRT040161 SLMO1 slowmo homolog 1 (Drosophila) 1 1
MIRT040162 P4HB prolyl 4-hydroxylase, beta polypeptide 1 1
MIRT040163 RPS2 ribosomal protein S2 1 1
MIRT040164 SDK1 sidekick homolog 1, cell adhesion molecule (chicken) 1 1
MIRT040165 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT040166 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme 1 1
MIRT040167 AKTIP AKT interacting protein 1 1
MIRT040168 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT040169 LMNA lamin A/C 1 1
MIRT040170 ASB3 ankyrin repeat and SOCS box-containing 3 1 1
MIRT040171 H2AFV H2A histone family, member V 1 1
MIRT040172 POLR1A polymerase (RNA) I polypeptide A, 194kDa 1 1
MIRT040173 REEP4 receptor accessory protein 4 1 1
MIRT040174 CCT7 chaperonin containing TCP1, subunit 7 (eta) 1 1
MIRT040175 LMTK2 lemur tyrosine kinase 2 1 1
MIRT040176 CTNND1 catenin (cadherin-associated protein), delta 1 1 1
MIRT040177 PSAP prosaposin 1 1
MIRT040178 ANO6 anoctamin 6 1 1
MIRT040179 ASB8 ankyrin repeat and SOCS box-containing 8 1 1
MIRT040180 SMC3 structural maintenance of chromosomes 3 1 1
MIRT040181 H2AFY H2A histone family, member Y 1 1
MIRT040182 ASB6 ankyrin repeat and SOCS box-containing 6 1 1
MIRT040183 PNMA2 paraneoplastic antigen MA2 1 1
MIRT040184 CCND2 cyclin D2 1 1
MIRT040185 ATXN7L3 ataxin 7-like 3 1 1
MIRT040186 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT040187 PPIF peptidylprolyl isomerase F 1 1
MIRT040188 DNM2 dynamin 2 1 1
MIRT040189 LRPAP1 low density lipoprotein receptor-related protein associated protein 1 1 1
MIRT040190 PRR14L chromosome 22 open reading frame 30 1 1
MIRT040191 DDX11 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae) 1 1
MIRT040192 STK35 serine/threonine kinase 35 1 1
MIRT040193 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 1 1
MIRT040194 TM9SF1 transmembrane 9 superfamily member 1 1 1
MIRT040195 NTRK3 neurotrophic tyrosine kinase, receptor, type 3 1 1
MIRT040196 GANAB glucosidase, alpha; neutral AB 1 1
MIRT040197 LDHB lactate dehydrogenase B 1 1
MIRT040198 UBN1 ubinuclein 1 1 1
MIRT040199 CELSR1 cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila) 1 1
MIRT040200 DDX42 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 1 1
MIRT040201 FBXL19 F-box and leucine-rich repeat protein 19 1 1
MIRT040202 KIRREL kin of IRRE like (Drosophila) 1 1
MIRT040203 DLG3 discs, large homolog 3 (Drosophila) 1 1
MIRT040204 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT040205 C11orf57 chromosome 11 open reading frame 57 1 1
MIRT040206 NUDT16 nudix (nucleoside diphosphate linked moiety X)-type motif 16 1 1
MIRT040207 TAF6 TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa 1 1
MIRT040208 TPM3 tropomyosin 3 1 1
MIRT040209 PAF1 Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) 1 1
MIRT040210 EZH1 enhancer of zeste homolog 1 (Drosophila) 1 1
MIRT040211 PLEC plectin 1 1
MIRT040212 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT040213 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT040214 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT040215 TUBB2B tubulin, beta 2B 1 1
MIRT040216 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT040217 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT040218 IRS4 insulin receptor substrate 4 1 1
MIRT040219 TNRC18 trinucleotide repeat containing 18 1 1
MIRT040220 SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 1 1
MIRT040221 HIST1H2BD histone cluster 1, H2bd 1 1
MIRT040222 CPT1C carnitine palmitoyltransferase 1C 1 1
MIRT040223 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT040224 OGFR opioid growth factor receptor 1 1
MIRT040225 FOXN4 forkhead box N4 1 1
MIRT040226 CCHCR1 coiled-coil alpha-helical rod protein 1 1 1
MIRT040227 SF3B1 splicing factor 3b, subunit 1, 155kDa 1 1
MIRT040228 RNF185 ring finger protein 185 1 1
MIRT040229 FAM109A family with sequence similarity 109, member A 1 1
MIRT040230 KLHL11 kelch-like 11 (Drosophila) 1 1
MIRT040231 PEF1 penta-EF-hand domain containing 1 1 1
MIRT040232 MATR3 matrin 3 1 1
MIRT040233 NUP50 nucleoporin 50kDa 1 1
MIRT040234 SOX8 SRY (sex determining region Y)-box 8 1 1
MIRT040235 RPL5 ribosomal protein L5 1 1
MIRT040236 EMD emerin 1 1
MIRT040237 TRIP12 thyroid hormone receptor interactor 12 1 1
MIRT040238 TIAM1 T-cell lymphoma invasion and metastasis 1 1 1
MIRT040239 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT040240 HIST2H2AB histone cluster 2, H2ab 1 1
MIRT040241 SEPT2 septin 2 1 1
MIRT040242 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT040243 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT040244 SLCO4C1 solute carrier organic anion transporter family, member 4C1 1 1
MIRT040245 HIST4H4 histone cluster 4, H4 1 1
MIRT040246 YY1 YY1 transcription factor 1 1
MIRT040247 ITGA8 integrin, alpha 8 1 1
MIRT040248 TMEM33 transmembrane protein 33 1 1
MIRT040249 CTCF CCCTC-binding factor (zinc finger protein) 1 1
MIRT040250 GINS2 GINS complex subunit 2 (Psf2 homolog) 1 1
MIRT040251 ZZEF1 zinc finger, ZZ-type with EF-hand domain 1 1 1
MIRT040252 CERK ceramide kinase 1 1
MIRT040253 MTG1 mitochondrial GTPase 1 homolog (S. cerevisiae) 1 1
MIRT040254 FN1 fibronectin 1 1 1
MIRT040255 CEP250 centrosomal protein 250kDa 1 1
MIRT040256 AQP3 aquaporin 3 (Gill blood group) 1 1
MIRT040257 PDS5A PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) 1 1
MIRT040258 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT040259 AP2B1 adaptor-related protein complex 2, beta 1 subunit 1 1
MIRT040260 MIER3 mesoderm induction early response 1, family member 3 1 1
MIRT040261 SGMS2 sphingomyelin synthase 2 1 1
MIRT040262 RAN RAN, member RAS oncogene family 1 1
MIRT040263 NRD1 nardilysin (N-arginine dibasic convertase) 1 1
MIRT040264 DEDD death effector domain containing 1 1
MIRT040265 MYH14 myosin, heavy chain 14, non-muscle 1 1
MIRT040266 RALBP1 ralA binding protein 1 1 1
MIRT040267 SAE1 SUMO1 activating enzyme subunit 1 1 1
MIRT040268 HIPK2 homeodomain interacting protein kinase 2 1 1
MIRT040269 NOC2L nucleolar complex associated 2 homolog (S. cerevisiae) 1 1
MIRT040270 SSR2 signal sequence receptor, beta (translocon-associated protein beta) 1 1
MIRT040271 HIST1H2BG histone cluster 1, H2bg 1 1
MIRT040272 CTC1 chromosome 17 open reading frame 68 1 1
MIRT040273 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT040274 WWP2 WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT040275 IRF2BPL chromosome 14 open reading frame 4 1 1
MIRT040276 PRNP prion protein 1 1
MIRT040277 SMOX spermine oxidase 1 1
MIRT040278 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT040279 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
MIRT040280 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 1 1
MIRT040281 C19orf43 chromosome 19 open reading frame 43 1 1
MIRT040282 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT040283 LAMTOR2 roadblock domain containing 3 1 1
MIRT040284 CHERP calcium homeostasis endoplasmic reticulum protein 1 1
MIRT040285 TBCB tubulin folding cofactor B 1 1
MIRT040286 PLXNA1 plexin A1 1 1
MIRT040287 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 1 1
MIRT040288 CLN6 ceroid-lipofuscinosis, neuronal 6, late infantile, variant 1 1
MIRT040289 USP7 ubiquitin specific peptidase 7 (herpes virus-associated) 1 1
MIRT040290 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 1
MIRT040291 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 1 1
MIRT040292 MTA2 metastasis associated 1 family, member 2 1 1
MIRT040293 TYMS thymidylate synthetase 1 1
MIRT040294 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 1
MIRT040295 KRBA1 KRAB-A domain containing 1 1 1
MIRT040296 SEC61A1 Sec61 alpha 1 subunit (S. cerevisiae) 1 1
MIRT040297 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT040298 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT040299 UBE2G2 ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) 1 1
MIRT040300 AKAP8L A kinase (PRKA) anchor protein 8-like 1 1
MIRT040301 TMCO4 transmembrane and coiled-coil domains 4 1 1
MIRT040302 DRG1 developmentally regulated GTP binding protein 1 1 1
MIRT040303 SEMA7A semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) 1 1
MIRT040304 DOM3Z dom-3 homolog Z (C. elegans) 1 1
MIRT040305 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT040306 GALK1 galactokinase 1 1 1
MIRT040307 RPL31 ribosomal protein L31 1 1
MIRT040308 PHKG2 phosphorylase kinase, gamma 2 (testis) 1 1
MIRT040309 DST dystonin 1 1
MIRT040310 PVR poliovirus receptor 1 1
MIRT040311 FLCN folliculin 1 1
MIRT040312 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT040313 PSMB7 proteasome (prosome, macropain) subunit, beta type, 7 1 1
MIRT040314 RCC2 regulator of chromosome condensation 2 1 1
MIRT040315 PLEKHB2 pleckstrin homology domain containing, family B (evectins) member 2 1 1
MIRT040316 HMGXB3 HMG box domain containing 3 1 1
MIRT040317 PFDN6 prefoldin subunit 6 1 1
MIRT040318 MYO1D myosin ID 1 1
MIRT040319 MRPL38 mitochondrial ribosomal protein L38 1 1
MIRT040320 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 1 1
MIRT040321 CYC1 cytochrome c-1 1 1
MIRT040322 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT040323 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT040324 MARS methionyl-tRNA synthetase 1 1
MIRT040325 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT040326 FAM120A family with sequence similarity 120A 1 1
MIRT040327 UBE2C ubiquitin-conjugating enzyme E2C 1 1
MIRT040328 NRIP1 nuclear receptor interacting protein 1 1 1
MIRT040329 PODXL2 podocalyxin-like 2 1 1
MIRT040330 SOCS4 suppressor of cytokine signaling 4 1 1
MIRT040331 FBXL14 F-box and leucine-rich repeat protein 14 1 1
MIRT040332 PDGFC platelet derived growth factor C 1 1
MIRT040333 DPM3 dolichyl-phosphate mannosyltransferase polypeptide 3 1 1
MIRT040334 LIG1 ligase I, DNA, ATP-dependent 1 1
MIRT040335 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT040336 SLK STE20-like kinase (yeast) 1 1
MIRT040337 IREB2 iron-responsive element binding protein 2 1 1
MIRT040338 MARCKSL1 MARCKS-like 1 1 1
MIRT040339 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 1 1
MIRT040340 SLC38A7 solute carrier family 38, member 7 1 1
MIRT040341 MAGED1 melanoma antigen family D, 1 1 1
MIRT040342 KIAA1191 KIAA1191 1 1
MIRT040343 NONO non-POU domain containing, octamer-binding 1 1
MIRT040344 EZR ezrin 1 1
MIRT040345 OGG1 8-oxoguanine DNA glycosylase 1 1
MIRT040346 CD99 CD99 molecule 1 1
MIRT040347 FSTL1 follistatin-like 1 1 1
MIRT040348 RADIL Ras association and DIL domains 1 1
MIRT040349 CHD5 chromodomain helicase DNA binding protein 5 1 1
MIRT040350 RBM8A RNA binding motif protein 8A 1 1
MIRT040351 MAP7D1 MAP7 domain containing 1 1 1
MIRT040352 ZNF263 zinc finger protein 263 1 1
MIRT040353 PKD1 polycystic kidney disease 1 (autosomal dominant) 1 1
MIRT040354 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT040355 HCFC1 host cell factor C1 (VP16-accessory protein) 1 1
MIRT040356 CKAP4 cytoskeleton-associated protein 4 1 1
MIRT040357 DPP3 dipeptidyl-peptidase 3 1 1
MIRT040358 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 1 1
MIRT040359 GOLGA2 golgin A2 1 1
MIRT040360 CTPS1 CTP synthase 1 1
MIRT040361 EHMT2 euchromatic histone-lysine N-methyltransferase 2 1 1
MIRT040362 ADRBK2 adrenergic, beta, receptor kinase 2 1 1
MIRT040363 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT040364 RNPS1 RNA binding protein S1, serine-rich domain 1 1
MIRT040365 HS6ST1 heparan sulfate 6-O-sulfotransferase 1 1 1
MIRT040366 PGAM4 phosphoglycerate mutase family member 4 1 1
MIRT040367 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT040368 ADCK2 aarF domain containing kinase 2 1 1
MIRT040369 TUBA1A tubulin, alpha 1a 1 1
MIRT040370 TUBA1B tubulin, alpha 1b 1 1
MIRT040371 CHST15 carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 1 1
MIRT040372 SIL1 SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae) 1 1
MIRT040373 LENG8 leukocyte receptor cluster (LRC) member 8 1 1
MIRT040374 PPP1R14B protein phosphatase 1, regulatory (inhibitor) subunit 14B 1 1
MIRT040375 NCOR1 nuclear receptor corepressor 1 1 1
MIRT040376 PPP1R10 protein phosphatase 1, regulatory (inhibitor) subunit 10 1 1
MIRT040377 WBP1L chromosome 10 open reading frame 26 1 1
MIRT040378 WDR33 WD repeat domain 33 1 1
MIRT040379 HIST2H3A histone cluster 2, H3a 1 1
MIRT040380 SCARA3 scavenger receptor class A, member 3 1 1
MIRT040381 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT040382 SSH1 slingshot homolog 1 (Drosophila) 1 1
MIRT040383 VANGL1 vang-like 1 (van gogh, Drosophila) 1 1
MIRT040384 PLOD2 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 1 1
MIRT040385 RAB23 RAB23, member RAS oncogene family 1 1
MIRT040386 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT040387 POLR2B polymerase (RNA) II (DNA directed) polypeptide B, 140kDa 1 1
MIRT040388 BCLAF1 BCL2-associated transcription factor 1 1 1
MIRT040389 EBP emopamil binding protein (sterol isomerase) 1 1
MIRT040390 VARS valyl-tRNA synthetase 1 1
MIRT040391 APBA3 amyloid beta (A4) precursor protein-binding, family A, member 3 1 1
MIRT040392 FAM98A family with sequence similarity 98, member A 1 1
MIRT040393 TCERG1 transcription elongation regulator 1 1 1
MIRT040394 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT040395 HYOU1 hypoxia up-regulated 1 1 1
MIRT040396 PTPRU protein tyrosine phosphatase, receptor type, U 1 1
MIRT040397 IL6ST interleukin 6 signal transducer (gp130, oncostatin M receptor) 1 1
MIRT040398 RBM15B RNA binding motif protein 15B 1 1
MIRT040399 WDR62 WD repeat domain 62 1 1
MIRT040400 OSBPL11 oxysterol binding protein-like 11 1 1
MIRT040401 ASNS asparagine synthetase (glutamine-hydrolyzing) 1 1
MIRT040402 DDIT4 DNA-damage-inducible transcript 4 1 1
MIRT040403 KIFC2 kinesin family member C2 1 1
MIRT040404 TUSC2 tumor suppressor candidate 2 1 1
MIRT040405 ALDOC aldolase C, fructose-bisphosphate 1 1
MIRT040406 NRBP1 nuclear receptor binding protein 1 1 1
MIRT040407 MPP2 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) 1 1
MIRT040408 ATN1 atrophin 1 1 1
MIRT040409 PIN4 protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) 1 1
MIRT040410 THUMPD3 THUMP domain containing 3 1 1
MIRT040411 SHKBP1 SH3KBP1 binding protein 1 1 1
MIRT040412 NUPR1 nuclear protein, transcriptional regulator, 1 1 1
MIRT040413 TATDN2 TatD DNase domain containing 2 1 1
MIRT040414 ATPIF1 ATPase inhibitory factor 1 1 1
MIRT040415 ABLIM1 actin binding LIM protein 1 1 1
MIRT040416 C17orf51 chromosome 17 open reading frame 51 1 1
MIRT040417 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT040418 PABPN1 poly(A) binding protein, nuclear 1 1 1
MIRT040419 CIC capicua homolog (Drosophila) 1 1
MIRT040420 NEK9 NIMA (never in mitosis gene a)- related kinase 9 1 1
MIRT040421 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT040422 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 1 1
MIRT040423 ZNF687 zinc finger protein 687 1 1
MIRT040424 IDH3B isocitrate dehydrogenase 3 (NAD+) beta 1 1
MIRT040425 LRBA LPS-responsive vesicle trafficking, beach and anchor containing 1 1
MIRT040426 KDM4B lysine (K)-specific demethylase 4B 1 1
MIRT040427 CAMSAP3 KIAA1543 1 1
MIRT040428 ALDH1B1 aldehyde dehydrogenase 1 family, member B1 1 1
MIRT040429 C9orf78 chromosome 9 open reading frame 78 1 1
MIRT040430 ZNF711 zinc finger protein 711 1 1
MIRT040431 NAF1 nuclear assembly factor 1 homolog (S. cerevisiae) 1 1
MIRT040432 H1F0 H1 histone family, member 0 1 1
MIRT040433 HLA-A major histocompatibility complex, class I, A 1 1
MIRT040434 EPN2 epsin 2 1 1
MIRT040435 EP400 E1A binding protein p400 1 1
MIRT040436 GADD45GIP1 growth arrest and DNA-damage-inducible, gamma interacting protein 1 1 1
MIRT040437 HOXC4 homeobox C4 1 1
MIRT040438 SUV39H1 suppressor of variegation 3-9 homolog 1 (Drosophila) 1 1
MIRT040439 CIZ1 CDKN1A interacting zinc finger protein 1 1 1
MIRT040440 ANKRD11 ankyrin repeat domain 11 1 1
MIRT040441 NDUFS1 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) 1 1
MIRT040442 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1
MIRT040443 MOV10 Mov10, Moloney leukemia virus 10, homolog (mouse) 1 1
MIRT040444 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa 1 1
MIRT040445 NAT8L N-acetyltransferase 8-like (GCN5-related, putative) 1 1
MIRT040446 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT040447 MID1IP1 MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) 1 1
MIRT040448 GNPTAB N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits 1 1
MIRT040449 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT040450 MYO9A myosin IXA 1 1
MIRT040451 DLAT dihydrolipoamide S-acetyltransferase 1 1
MIRT040452 OGFOD1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT040453 NIP7 nuclear import 7 homolog (S. cerevisiae) 1 1
MIRT040454 LRRC37A2 leucine rich repeat containing 37, member A2 1 1
MIRT040455 LDLRAP1 low density lipoprotein receptor adaptor protein 1 1 1
MIRT040456 STAT1 signal transducer and activator of transcription 1, 91kDa 1 1
MIRT040457 RRP1 ribosomal RNA processing 1 homolog (S. cerevisiae) 1 1
MIRT040458 CDCA4 cell division cycle associated 4 1 1
MIRT040459 TMSB10 thymosin beta 10 1 1
MIRT040460 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT040461 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT040462 MDC1 mediator of DNA-damage checkpoint 1 1 1
MIRT040463 COL4A2 collagen, type IV, alpha 2 1 1
MIRT040464 ZNF784 zinc finger protein 784 1 1
MIRT040465 DDX55 DEAD (Asp-Glu-Ala-Asp) box polypeptide 55 1 1
MIRT040466 DAP3 death associated protein 3 1 1
MIRT040467 RGMA RGM domain family, member A 1 1
MIRT040468 MRPS12 mitochondrial ribosomal protein S12 1 1
MIRT040469 FUS fused in sarcoma 1 1
MIRT040470 TCF3 transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) 1 1
MIRT040471 SLC4A2 solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1) 1 1
MIRT040472 USP19 ubiquitin specific peptidase 19 1 1
MIRT040473 MAGEF1 melanoma antigen family F, 1 1 1
MIRT040474 SYK spleen tyrosine kinase 1 1
MIRT040475 GDF11 growth differentiation factor 11 1 1