Accession ID: MIRT040627 [miRNA, hsa-miR-92b-3p :: SYNGAP1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-92bLinkOut: [miRBase ]
Synonyms MIRN92B, hsa-mir-92b, MIR92B
Description Homo sapiens miR-92b stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-92b-3p
Mature Sequence 61| UAUUGCACUCGUCCCGGCCUCC |82
Evidence Experimental
Experiments Microarray
Putative hsa-miR-92b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-92b-3p :: SYNGAP1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ccTCCGGCCCTGCTCACGTTAt 5'
            |||::|   | |||||| | 
Target 5' ggAGGTTG---CCAGTGCACTa 3'
6 - 24
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
635 hsa-miR-92b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001173 CORO1A coronin, actin binding protein, 1A 1 1
MIRT004048 SLC15A1 solute carrier family 15 (oligopeptide transporter), member 1 4 1
MIRT004293 CDKN1C cyclin-dependent kinase inhibitor 1C (p57, Kip2) 3 1
MIRT004351 PRMT5 protein arginine methyltransferase 5 2 1
MIRT035518 NLK nemo-like kinase 1 1
MIRT040525 EFNB1 ephrin-B1 1 1
MIRT040526 GSTM3 glutathione S-transferase mu 3 (brain) 1 1
MIRT040527 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT040528 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT040529 AMIGO1 adhesion molecule with Ig-like domain 1 1 1
MIRT040530 FBXO31 F-box protein 31 1 1
MIRT040531 OR6V1 olfactory receptor, family 6, subfamily V, member 1 1 1
MIRT040532 RBBP5 retinoblastoma binding protein 5 1 1
MIRT040533 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT040534 NCL nucleolin 1 1
MIRT040535 NIPA2 non imprinted in Prader-Willi/Angelman syndrome 2 1 1
MIRT040536 MRPL39 mitochondrial ribosomal protein L39 1 1
MIRT040537 ANKRD52 ankyrin repeat domain 52 1 1
MIRT040538 PLXND1 plexin D1 1 1
MIRT040539 CTC1 CTS telomere maintenance complex component 1 1 1
MIRT040540 ZNF282 zinc finger protein 282 1 1
MIRT040541 HPS6 Hermansky-Pudlak syndrome 6 1 1
MIRT040542 WARS tryptophanyl-tRNA synthetase 1 1
MIRT040543 PRRC2B proline-rich coiled-coil 2B 1 3
MIRT040544 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 3
MIRT040545 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT040546 GPR55 G protein-coupled receptor 55 1 1
MIRT040547 FBXO21 F-box protein 21 1 1
MIRT040548 MYH10 myosin, heavy chain 10, non-muscle 1 1
MIRT040549 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT040550 UROD uroporphyrinogen decarboxylase 1 1
MIRT040551 DNAJC30 DnaJ (Hsp40) homolog, subfamily C, member 30 1 2
MIRT040552 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT040553 SMAP2 small ArfGAP2 1 1
MIRT040554 IK IK cytokine, down-regulator of HLA II 1 1
MIRT040555 TRAFD1 TRAF-type zinc finger domain containing 1 1 1
MIRT040556 MSH3 mutS homolog 3 (E. coli) 1 1
MIRT040557 UBE2Q2 ubiquitin-conjugating enzyme E2Q family member 2 1 1
MIRT040558 MRPL53 mitochondrial ribosomal protein L53 1 1
MIRT040559 ABCA3 ATP-binding cassette, sub-family A (ABC1), member 3 1 1
MIRT040560 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme 1 1
MIRT040561 FOXN3 forkhead box N3 1 1
MIRT040562 HIST2H4B histone cluster 2, H4b 1 1
MIRT040563 ARL6IP4 ADP-ribosylation-like factor 6 interacting protein 4 1 1
MIRT040564 FLNA filamin A, alpha 1 1
MIRT040565 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT040566 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT040567 SFXN1 sideroflexin 1 1 1
MIRT040568 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT040569 ADCK4 aarF domain containing kinase 4 1 1
MIRT040570 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT040571 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT040572 RNF168 ring finger protein 168, E3 ubiquitin protein ligase 1 1
MIRT040573 PIN4 protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) 1 1
MIRT040574 KDM3A lysine (K)-specific demethylase 3A 1 1
MIRT040575 DEXI Dexi homolog (mouse) 1 1
MIRT040576 RPS3A ribosomal protein S3A 1 1
MIRT040577 APOLD1 apolipoprotein L domain containing 1 1 1
MIRT040578 PFN1 profilin 1 1 1
MIRT040579 TAF12 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa 1 1
MIRT040580 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 2
MIRT040581 MEX3B mex-3 homolog B (C. elegans) 1 1
MIRT040582 HEATR2 HEAT repeat containing 2 1 1
MIRT040583 RTKN2 rhotekin 2 1 1
MIRT040584 SIN3A SIN3 transcription regulator homolog A (yeast) 1 1
MIRT040585 PHF23 PHD finger protein 23 1 1
MIRT040586 FLNB filamin B, beta 1 1
MIRT040587 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT040588 XPO7 exportin 7 1 1
MIRT040589 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT040590 RAN RAN, member RAS oncogene family 1 1
MIRT040591 LUC7L3 LUC7-like 3 (S. cerevisiae) 1 1
MIRT040592 GSS glutathione synthetase 1 1
MIRT040593 ZBTB48 zinc finger and BTB domain containing 48 1 1
MIRT040594 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT040595 SMG1 smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 2
MIRT040596 METRN meteorin, glial cell differentiation regulator 1 1
MIRT040597 HAGH hydroxyacylglutathione hydrolase 1 1
MIRT040598 RERE arginine-glutamic acid dipeptide (RE) repeats 1 1
MIRT040599 USF1 upstream transcription factor 1 1 1
MIRT040600 CEP152 centrosomal protein 152kDa 1 1
MIRT040601 ADAT1 adenosine deaminase, tRNA-specific 1 1 1
MIRT040602 NONO non-POU domain containing, octamer-binding 1 1
MIRT040603 RPAP1 RNA polymerase II associated protein 1 1 1
MIRT040604 NABP2 nucleic acid binding protein 2 1 1
MIRT040605 EZH2 enhancer of zeste homolog 2 (Drosophila) 1 1
MIRT040606 GNB2 guanine nucleotide binding protein (G protein), beta polypeptide 2 1 1
MIRT040607 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT040608 DOCK11 dedicator of cytokinesis 11 1 1
MIRT040609 OGFR opioid growth factor receptor 1 1
MIRT040610 LARS leucyl-tRNA synthetase 1 1
MIRT040611 SRP68 signal recognition particle 68kDa 1 1
MIRT040612 UNC5B unc-5 homolog B (C. elegans) 1 1
MIRT040613 SOGA1 suppressor of glucose, autophagy associated 1 1 1
MIRT040614 LYST lysosomal trafficking regulator 1 1
MIRT040615 SPC24 SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT040616 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 1 1
MIRT040617 RPL8 ribosomal protein L8 1 1
MIRT040618 ARID1B AT rich interactive domain 1B (SWI1-like) 1 4
MIRT040619 AP1B1 adaptor-related protein complex 1, beta 1 subunit 1 1
MIRT040620 CAMSAP1 calmodulin regulated spectrin-associated protein 1 1 1
MIRT040621 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 1 1
MIRT040622 TMEM115 transmembrane protein 115 1 1
MIRT040623 GATA6 GATA binding protein 6 1 2
MIRT040624 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT040625 PSMD3 proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 1 1
MIRT040626 RPS28 ribosomal protein S28 1 1
MIRT040627 SYNGAP1 synaptic Ras GTPase activating protein 1 1 1
MIRT040628 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT040629 RPLP0 ribosomal protein, large, P0 1 1
MIRT040630 EDF1 endothelial differentiation-related factor 1 1 1
MIRT040631 RPS4X ribosomal protein S4, X-linked 1 1
MIRT040632 MBNL1 muscleblind-like splicing regulator 1 1 1
MIRT040633 GPX1 glutathione peroxidase 1 1 1
MIRT040634 ACTN4 actinin, alpha 4 1 1
MIRT040635 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT040636 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 1 1
MIRT040637 PARVG parvin, gamma 1 1
MIRT040638 TLN1 talin 1 1 1
MIRT040639 PHF19 PHD finger protein 19 1 1
MIRT040640 SLCO4A1 solute carrier organic anion transporter family, member 4A1 1 1
MIRT040641 COPA coatomer protein complex, subunit alpha 1 1
MIRT040642 FJX1 four jointed box 1 (Drosophila) 1 1
MIRT040643 PIGO phosphatidylinositol glycan anchor biosynthesis, class O 1 1
MIRT040644 ATP13A1 ATPase type 13A1 1 1
MIRT040645 BAG6 BCL2-associated athanogene 6 1 1
MIRT040646 RBM10 RNA binding motif protein 10 1 1
MIRT040647 HIST1H2BF histone cluster 1, H2bf 1 1
MIRT040648 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT040649 KEAP1 kelch-like ECH-associated protein 1 1 1
MIRT040650 SFPQ splicing factor proline/glutamine-rich 1 1
MIRT040651 REXO2 REX2, RNA exonuclease 2 homolog (S. cerevisiae) 1 1
MIRT040652 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 1
MIRT040653 IGSF8 immunoglobulin superfamily, member 8 1 1
MIRT040654 AKAP8 A kinase (PRKA) anchor protein 8 1 1
MIRT040655 RBM14 RNA binding motif protein 14 1 1
MIRT040656 PYCR2 pyrroline-5-carboxylate reductase family, member 2 1 1
MIRT040657 FASN fatty acid synthase 1 1
MIRT040658 STRBP spermatid perinuclear RNA binding protein 1 1
MIRT040659 HIST1H2AM histone cluster 1, H2am 1 1
MIRT040660 FBN2 fibrillin 2 1 1
MIRT040661 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 1
MIRT040662 ORC1 origin recognition complex, subunit 1 1 1
MIRT040663 CISD1 CDGSH iron sulfur domain 1 1 1
MIRT040664 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT040665 C9orf64 chromosome 9 open reading frame 64 1 1
MIRT040666 ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 1 1
MIRT040667 RRP1 ribosomal RNA processing 1 homolog (S. cerevisiae) 1 1
MIRT040668 TNPO2 transportin 2 1 1
MIRT040669 SLC25A5 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 1 1
MIRT040670 IARS isoleucyl-tRNA synthetase 1 1
MIRT040671 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT040672 G6PD glucose-6-phosphate dehydrogenase 1 1
MIRT040673 COX1 cytochrome c oxidase subunit I 1 1
MIRT040674 FAM58A family with sequence similarity 58, member A 1 1
MIRT040675 MPHOSPH10 M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein) 1 1
MIRT040676 PLA2G12A phospholipase A2, group XIIA 1 1
MIRT040677 DENND4A DENN/MADD domain containing 4A 1 1
MIRT040678 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT040679 XRCC1 X-ray repair complementing defective repair in Chinese hamster cells 1 1 1
MIRT040680 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 1 1
MIRT040681 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT040682 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 1 5
MIRT040683 CAPRIN1 cell cycle associated protein 1 1 1
MIRT040684 RPL3 ribosomal protein L3 1 1
MIRT040685 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT040686 PHRF1 PHD and ring finger domains 1 1 1
MIRT040687 SNRNP70 small nuclear ribonucleoprotein 70kDa (U1) 1 1
MIRT040688 WDR82 WD repeat domain 82 1 1
MIRT040689 PSMB3 proteasome (prosome, macropain) subunit, beta type, 3 1 1
MIRT040690 GRB2 growth factor receptor-bound protein 2 1 1
MIRT040691 BRD8 bromodomain containing 8 1 1
MIRT040692 TSPYL1 TSPY-like 1 1 1
MIRT040693 CCDC22 coiled-coil domain containing 22 1 1
MIRT040694 XPO5 exportin 5 1 1
MIRT040695 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT040696 THAP10 THAP domain containing 10 1 1
MIRT040697 GRHPR glyoxylate reductase/hydroxypyruvate reductase 1 1
MIRT040698 PWP1 PWP1 homolog (S. cerevisiae) 1 1
MIRT040699 SLC25A4 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 1 1
MIRT040700 BBX bobby sox homolog (Drosophila) 1 1
MIRT040701 DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) 1 1
MIRT040702 ABR active BCR-related 1 1
MIRT040703 SCAF1 SR-related CTD-associated factor 1 1 1
MIRT040704 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT040705 FAM3C family with sequence similarity 3, member C 1 1
MIRT040706 PSMA7 proteasome (prosome, macropain) subunit, alpha type, 7 1 1
MIRT040707 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT040708 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT040709 MRPS23 mitochondrial ribosomal protein S23 1 1
MIRT040710 SOLH small optic lobes homolog (Drosophila) 1 1
MIRT040711 ERICH1 glutamate-rich 1 1 1
MIRT040712 PABPN1 poly(A) binding protein, nuclear 1 1 1
MIRT040713 EIF2AK1 eukaryotic translation initiation factor 2-alpha kinase 1 1 1
MIRT040714 PFKFB4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 1 1
MIRT040715 LDLR low density lipoprotein receptor 1 1
MIRT040716 RBM8A RNA binding motif protein 8A 1 1
MIRT040717 PARK7 parkinson protein 7 1 1
MIRT040718 POM121 POM121 transmembrane nucleoporin 1 1
MIRT040719 RPS14 ribosomal protein S14 1 1
MIRT040720 TUBB6 tubulin, beta 6 class V 1 1
MIRT040721 ZSCAN18 zinc finger and SCAN domain containing 18 1 1
MIRT040722 GLOD4 glyoxalase domain containing 4 1 1
MIRT040723 AP2A2 adaptor-related protein complex 2, alpha 2 subunit 1 1
MIRT040724 SSRP1 structure specific recognition protein 1 1 1
MIRT040725 SYMPK symplekin 1 1
MIRT040726 PRR5 proline rich 5 (renal) 1 1
MIRT040727 ORAOV1 oral cancer overexpressed 1 1 1
MIRT040728 TCP11L1 t-complex 11, testis-specific-like 1 1 1
MIRT040729 PRRC2A proline-rich coiled-coil 2A 1 1
MIRT040730 MDK midkine (neurite growth-promoting factor 2) 1 1
MIRT040731 LTBP3 latent transforming growth factor beta binding protein 3 1 1
MIRT040732 KDM2A lysine (K)-specific demethylase 2A 1 1
MIRT040733 SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 1 1
MIRT040734 EIF3A eukaryotic translation initiation factor 3, subunit A 1 1
MIRT040735 CRIM1 cysteine rich transmembrane BMP regulator 1 (chordin-like) 1 1
MIRT040736 SURF6 surfeit 6 1 1
MIRT040737 MAFK v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) 1 1
MIRT040738 RNF181 ring finger protein 181 1 1
MIRT040739 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT055316 DUSP5 dual specificity phosphatase 5 1 5
MIRT055793 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 6
MIRT057115 DDIT4 DNA-damage-inducible transcript 4 1 2
MIRT059667 GATAD2B GATA zinc finger domain containing 2B 1 2
MIRT059927 ZDHHC5 zinc finger, DHHC-type containing 5 1 2
MIRT061613 BTG2 BTG family, member 2 1 3
MIRT061743 ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 1 1
MIRT066481 HMGA2 high mobility group AT-hook 2 1 1
MIRT068743 COG3 component of oligomeric golgi complex 3 1 1
MIRT069314 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT069390 ZFYVE21 zinc finger, FYVE domain containing 21 1 1
MIRT069975 GEMIN2 gem (nuclear organelle) associated protein 2 1 1
MIRT072532 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT074765 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 1 2
MIRT075713 GAN gigaxonin 1 1
MIRT076202 GID4 GID complex subunit 4, VID24 homolog (S. cerevisiae) 1 3
MIRT077390 NSF N-ethylmaleimide-sensitive factor 1 1
MIRT077513 UBE2Z ubiquitin-conjugating enzyme E2Z 1 2
MIRT077904 TOB1 transducer of ERBB2, 1 1 4
MIRT079207 GAA glucosidase, alpha; acid 1 1
MIRT082251 MED29 mediator complex subunit 29 1 2
MIRT082435 CIC capicua homolog (Drosophila) 1 4
MIRT082477 PPP1R37 protein phosphatase 1, regulatory subunit 37 1 1
MIRT082779 ZNF264 zinc finger protein 264 1 1
MIRT084534 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 5
MIRT085310 UBXN4 UBX domain protein 4 1 5
MIRT086367 SSFA2 sperm specific antigen 2 1 5
MIRT087456 NF2 neurofibromin 2 (merlin) 1 1
MIRT088866 FOXN2 forkhead box N2 1 7
MIRT091083 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT092186 ITPR1 inositol 1,4,5-trisphosphate receptor, type 1 1 4
MIRT092327 EDEM1 ER degradation enhancer, mannosidase alpha-like 1 1 4
MIRT092391 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT093534 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 1 3
MIRT095658 TRIO trio Rho guanine nucleotide exchange factor 1 1
MIRT096936 PAPD7 PAP associated domain containing 7 1 5
MIRT097027 MAP1B microtubule-associated protein 1B 1 2
MIRT097115 TNPO1 transportin 1 1 1
MIRT097151 FCHO2 FCH domain only 2 1 1
MIRT097276 HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase 1 1
MIRT099140 MYLIP myosin regulatory light chain interacting protein 1 4
MIRT099907 SOX4 SRY (sex determining region Y)-box 4 1 7
MIRT101286 FAM135A family with sequence similarity 135, member A 1 1
MIRT102291 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 6
MIRT102509 KLHDC10 kelch domain containing 10 1 2
MIRT102894 INSIG1 insulin induced gene 1 1 2
MIRT103438 SNX10 sorting nexin 10 1 1
MIRT104749 FZD6 frizzled family receptor 6 1 1
MIRT106278 SGK3 serum/glucocorticoid regulated kinase family, member 3 1 1
MIRT107664 TESK1 testis-specific kinase 1 1 1
MIRT109190 VMA21 VMA21 vacuolar H+-ATPase homolog (S. cerevisiae) 1 3
MIRT109929 CDK16 cyclin-dependent kinase 16 1 1
MIRT126396 EDRF1 chromosome 10 open reading frame 137 1 1
MIRT127293 VDAC2 voltage-dependent anion channel 2 1 1
MIRT128091 KIF1B kinesin family member 1B 1 1
MIRT129552 FAR1 fatty acyl CoA reductase 1 1 1
MIRT129995 CPTP glycolipid transfer protein domain containing 1 1 1
MIRT130353 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT130487 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT131664 UVRAG UV radiation resistance associated gene 1 1
MIRT131821 XPR1 xenotropic and polytropic retrovirus receptor 1 1 1
MIRT134141 KLHL42 kelch domain containing 5 1 1
MIRT135571 SPRYD4 SPRY domain containing 4 1 2
MIRT136301 NECAP1 NECAP endocytosis associated 1 1 1
MIRT140807 SMAD6 SMAD family member 6 1 1
MIRT142666 KIAA0556 KIAA0556 1 1
MIRT143326 PAPD5 PAP associated domain containing 5 1 1
MIRT143605 RBL2 retinoblastoma-like 2 (p130) 1 1
MIRT144952 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT150805 ZNF430 zinc finger protein 430 1 1
MIRT150925 ZNF492 zinc finger protein 492 1 1
MIRT154087 ARFGEF2 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) 1 1
MIRT155532 MORC3 MORC family CW-type zinc finger 3 1 1
MIRT156709 C2ORF69 chromosome 2 open reading frame 69 1 1
MIRT157000 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT161153 SLC25A36 solute carrier family 25 (pyrimidine nucleotide carrier ), member 36 1 4
MIRT161328 SELT selenoprotein T 1 1
MIRT161829 MFN1 mitofusin 1 1 1
MIRT161900 FXR1 fragile X mental retardation, autosomal homolog 1 1 1
MIRT162309 KAT2B K(lysine) acetyltransferase 2B 1 1
MIRT162448 GOLGA4 golgin A4 1 1
MIRT162574 KLHL18 kelch-like 18 (Drosophila) 1 1
MIRT163749 SETD5 SET domain containing 5 1 1
MIRT164002 KIAA1109 KIAA1109 1 3
MIRT164356 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164691 RNF4 ring finger protein 4 1 2
MIRT165187 GRAMD3 GRAM domain containing 3 1 1
MIRT167707 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 1 5
MIRT168061 E2F3 E2F transcription factor 3 1 1
MIRT168347 WRNIP1 Werner helicase interacting protein 1 1 1
MIRT169293 CD2AP CD2-associated protein 1 1
MIRT171361 PHTF2 putative homeodomain transcription factor 2 1 1
MIRT171661 ANKIB1 ankyrin repeat and IBR domain containing 1 1 1
MIRT171785 CASD1 CAS1 domain containing 1 1 1
MIRT172288 FAM91A1 family with sequence similarity 91, member A1 1 1
MIRT172859 TACC1 transforming, acidic coiled-coil containing protein 1 1 1
MIRT173873 DAB2IP DAB2 interacting protein 1 1
MIRT176126 ATP7A ATPase, Cu++ transporting, alpha polypeptide 1 1
MIRT178957 USP28 ubiquitin specific peptidase 28 1 1
MIRT185719 ARNTL2 aryl hydrocarbon receptor nuclear translocator-like 2 1 1
MIRT186265 TCEB3 transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A) 1 1
MIRT186538 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 1 2
MIRT186631 COX20 COX20 Cox2 chaperone homolog (S. cerevisiae) 1 4
MIRT189374 TXLNA taxilin alpha 1 2
MIRT190975 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT197014 EIF1 eukaryotic translation initiation factor 1 1 5
MIRT206438 YIPF4 Yip1 domain family, member 4 1 1
MIRT211230 FGF2 fibroblast growth factor 2 (basic) 1 5
MIRT214530 C5ORF24 chromosome 5 open reading frame 24 1 1
MIRT215685 PTGER4 prostaglandin E receptor 4 (subtype EP4) 1 1
MIRT216035 IL6ST interleukin 6 signal transducer (gp130, oncostatin M receptor) 1 5
MIRT218085 TULP4 tubby like protein 4 1 2
MIRT242420 CCDC113 coiled-coil domain containing 113 1 2
MIRT243163 SOX11 SRY (sex determining region Y)-box 11 1 1
MIRT245512 KIF1BP KIAA1279 1 1
MIRT246120 QSER1 glutamine and serine rich 1 1 1
MIRT247154 OTUD3 OTU domain containing 3 1 1
MIRT250944 CDK5R1 cyclin-dependent kinase 5, regulatory subunit 1 (p35) 1 2
MIRT253351 ZNF417 zinc finger protein 417 1 1
MIRT271969 ARF1 ADP-ribosylation factor 1 1 1
MIRT273218 ZNF695 zinc finger protein 695 1 2
MIRT282778 SNN stannin 1 1
MIRT296116 SLC12A5 solute carrier family 12 (potassium/chloride transporter), member 5 1 1
MIRT301712 TEF thyrotrophic embryonic factor 1 1
MIRT322175 CLN8 ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation) 1 2
MIRT341540 CNIH1 cornichon homolog (Drosophila) 1 4
MIRT356063 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT438225 DKK3 dickkopf 3 homolog (Xenopus laevis) 2 1
MIRT438261 PTEN phosphatase and tensin homolog 2 2
MIRT438481 RECK reversion-inducing-cysteine-rich protein with kazal motifs 1 1
MIRT438641 SMAD3 SMAD family member 3 3 1
MIRT439088 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 0 1
MIRT443577 PPIC peptidylprolyl isomerase C (cyclophilin C) 1 1
MIRT448829 FKBP1A FK506 binding protein 1A, 12kDa 1 2
MIRT451492 FOPNL FGFR1OP N-terminal like 1 1
MIRT452693 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 1
MIRT453165 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT454586 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 2
MIRT455792 TAF8 TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa 1 2
MIRT456008 CYP2C19 cytochrome P450, family 2, subfamily C, polypeptide 19 1 1
MIRT456042 KIAA1586 KIAA1586 1 1
MIRT456761 TMEM239 transmembrane protein 239 1 2
MIRT458066 NLRP9 NLR family, pyrin domain containing 9 1 1
MIRT459228 MRPS21 mitochondrial ribosomal protein S21 1 1
MIRT459532 MFF mitochondrial fission factor 1 3
MIRT459757 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa 1 1
MIRT460234 TNFRSF13C tumor necrosis factor receptor superfamily, member 13C 1 1
MIRT461102 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT462922 ZNRF3 zinc and ring finger 3 1 1
MIRT463474 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT463514 ZBTB8B zinc finger and BTB domain containing 8B 1 2
MIRT465501 TOR1B torsin family 1, member B (torsin B) 1 1
MIRT469523 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 4
MIRT470077 PTGES2 prostaglandin E synthase 2 1 1
MIRT471579 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT473452 MCOLN2 mucolipin 2 1 4
MIRT475879 H3F3C H3 histone, family 3C 1 5
MIRT475916 H3F3B H3 histone, family 3B (H3.3B) 1 4
MIRT476197 GOLGA8A golgin A8 family, member A 1 5
MIRT476316 GM2A GM2 ganglioside activator 1 1
MIRT476677 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 5
MIRT478373 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT479543 CDC5L CDC5 cell division cycle 5-like (S. pombe) 1 1
MIRT481022 BAZ2B bromodomain adjacent to zinc finger domain, 2B 1 1
MIRT491007 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT493167 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT494346 CASKIN1 CASK interacting protein 1 1 1
MIRT499085 ZDHHC21 zinc finger, DHHC-type containing 21 1 3
MIRT500027 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 4
MIRT501294 RRN3 RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae) 1 3
MIRT503126 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 4
MIRT503299 GTF2A1 general transcription factor IIA, 1, 19/37kDa 1 3
MIRT504326 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504469 EID2B EP300 interacting inhibitor of differentiation 2B 1 2
MIRT504653 RPL9 ribosomal protein L9 1 3
MIRT505329 TMF1 TATA element modulatory factor 1 1 5
MIRT505729 SERTAD3 SERTA domain containing 3 1 3
MIRT505823 RSBN1 round spermatid basic protein 1 1 4
MIRT506003 PURG purine-rich element binding protein G 1 4
MIRT506807 KLHL15 kelch-like 15 (Drosophila) 1 4
MIRT507121 GOLGA8B golgin A8 family, member B 1 4
MIRT507351 FAM129A family with sequence similarity 129, member A 1 4
MIRT507676 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 2
MIRT507701 CNOT2 CCR4-NOT transcription complex, subunit 2 1 4
MIRT508010 BCAT1 branched chain amino-acid transaminase 1, cytosolic 1 2
MIRT510437 ZIC5 Zic family member 5 1 3
MIRT510541 XKR7 XK, Kell blood group complex subunit-related family, member 7 1 2
MIRT510598 TPPP tubulin polymerization promoting protein 1 3
MIRT511059 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 1 3
MIRT511854 GOLGA8J golgin A8 family, member J 1 3
MIRT511863 GOLGA8I golgin A8 family, member I 1 3
MIRT512568 CTDSPL CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like 1 1
MIRT512706 ZNF134 zinc finger protein 134 1 3
MIRT513175 MOAP1 modulator of apoptosis 1 1 3
MIRT513788 PAWR PRKC, apoptosis, WT1, regulator 1 3
MIRT515098 IRGQ immunity-related GTPase family, Q 1 1
MIRT515479 INCENP inner centromere protein antigens 135/155kDa 1 2
MIRT517414 BMP8A bone morphogenetic protein 8a 1 1
MIRT518752 C1orf35 chromosome 1 open reading frame 35 1 1
MIRT519778 ZNF354B zinc finger protein 354B 1 2
MIRT519863 ZFP62 zinc finger protein 62 homolog (mouse) 1 3
MIRT520511 TRAM2 translocation associated membrane protein 2 1 4
MIRT521069 SLC25A32 solute carrier family 25 (mitochondrial folate carrier) , member 32 1 3
MIRT526910 ZNF772 zinc finger protein 772 1 3
MIRT527132 GULP1 GULP, engulfment adaptor PTB domain containing 1 1 1
MIRT527865 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT528402 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT532954 ZNF24 zinc finger protein 24 1 2
MIRT533020 ZFC3H1 zinc finger, C3H1-type containing 1 3
MIRT533193 WASL Wiskott-Aldrich syndrome-like 1 3
MIRT534194 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 2
MIRT534963 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 2
MIRT536398 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT537050 GRAMD4 GRAM domain containing 4 1 1
MIRT537126 GOLGA3 golgin A3 1 3
MIRT537182 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 2
MIRT537653 ERGIC2 ERGIC and golgi 2 1 2
MIRT538634 CCSER2 family with sequence similarity 190, member B 1 2
MIRT539228 ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 1 4
MIRT540097 NPY4R pancreatic polypeptide receptor 1 1 1
MIRT540995 ZNF460 zinc finger protein 460 1 2
MIRT541470 AURKA aurora kinase A 1 2
MIRT542677 SESN3 sestrin 3 1 1
MIRT542755 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT542861 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT542929 HOXC8 homeobox C8 1 1
MIRT543745 SZRD1 SUZ RNA binding domain containing 1 1 1
MIRT544402 ZSCAN12 zinc finger and SCAN domain containing 12 1 1
MIRT544581 AP5Z1 adaptor-related protein complex 5, zeta 1 subunit 1 2
MIRT544660 MED19 mediator complex subunit 19 1 1
MIRT545249 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT545259 TRIM36 tripartite motif containing 36 1 2
MIRT545742 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT546001 WDR81 WD repeat domain 81 1 1
MIRT546042 VPS4B vacuolar protein sorting 4 homolog B (S. cerevisiae) 1 1
MIRT547168 PDZD8 PDZ domain containing 8 1 1
MIRT547275 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 2
MIRT547730 KIF5B kinesin family member 5B 1 2
MIRT548202 FNIP1 folliculin interacting protein 1 1 1
MIRT548754 CNNM4 cyclin M4 1 1
MIRT549639 ZNF75A zinc finger protein 75a 1 1
MIRT549682 ZNF598 zinc finger protein 598 1 1
MIRT550195 MRO maestro 1 1
MIRT550338 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT550534 MYZAP myocardial zonula adherens protein 1 1
MIRT550973 TOR4A torsin family 4, member A 1 1
MIRT551219 CIDEC cell death-inducing DFFA-like effector c 1 1
MIRT551353 AGBL5 ATP/GTP binding protein-like 5 1 1
MIRT551569 LETM1 leucine zipper-EF-hand containing transmembrane protein 1 1 1
MIRT552275 RAB3D RAB3D, member RAS oncogene family 1 1
MIRT552659 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT553079 UCK2 uridine-cytidine kinase 2 1 1
MIRT553755 TBC1D8 TBC1 domain family, member 8 (with GRAM domain) 1 1
MIRT554028 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT554097 SMU1 smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) 1 1
MIRT554158 SLX4 SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae) 1 1
MIRT554813 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT555524 PMEPA1 prostate transmembrane protein, androgen induced 1 1 1
MIRT555596 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase, type I, gamma 1 2
MIRT555633 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 3
MIRT555684 PGAM4 phosphoglycerate mutase family member 4 1 2
MIRT555831 PAX9 paired box 9 1 1
MIRT555872 PAIP1 poly(A) binding protein interacting protein 1 1 1
MIRT555943 NUP43 nucleoporin 43kDa 1 2
MIRT555998 NFYB nuclear transcription factor Y, beta 1 1
MIRT556341 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT556431 LONRF3 LON peptidase N-terminal domain and ring finger 3 1 1
MIRT556583 LHFPL2 lipoma HMGIC fusion partner-like 2 1 3
MIRT556799 KIAA1958 KIAA1958 1 1
MIRT558049 EXOC5 exocyst complex component 5 1 2
MIRT558695 CLTA clathrin, light chain A 1 1
MIRT559189 BMPR1A bone morphogenetic protein receptor, type IA 1 2
MIRT559643 AKAP10 A kinase (PRKA) anchor protein 10 1 1
MIRT559705 AEN apoptosis enhancing nuclease 1 1
MIRT560671 SRFBP1 serum response factor binding protein 1 1 1
MIRT560988 GPBP1L1 GC-rich promoter binding protein 1-like 1 1 1
MIRT562168 HOXA13 homeobox A13 1 1
MIRT562276 GNAQ guanine nucleotide binding protein (G protein), q polypeptide 1 1
MIRT563622 ZNF277 zinc finger protein 277 1 1
MIRT563813 FMN1 formin 1 1 1
MIRT564094 TLR3 toll-like receptor 3 1 1
MIRT565318 TMEM41A transmembrane protein 41A 1 1
MIRT565983 RNF44 ring finger protein 44 1 1
MIRT566049 REV3L REV3-like, polymerase (DNA directed), zeta, catalytic subunit 1 2
MIRT568234 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT568311 BAK1 BCL2-antagonist/killer 1 1 1
MIRT572374 ATOX1 ATX1 antioxidant protein 1 homolog (yeast) 1 1
MIRT574819 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 2
MIRT609210 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT616216 RBM27 RNA binding motif protein 27 1 1
MIRT629086 FASLG Fas ligand (TNF superfamily, member 6) 1 1
MIRT632122 FKBP9 FK506 binding protein 9, 63 kDa 1 1
MIRT632574 POLQ polymerase (DNA directed), theta 1 1
MIRT634802 ENTHD1 ENTH domain containing 1 1 1
MIRT636551 ESRP1 epithelial splicing regulatory protein 1 1 1
MIRT640975 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT653873 SH2B3 SH2B adaptor protein 3 1 1
MIRT655596 OTUD7B OTU domain containing 7B 1 1
MIRT659762 CCDC171 coiled-coil domain containing 171 1 1
MIRT660742 ALG14 asparagine-linked glycosylation 14 homolog (S. cerevisiae) 1 1
MIRT681035 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 1 1
MIRT682303 RBM28 RNA binding motif protein 28 1 1
MIRT682571 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 1 1
MIRT686215 ZNF267 zinc finger protein 267 1 1
MIRT687207 PLXNA3 plexin A3 1 1
MIRT690628 LAX1 lymphocyte transmembrane adaptor 1 1 1
MIRT692417 AGMAT agmatine ureohydrolase (agmatinase) 1 1
MIRT694435 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 1
MIRT700723 PNO1 partner of NOB1 homolog (S. cerevisiae) 1 1
MIRT701547 NARF nuclear prelamin A recognition factor 1 1
MIRT704377 DAND5 DAN domain family, member 5 1 1
MIRT707938 PPP1R3D protein phosphatase 1, regulatory subunit 3D 1 2
MIRT709937 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT711369 MED7 mediator complex subunit 7 1 1
MIRT712326 PER2 period homolog 2 (Drosophila) 1 2
MIRT714513 SHE Src homology 2 domain containing E 1 1
MIRT715518 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 1 1
MIRT724292 OSMR oncostatin M receptor 1 1
MIRT725355 MUC21 mucin 21, cell surface associated 1 1
MIRT726002 ZNF98 zinc finger protein 98 1 1
MIRT726018 ZNF721 zinc finger protein 721 1 1
MIRT726042 ZNF224 zinc finger protein 224 1 1
MIRT726052 ZNF17 zinc finger protein 17 1 1
MIRT726090 XRN1 5'-3' exoribonuclease 1 1 1
MIRT726117 VPS54 vacuolar protein sorting 54 homolog (S. cerevisiae) 1 1
MIRT726227 TSC1 tuberous sclerosis 1 1 1
MIRT726252 TOB2 transducer of ERBB2, 2 1 1
MIRT726296 TMEM194A transmembrane protein 194A 1 1
MIRT726299 TMEM184B transmembrane protein 184B 1 1
MIRT726405 SYNJ1 synaptojanin 1 1 1
MIRT726406 SUV420H1 suppressor of variegation 4-20 homolog 1 (Drosophila) 1 1
MIRT726452 SRPR signal recognition particle receptor (docking protein) 1 1
MIRT726464 SPOCK2 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 1 1
MIRT726492 SMAD7 SMAD family member 7 1 1
MIRT726502 SLC9A1 solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1 1 1
MIRT726512 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT726527 SLC39A6 solute carrier family 39 (zinc transporter), member 6 1 1
MIRT726540 SLC37A3 solute carrier family 37 (glycerol-3-phosphate transporter), member 3 1 1
MIRT726549 SLC25A16 solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 1 1
MIRT726562 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT726576 SIK1 salt-inducible kinase 1 1 1
MIRT726584 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT726597 SGPP1 sphingosine-1-phosphate phosphatase 1 1 1
MIRT726603 PEAK1 NKF3 kinase family member 1 1
MIRT726614 SCAF11 SR-related CTD-associated factor 11 1 1
MIRT726624 SERTAD2 SERTA domain containing 2 1 1
MIRT726704 RP2 retinitis pigmentosa 2 (X-linked recessive) 1 1
MIRT726739 RNF103 ring finger protein 103 1 1
MIRT726759 REXO1 REX1, RNA exonuclease 1 homolog (S. cerevisiae) 1 1
MIRT726796 RAD21 RAD21 homolog (S. pombe) 1 1
MIRT726800 RABL5 RAB, member RAS oncogene family-like 5 1 1
MIRT726806 RAB7B RAB7B, member RAS oncogene family 1 1
MIRT726846 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 1 1
MIRT726848 PSMD5 proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 1 1
MIRT726890 PPP1R12C protein phosphatase 1, regulatory subunit 12C 1 1
MIRT726897 PPCS phosphopantothenoylcysteine synthetase 1 1
MIRT726931 PITPNA phosphatidylinositol transfer protein, alpha 1 1
MIRT726941 PIK3AP1 phosphoinositide-3-kinase adaptor protein 1 1 1
MIRT727005 PBLD phenazine biosynthesis-like protein domain containing 1 1
MIRT727070 NPTN neuroplastin 1 1
MIRT727073 GLYR1 glyoxylate reductase 1 homolog (Arabidopsis) 1 1
MIRT727119 MYO5A myosin VA (heavy chain 12, myoxin) 1 1
MIRT727121 MYO1D myosin ID 1 1
MIRT727139 MTMR1 myotubularin related protein 1 1 1
MIRT727144 MTF1 metal-regulatory transcription factor 1 1 1
MIRT727148 MRS2 MRS2 magnesium homeostasis factor homolog (S. cerevisiae) 1 1
MIRT727155 MRPL19 mitochondrial ribosomal protein L19 1 1
MIRT727163 MPP1 membrane protein, palmitoylated 1, 55kDa 1 1
MIRT727199 MIA3 melanoma inhibitory activity family, member 3 1 1
MIRT727214 MEF2D myocyte enhancer factor 2D 1 1
MIRT727231 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT727240 MBD2 methyl-CpG binding domain protein 2 1 1
MIRT727243 MAST3 microtubule associated serine/threonine kinase 3 1 1
MIRT727259 MAN2A1 mannosidase, alpha, class 2A, member 1 1 1
MIRT727323 LAMP2 lysosomal-associated membrane protein 2 1 1
MIRT727339 KLHL14 kelch-like 14 (Drosophila) 1 1
MIRT727388 JOSD1 Josephin domain containing 1 1 1
MIRT727462 IKZF2 IKAROS family zinc finger 2 (Helios) 1 1
MIRT727474 ICAM1 intercellular adhesion molecule 1 1 1
MIRT727479 IBTK inhibitor of Bruton agammaglobulinemia tyrosine kinase 1 1
MIRT727511 HECTD1 HECT domain containing E3 ubiquitin protein ligase 1 1 1
MIRT727527 GRAMD1B GRAM domain containing 1B 1 1
MIRT727564 GXYLT1 glucoside xylosyltransferase 1 1 1
MIRT727581 GIT2 G protein-coupled receptor kinase interacting ArfGAP 2 1 1
MIRT727621 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT727630 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT727656 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT727709 FAM46A family with sequence similarity 46, member A 1 1
MIRT727715 FAM126B family with sequence similarity 126, member B 1 1
MIRT727739 EVI5 ecotropic viral integration site 5 1 1
MIRT727762 EPM2AIP1 EPM2A (laforin) interacting protein 1 1 1
MIRT727816 EARS2 glutamyl-tRNA synthetase 2, mitochondrial 1 1
MIRT727826 DYNLT3 dynein, light chain, Tctex-type 3 1 1
MIRT727844 DUSP10 dual specificity phosphatase 10 1 1
MIRT727846 DUS2L dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae) 1 1
MIRT727850 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT727861 DOCK9 dedicator of cytokinesis 9 1 1
MIRT727871 DNAJC27 DnaJ (Hsp40) homolog, subfamily C, member 27 1 1
MIRT727875 DNAJB12 DnaJ (Hsp40) homolog, subfamily B, member 12 1 1
MIRT727884 DENND4B DENN/MADD domain containing 4B 1 1
MIRT727904 DBT dihydrolipoamide branched chain transacylase E2 1 1
MIRT727939 CREB3L2 cAMP responsive element binding protein 3-like 2 1 1
MIRT728008 CDC6 cell division cycle 6 homolog (S. cerevisiae) 1 1
MIRT728015 CDC27 cell division cycle 27 homolog (S. cerevisiae) 1 1
MIRT728021 CD69 CD69 molecule 1 1
MIRT728085 C6orf62 chromosome 6 open reading frame 62 1 1
MIRT728112 C21orf91 chromosome 21 open reading frame 91 1 1
MIRT728114 C20orf112 chromosome 20 open reading frame 112 1 1
MIRT728169 C10orf118 chromosome 10 open reading frame 118 1 1
MIRT728204 BICD2 bicaudal D homolog 2 (Drosophila) 1 1
MIRT728217 BCAT2 branched chain amino-acid transaminase 2, mitochondrial 1 1
MIRT728247 ATXN1 ataxin 1 1 1
MIRT728261 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT728388 ADAM10 ADAM metallopeptidase domain 10 1 1
MIRT728411 ACAA1 acetyl-CoA acyltransferase 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*