Accession ID: MIRT040627 [miRNA, hsa-miR-92b-3p :: SYNGAP1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-92bLinkOut: [miRBase ]
Synonyms MIRN92B, hsa-mir-92b, MIR92B
Description Homo sapiens miR-92b stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-92b-3p
Mature Sequence 61| UAUUGCACUCGUCCCGGCCUCC |82
Evidence Experimental
Experiments Microarray
Putative hsa-miR-92b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SYNGAP1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms DKFZp761G1421, KIAA1938, MRD5, RASA1, RASA5, SYNGAP
Description synaptic Ras GTPase activating protein 1 homolog (rat)
Transcript NM_0067    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SYNGAP1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SYNGAP1
(miRNA target sites are highlighted)
>SYNGAP1|NM_0067|3'UTR
   1 TAGCCCACCCAGCATCAGAGACCTTCTCTTCCTTTCCTGTGCACCCCACCCTGTAACAGCACCAACCACCAGGATTGGAC
  81 ATCACCGAGGAACAGCGGGATTGCCTCCCCGAATGCCTCCCTGGGAGGCACACTGATTGCCCACCCCCACCACTGCACCA
 161 TTTCCAGGAGGGAGAGTGGGGACCCTCAGCCGCCCCCTTTTCCTTCCCATTGGGGTGCTGCCCTCTCTTTGACCCCCAGG
 241 GACCCTTGCCCCAGGACACCGCCTACCCCGTACAGACCCCTTCACTCCGGGGTGCTATCCCCATCCTCTGCCTCATCGTT
 321 CCCCTGAGCACTGGGGGACAGACCCTCACCCCCACCCTGGGGGTGTGGCACCTCCAAACTTTCAACTTCAGGGTGATTTT
 401 TTTAGCAGTAACCAGAGCTGACAATCTAACTCCCCTCCACCGCCCCATTTTGGCCTCCCCTGCCCCCCTTGTTATGGGGA
 481 GGGGACCCCGGGTGAGGGGGCCCTATTACCCCTTGATTTCTCAGGAGCGTCTGGGGGGGCTCAGCACGCACAAACTCCTT
 561 CTCCTTCTACCACTCTTAAATTTACTCCCTCCCCACCCAGAACCCAGATGGGGTGGAGGGGGCCACCGGGGCAGGGAGGG
 641 GGCGGCAAGGGGGGAATGGGAGTTGTCTCCCCTTCTCCCCACACCTGATCTGCTCTCGGCTGGTCCCAGAGCGGGGTGAG
 721 GGGGCTTATGCCCCCCCCTCCCCCAGTGTGTTGGGTGGGGTGGAATTGAGGTTAGGGTGAGGGGTCAGGGTTTAGGAGGG
 801 TGTGTATGTTGGGAGGACAGGCTAGTTGATCTGTCCTACTCTGACACACAGTCCCCTCTGCCCCTTCCTTCTCTCTTCTT
 881 GGTCTCTACTCCCAGGGGGAGGGGGGAACTTACTCTAGGAAAAGCCATGTCTCTCTCCCCCAGGGTGGGGGGACCTGTGT
 961 TGGAGGAGGGGTGTTGGGGGGCCCCCTTCCATGACTCTGTCCCCTGGGGGAGGTAGGACAGGGCTGGGCTTCCCTCTCAT
1041 CCTCCCCCTCCCAATCTCCTTCCACCTCCCTCCCTCCCGCCAGCTCCACGATTTTTCGGTGTTTCTCTGTACATAGTTTT
1121 CTGGCGGGATAGGGGAGGTAGGATGGATGGGGTTTGGGGTGGGTAGGCCATGGGAGGGGAGAAGCCCCTCCTTGGCACCC
1201 CCTCTTCCCTGACTGCTGTCCCCTACCCAGCCTTGCCCCCTTCATCCTTTTGCGTTTGGTATTGAGACTCTCCTAGACTC
1281 TACTCCTCTTTCTTTTGTATGGACAGTTCCCCTTCAGTCCCATCCCCCTACACATACACCCAGCCGGGGCCAAATTTATA
1361 CTTATATAAAAGTTGTAAATATGTGAAATTTTATCCCTGTGCCCTTTCCCCACCTCAGGCCCTACCCCTGGACCCTCCCC
1441 AACCTTCCTTCTCTCTTCTTTGGCTGTTGTAATTATCTGGGGTTTGTACTGTACATATCCGGGGTGTGTGTGTGTGGGCT
1521 GGGGGCAACCCTTCTGTACAGAGCTTCCTGGCCCCCTCCCCCCCCGCCCCTCTGCTTCCCTCCCCACCCACCACCTCAAG
1601 GGTAGGGAGTTGCTCTTCCTACCTGTTTTATTTTGTTTTCTCGTTCTCCCTCCCCACCCCACTCCCAGCCTTATCTATCC
1681 CCCCTCACTGTCCCCTTTTCTCCACTCCCAGCCCCATTTCCTTTTTTTCTGGAGTGTGTGGTGAAACAGAAAAAAACATG
1761 TTTAATAAACGGAGATTGTTCTTTTAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ccucCGGCCCUGCUCACGUUAu 5'
              |::|||  |:||| ||| 
Target 5' gtgtGTTGGGTGGGGTGGAATt 3'
746 - 767 130.00 -16.50
2
miRNA  3' ccuccGGCCCUGCUCACGUUAu 5'
               |||||    |||| || 
Target 5' tcactCCGGG----GTGCTATc 3'
282 - 299 119.00 -13.30
3
miRNA  3' ccuccgGCCCUGCUCACGUUau 5'
                :||| :|:| ||||  
Target 5' tgtgtgTGGGCTGGGGGCAAcc 3'
1509 - 1530 108.00 -14.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-92b-3p :: SYNGAP1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ccTCCGGCCCTGCTCACGTTAt 5'
            |||::|   | |||||| | 
Target 5' ggAGGTTG---CCAGTGCACTa 3'
6 - 24
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
220 hsa-miR-92b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001173 CORO1A coronin, actin binding protein, 1A 1 1
MIRT004048 SLC15A1 solute carrier family 15 (oligopeptide transporter), member 1 4 1
MIRT004293 CDKN1C cyclin-dependent kinase inhibitor 1C (p57, Kip2) 3 1
MIRT004351 PRMT5 protein arginine methyltransferase 5 2 1
MIRT035518 NLK nemo-like kinase 1 1
MIRT040525 EFNB1 ephrin-B1 1 1
MIRT040526 GSTM3 glutathione S-transferase mu 3 (brain) 1 1
MIRT040527 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT040528 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT040529 AMIGO1 adhesion molecule with Ig-like domain 1 1 1
MIRT040530 FBXO31 F-box protein 31 1 1
MIRT040531 OR6V1 olfactory receptor, family 6, subfamily V, member 1 1 1
MIRT040532 RBBP5 retinoblastoma binding protein 5 1 1
MIRT040533 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT040534 NCL nucleolin 1 1
MIRT040535 NIPA2 non imprinted in Prader-Willi/Angelman syndrome 2 1 1
MIRT040536 MRPL39 mitochondrial ribosomal protein L39 1 1
MIRT040537 ANKRD52 ankyrin repeat domain 52 1 1
MIRT040538 PLXND1 plexin D1 1 1
MIRT040539 CTC1 chromosome 17 open reading frame 68 1 1
MIRT040540 ZNF282 zinc finger protein 282 1 1
MIRT040541 HPS6 Hermansky-Pudlak syndrome 6 1 1
MIRT040542 WARS tryptophanyl-tRNA synthetase 1 1
MIRT040543 PRRC2B HLA-B associated transcript 2-like 1 1 1
MIRT040544 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 1
MIRT040545 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT040546 GPR55 G protein-coupled receptor 55 1 1
MIRT040547 FBXO21 F-box protein 21 1 1
MIRT040548 MYH10 myosin, heavy chain 10, non-muscle 1 1
MIRT040549 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT040550 UROD uroporphyrinogen decarboxylase 1 1
MIRT040551 DNAJC30 DnaJ (Hsp40) homolog, subfamily C, member 30 1 1
MIRT040552 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT040553 SMAP2 small ArfGAP2 1 1
MIRT040554 IK IK cytokine, down-regulator of HLA II 1 1
MIRT040555 TRAFD1 TRAF-type zinc finger domain containing 1 1 1
MIRT040556 MSH3 mutS homolog 3 (E. coli) 1 1
MIRT040557 UBE2Q2 ubiquitin-conjugating enzyme E2Q family member 2 1 1
MIRT040558 MRPL53 mitochondrial ribosomal protein L53 1 1
MIRT040559 ABCA3 ATP-binding cassette, sub-family A (ABC1), member 3 1 1
MIRT040560 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme 1 1
MIRT040561 FOXN3 forkhead box N3 1 1
MIRT040562 HIST2H4B histone cluster 2, H4b 1 1
MIRT040563 ARL6IP4 ADP-ribosylation-like factor 6 interacting protein 4 1 1
MIRT040564 FLNA filamin A, alpha 1 1
MIRT040565 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT040566 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT040567 SFXN1 sideroflexin 1 1 1
MIRT040568 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT040569 ADCK4 aarF domain containing kinase 4 1 1
MIRT040570 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT040571 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT040572 RNF168 ring finger protein 168 1 1
MIRT040573 PIN4 protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) 1 1
MIRT040574 KDM3A lysine (K)-specific demethylase 3A 1 1
MIRT040575 DEXI Dexi homolog (mouse) 1 1
MIRT040576 RPS3A ribosomal protein S3A 1 1
MIRT040577 APOLD1 apolipoprotein L domain containing 1 1 1
MIRT040578 PFN1 profilin 1 1 1
MIRT040579 TAF12 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa 1 1
MIRT040580 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 1
MIRT040581 MEX3B mex-3 homolog B (C. elegans) 1 1
MIRT040582 HEATR2 HEAT repeat containing 2 1 1
MIRT040583 RTKN2 rhotekin 2 1 1
MIRT040584 SIN3A SIN3 homolog A, transcription regulator (yeast) 1 1
MIRT040585 PHF23 PHD finger protein 23 1 1
MIRT040586 FLNB filamin B, beta 1 1
MIRT040587 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT040588 XPO7 exportin 7 1 1
MIRT040589 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT040590 RAN RAN, member RAS oncogene family 1 1
MIRT040591 LUC7L3 LUC7-like 3 (S. cerevisiae) 1 1
MIRT040592 GSS glutathione synthetase 1 1
MIRT040593 ZBTB48 zinc finger and BTB domain containing 48 1 1
MIRT040594 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT040595 SMG1 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT040596 METRN meteorin, glial cell differentiation regulator 1 1
MIRT040597 HAGH hydroxyacylglutathione hydrolase 1 1
MIRT040598 RERE arginine-glutamic acid dipeptide (RE) repeats 1 1
MIRT040599 USF1 upstream transcription factor 1 1 1
MIRT040600 CEP152 centrosomal protein 152kDa 1 1
MIRT040601 ADAT1 adenosine deaminase, tRNA-specific 1 1 1
MIRT040602 NONO non-POU domain containing, octamer-binding 1 1
MIRT040603 RPAP1 RNA polymerase II associated protein 1 1 1
MIRT040604 NABP2 oligonucleotide/oligosaccharide-binding fold containing 2B 1 1
MIRT040605 EZH2 enhancer of zeste homolog 2 (Drosophila) 1 1
MIRT040606 GNB2 guanine nucleotide binding protein (G protein), beta polypeptide 2 1 1
MIRT040607 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT040608 DOCK11 dedicator of cytokinesis 11 1 1
MIRT040609 OGFR opioid growth factor receptor 1 1
MIRT040610 LARS leucyl-tRNA synthetase 1 1
MIRT040611 SRP68 signal recognition particle 68kDa 1 1
MIRT040612 UNC5B unc-5 homolog B (C. elegans) 1 1
MIRT040613 SOGA1 chromosome 20 open reading frame 117 1 1
MIRT040614 LYST lysosomal trafficking regulator 1 1
MIRT040615 SPC24 SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT040616 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 1 1
MIRT040617 RPL8 ribosomal protein L8 1 1
MIRT040618 ARID1B AT rich interactive domain 1B (SWI1-like) 1 1
MIRT040619 AP1B1 adaptor-related protein complex 1, beta 1 subunit 1 1
MIRT040620 CAMSAP1 calmodulin regulated spectrin-associated protein 1 1 1
MIRT040621 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 1 1
MIRT040622 TMEM115 transmembrane protein 115 1 1
MIRT040623 GATA6 GATA binding protein 6 1 1
MIRT040624 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT040625 PSMD3 proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 1 1
MIRT040626 RPS28 ribosomal protein S28 1 1
MIRT040627 SYNGAP1 synaptic Ras GTPase activating protein 1 homolog (rat) 1 1
MIRT040628 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT040629 RPLP0 ribosomal protein, large, P0 1 1
MIRT040630 EDF1 endothelial differentiation-related factor 1 1 1
MIRT040631 RPS4X ribosomal protein S4, X-linked 1 1
MIRT040632 MBNL1 muscleblind-like (Drosophila) 1 1
MIRT040633 GPX1 glutathione peroxidase 1 1 1
MIRT040634 ACTN4 actinin, alpha 4 1 1
MIRT040635 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT040636 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 1 1
MIRT040637 PARVG parvin, gamma 1 1
MIRT040638 TLN1 talin 1 1 1
MIRT040639 PHF19 PHD finger protein 19 1 1
MIRT040640 SLCO4A1 solute carrier organic anion transporter family, member 4A1 1 1
MIRT040641 COPA coatomer protein complex, subunit alpha 1 1
MIRT040642 FJX1 four jointed box 1 (Drosophila) 1 1
MIRT040643 PIGO phosphatidylinositol glycan anchor biosynthesis, class O 1 1
MIRT040644 ATP13A1 ATPase type 13A1 1 1
MIRT040645 BAG6 HLA-B associated transcript 3 1 1
MIRT040646 RBM10 RNA binding motif protein 10 1 1
MIRT040647 HIST1H2BF histone cluster 1, H2bf 1 1
MIRT040648 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT040649 KEAP1 kelch-like ECH-associated protein 1 1 1
MIRT040650 SFPQ splicing factor proline/glutamine-rich 1 1
MIRT040651 REXO2 REX2, RNA exonuclease 2 homolog (S. cerevisiae) 1 1
MIRT040652 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 1
MIRT040653 IGSF8 immunoglobulin superfamily, member 8 1 1
MIRT040654 AKAP8 A kinase (PRKA) anchor protein 8 1 1
MIRT040655 RBM14 RNA binding motif protein 14 1 1
MIRT040656 PYCR2 pyrroline-5-carboxylate reductase family, member 2 1 1
MIRT040657 FASN fatty acid synthase 1 1
MIRT040658 STRBP spermatid perinuclear RNA binding protein 1 1
MIRT040659 HIST1H2AM histone cluster 1, H2am 1 1
MIRT040660 FBN2 fibrillin 2 1 1
MIRT040661 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 1
MIRT040662 ORC1 origin recognition complex, subunit 1-like (yeast) 1 1
MIRT040663 CISD1 CDGSH iron sulfur domain 1 1 1
MIRT040664 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT040665 C9orf64 chromosome 9 open reading frame 64 1 1
MIRT040666 ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 1 1
MIRT040667 RRP1 ribosomal RNA processing 1 homolog (S. cerevisiae) 1 1
MIRT040668 TNPO2 transportin 2 1 1
MIRT040669 SLC25A5 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 1 1
MIRT040670 IARS isoleucyl-tRNA synthetase 1 1
MIRT040671 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT040672 G6PD glucose-6-phosphate dehydrogenase 1 1
MIRT040673 COX1 cytochrome c oxidase subunit I 1 1
MIRT040674 FAM58A family with sequence similarity 58, member A 1 1
MIRT040675 MPHOSPH10 M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein) 1 1
MIRT040676 PLA2G12A phospholipase A2, group XIIA 1 1
MIRT040677 DENND4A DENN/MADD domain containing 4A 1 1
MIRT040678 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT040679 XRCC1 X-ray repair complementing defective repair in Chinese hamster cells 1 1 1
MIRT040680 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 1 1
MIRT040681 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT040682 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 1 1
MIRT040683 CAPRIN1 cell cycle associated protein 1 1 1
MIRT040684 RPL3 ribosomal protein L3 1 1
MIRT040685 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT040686 PHRF1 PHD and ring finger domains 1 1 1
MIRT040687 SNRNP70 small nuclear ribonucleoprotein 70kDa (U1) 1 1
MIRT040688 WDR82 WD repeat domain 82 1 1
MIRT040689 PSMB3 proteasome (prosome, macropain) subunit, beta type, 3 1 1
MIRT040690 GRB2 growth factor receptor-bound protein 2 1 1
MIRT040691 BRD8 bromodomain containing 8 1 1
MIRT040692 TSPYL1 TSPY-like 1 1 1
MIRT040693 CCDC22 coiled-coil domain containing 22 1 1
MIRT040694 XPO5 exportin 5 1 1
MIRT040695 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT040696 THAP10 THAP domain containing 10 1 1
MIRT040697 GRHPR glyoxylate reductase/hydroxypyruvate reductase 1 1
MIRT040698 PWP1 PWP1 homolog (S. cerevisiae) 1 1
MIRT040699 SLC25A4 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 1 1
MIRT040700 BBX bobby sox homolog (Drosophila) 1 1
MIRT040701 DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) 1 1
MIRT040702 ABR active BCR-related gene 1 1
MIRT040703 SCAF1 SR-related CTD-associated factor 1 1 1
MIRT040704 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT040705 FAM3C family with sequence similarity 3, member C 1 1
MIRT040706 PSMA7 proteasome (prosome, macropain) subunit, alpha type, 7 1 1
MIRT040707 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT040708 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT040709 MRPS23 mitochondrial ribosomal protein S23 1 1
MIRT040710 SOLH small optic lobes homolog (Drosophila) 1 1
MIRT040711 ERICH1 glutamate-rich 1 1 1
MIRT040712 PABPN1 poly(A) binding protein, nuclear 1 1 1
MIRT040713 EIF2AK1 eukaryotic translation initiation factor 2-alpha kinase 1 1 1
MIRT040714 PFKFB4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 1 1
MIRT040715 LDLR low density lipoprotein receptor 1 1
MIRT040716 RBM8A RNA binding motif protein 8A 1 1
MIRT040717 PARK7 Parkinson disease (autosomal recessive, early onset) 7 1 1
MIRT040718 POM121 POM121 membrane glycoprotein (rat) 1 1
MIRT040719 RPS14 ribosomal protein S14 1 1
MIRT040720 TUBB6 tubulin, beta 6 1 1
MIRT040721 ZSCAN18 zinc finger and SCAN domain containing 18 1 1
MIRT040722 GLOD4 glyoxalase domain containing 4 1 1
MIRT040723 AP2A2 adaptor-related protein complex 2, alpha 2 subunit 1 1
MIRT040724 SSRP1 structure specific recognition protein 1 1 1
MIRT040725 SYMPK symplekin 1 1
MIRT040726 PRR5 proline rich 5 (renal) 1 1
MIRT040727 ORAOV1 oral cancer overexpressed 1 1 1
MIRT040728 TCP11L1 t-complex 11 (mouse)-like 1 1 1
MIRT040729 PRRC2A HLA-B associated transcript 2 1 1
MIRT040730 MDK midkine (neurite growth-promoting factor 2) 1 1
MIRT040731 LTBP3 latent transforming growth factor beta binding protein 3 1 1
MIRT040732 KDM2A lysine (K)-specific demethylase 2A 1 1
MIRT040733 SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 1 1
MIRT040734 EIF3A eukaryotic translation initiation factor 3, subunit A 1 1
MIRT040735 CRIM1 cysteine rich transmembrane BMP regulator 1 (chordin-like) 1 1
MIRT040736 SURF6 surfeit 6 1 1
MIRT040737 MAFK v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) 1 1
MIRT040738 RNF181 ring finger protein 181 1 1
MIRT040739 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1