Accession ID: MIRT040886 [miRNA, hsa-miR-18a-3p :: GNA13, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-18aLinkOut: [miRBase ]
Synonyms MIR18, MIRN18, MIRN18A, hsa-mir-18, hsa-mir-18a, miR-18, miRNA18A, MIR18A
Description Homo sapiens miR-18a stem-loop
Comment This sequence maps to chromosome 13 and is named miR-18 precursor-13 in reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-18a-3p
Mature Sequence 47| ACUGCCCUAAGUGCUCCUUCUGG |69
Evidence Experimental
Experiments Cloned
Putative hsa-miR-18a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol GNA13 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms G13
Description guanine nucleotide binding protein (G protein), alpha 13
Transcript NM_006572    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on GNA13 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of GNA13
(miRNA target sites are highlighted)
>GNA13|NM_006572|3'UTR
   1 TGTACAAAAGACTTGCTGTTTTAATATCTTTTTGTGTTTTTGATGTTTTCTGTTTGTTTTGTTTTTTAAAATAGCAGTTT
  81 ACAACCAGAATTAGAACAATCTTAATTCTACGTTTAACTTCTTGAAAATCTTAGTACTTTTTCTGCGGCCTTTGGTTTGT
 161 GGCTGAAAGCTGTTGAGTGACTCATCGCCAAGATTTGCTGTAATGCAGGCTTTGATCTGTTTCACCATGGCTTCTATTCA
 241 AGTCCAGTTAAAACCTCCCAGCTGACCTCAGACTAGGCATATTTCAGGCTTTAAATTATTCTACTTTCCAAACTGAATTC
 321 TCCTGCAGTGCCAAGTATCAAAGGTGTCCTTAAATACTTGTAGGGATGAGGTTAGGAATATTCAGTTCCAAAACAAGATA
 401 TCTTCTGTCCGCCTTACATATAGCAGTGACACTTGTTGCCTAACTTTATGGTGACCTCCTATTTTGTAAGGGCTGTTAGA
 481 AGTTCTATCTAAGAAATGGCATTCTGTAGGTTTATAGAAGGTTTAGCCTTCATATTTTAATTGCTTGTATACACAACAGC
 561 TGTTTTGCTTTTAGATTTCTGTGTTTCTGAAGGTAATGTTCTTCCTGTTTTCAAGTTTACATAAGGATCTTTGGTCTGAT
 641 GCTGATGAAGAGTTCACAGGTGGTATGGGAGAGCAAAAGGCAAGCTAATGCTGTTTACCGTGTTTTGGTCAAACGTAACG
 721 AGTGAAATAGAATTTGCCTTTCTCATATTTAATTATCATGTAGTTTAATGTACCATATGTGAAACATTCTGGCCATAGCA
 801 GCAACTAAAAACTGCAAGCAACTTGGTAACAGAACTTTCTAAATAAACTTAACCTGTTCCAGAATGTCATGTATTTGACT
 881 TTTAAGCCCTATCTCAGTTGGTCAGTAAAGACCAATCCTTACTGTAGGAAATCATTGTTGTATCATCACAAACATCTATC
 961 TTTTGCTGTCCTGTCCAGTCCCATCAACTCCACACTGTGCCATTTGTGGCATCGTTTTGTTTATTTGGAGTTTGCTAAGG
1041 GCAGTATTTTTCTGTCAAGACTATTCAAGAAGGCATTATTTGAGATTCCTGTTCATTCTTGGTGTGTCTCTAACAGATAC
1121 AGTATGTATACATTTGTATAATTGTTGTTGTTGAAAGTCCAGCTTTTTTGAGGTATATTTTAAATGTTTTAAGGATGCTT
1201 CTAAGGATCAGTAGTAATTTTTTTAGTTCGCACCTAAAGATGATTACATTGACCTCCCCCGACTGCTTACCAAATTAAAA
1281 TGTGTCCACGAAGTAGCTTTGTGATCGCAGATACATTCATAGTGAACTCATCAGAATGGCTGGTTTGCAGTACTGAAATA
1361 CTATCTTCTAGGCTGTATGTAGTGCTACAATTAGAGAAACAGAAGTCCAAGGCTGGCGACAGCTTGAAAAGTCTGACAGC
1441 TTTTCTACTTTTCCTGAAAATTTTAAGACTGTGATATCTGTCATTTTACTGTATAGCTGACTGTGTACTCAGGTATTTTA
1521 TTGGTCCTTGAAAGATTGGTCGTTATGGATCACCCAGCCTTTCCAAGTCAGTGGCTGTTGTTCTGTCTTGCTGTCTGATA
1601 CGAGAGTGGGGCTTTTCAGTGAACTAACCAGGGATTGTTCTTGACATACCTGACTTTTCTCACATTTGAACTTCCACTAT
1681 CATTGTATCCATATAACTTCTAGCATTTTCATGCCATGGTAATCCATGAGCTACACATACGTAGCCCGGCACCGTGATGC
1761 AAGTTCATGGTATCGTGCATGTTCGTGGTATCATGGTATCATTCATGCGTGTTTGAATAGTTCTACATCTAGTGCTTCTT
1841 GCCAAAAAGAATACATTGTTTAAATTCACAAAATTAGCATAATTGCAGTGCTAATGAATATCGGAATATGTGCACAGTAA
1921 CATTTGGACTATTCATTGGAGAGTTTACCCATACATTTAGCAAATTGAATGGCCAAAACATTTGACTCCAGTGAGGGCTC
2001 AAGTTAGATCCCTATAGAAAGAGGACACTTCATCTTACTTAAGTCATAGTTAAGATCTGTGATACGAACCATAGATATTG
2081 CCTGACAAAGCAGAAATCACCAAGTTTCCCCCTTTTGAATTACCACCAAGAAGTGTTGAAACACCAAATAGATATCATGT
2161 TATTTTGGGCATTTGCAGTTTTCTTCCCTGCTGCATGTAATGTCTCAGAATCAACATTCTTTTAAAATCTAGACTATATT
2241 TTGAGGCAATGAATTACTTATATTCAACTTAGGCTTGTTTTGACATTCAGTAGAACTTTAAGTTCAATCTAAAGGCTTCA
2321 GTCCACATTTTTTTATACGTTGTATTTTAAAAACGTTTGAAAGGAGTCTTACACCTGTATCATGAAAACTGAATCCTTTT
2401 GAAATACCACTATATGAAGAGAGAGATGAAATTTAGTGAACAGAATTGAAAAGGTGCTCATAATTTCACTATGCAAACTT
2481 ACCCCAGTCTCTAAAAAAGTAATTTAGATTTAAAGTTCTTTGATGTATTTGATTTTCTAAATCTTTATGGTTATGATTTG
2561 GAATAAAATGTGCCTAATCCTGTGTTACATTCTGTTCTTAAATCTGAATGCCTTCTCATTTAATTCTGAGGAAATATCAC
2641 ACAAGTGTCTTCATTGACCTTGAAGAAATGTATATACAGTTGCCTTATAAAACAACATAAATTTAGACCATAACTTTTAT
2721 AGAGAAAGGGTTTTGTCAAATGTTTTCTGAAAATCTGAGTAATTCAAAGCATGCCTCTGCCCCTTTAATATTTTTAATAA
2801 CCTGCATTGTTGCTGTCTGCCAAATATTAAATTGAAATCTTCATTTCAATTTTATTATCTGGAAAGGGCACTGGATTGCT
2881 CTGCAACCAAAGAAAGCAATATGGAATGAAAAAACTCATTCACTTTTGTCTTATTTTCTTTTAAGGTGTATTGGCATGTA
2961 ATTTGCATAGAGAAGGTCCTCTGGTTAGTCTCTCAAATTGAGGCTGTTTAGGGAAATCCTTATTCAGTTGGTGGCAGTGG
3041 TTGGTTTAAAGTAGAAGGAAATAAGATCGCCTTAATACCAGAAATGATTAGAAGTGCTGATTTAGATTCAACAAATACCA
3121 TATGTCCTTATCATTTTTTGTAAGAAGAAATTGGTTAAGTCCTAACTTTCAATGTGTACCCAAATACTTGTATTTATGCT
3201 TTTGATAAAATGTATTTTCAGCATTAATACACATCCGATTATGCCTTATTTATATATGAAGAATAAAGTTACCATGTTAT
3281 ACTGTTATGTCCTAAAATTCAAATCACTATTTGAGAAACCCTCAAATTGGTGCTTTCATTATATAATGATACATTTAGAC
3361 AAAACCCCAAACTAAGCCATTTGAAACAAGATTCTCTCCATTGCAGTTTGTAGCAATGTTATTTCTGTGTATGTCATGAG
3441 AAGGCTAAATATCAGTGTTAATTTCTTGTTTGAATCCGTGAAATCATGCCTGTAAAGCCCAAACATTTGTAACAAACTCC
3521 CTAATAAATTTAGAGAAAGTCACTCTGTTACCATTTCATTTATTTTAGTTTTATTTGAGAAATTAAGACCAGAAGTTTTG
3601 CTCATGTCTTTTTCACTTGGAAATCTGACTTAGTACCTAGTTAATTTGTCTCTCTCCCATCATTTTAAGGCGTTCGCTTC
3681 TGTTAATCACAGATGATCTGTCCTTGTGTTGTGCTGCTTGACTAAAAGCACTGTTTTGTTTTGTTTTGTTTTGTTTTTTA
3761 ATGATAGGATACAGGGTGGCTTTTCAGTCTAGTAAACATGAGGAGGGGAGAGATTGTGGGTGGGTGTGGGTGTGTCCGCA
3841 TGTCCCAAATACAGCACATGCCCATTTTTTTATGGTACGAGGTTAGGGCTTATTAATAAATGTATACTAGATCTTGAAGT
3921 GTAAGTCTAAGTCTGAACATTTTAAACAAGTTGGACTTTATGGCTTTTTCAAGTTCCATCAAGTAGATACTAGTCTTAGG
4001 CTGGTAGGTGATTAACAACATCATTTGGAGTACAGTGTTTGTACCACTAGCATTCTTATGTCTGTACTTGAACGTGTAGT
4081 TAGCATTTAAGTTATGTTCACTCTTGTAGCATTCAGGTCTTACCATCTGGTTTCAAATGCGAGAGCTTATATGAACATTG
4161 TTTTGAAAGCATGAATGATATGGCAATATTTTATGTCTTGATAAGGAGAGTTTTGTGACATATACAAATCTGCTGTTGAT
4241 GATGAAAGTTTACAGGTGGATCAGAGTATGCTGGAACTCAGTGTGCATAAAATTTCAGTCAGTGAATATCACTGAACGTC
4321 ATATACTACTTGGTATGTGACTTTGGTTTGTGTTAAGAAAGCTTGTATATAATATTTTTTGCCATAGTAAGTGAGAAATT
4401 GTCCTTAATCATGCCTGTTTGATGGTACTAGGAAAGAAAGGGGTAGAGATTAATTCTTGCACAGTATAAGCAACAGTGCA
4481 ACAAACTATGCCATTTACCTTTTACCTCTTACTTGAAGGCAGAATCGCAAAACGTTTGAAATGGCTTTTCTAAACTACTC
4561 TACTCTGGTGAGAGCTCATTTACCACAAGAAGCCTTATAAAAAAGTATATTTTGTAATAACCCCGTAGATACTGTACCTA
4641 ACAAAACATGACTCGTATTAGCTCTATAAAATATTTGTGGCTTAGGATTTTTTTTTTACATATATCTTTTTATAACTTTC
4721 CAGGAACTAAGCACATTATCTGATAATTGTTGTAAATTTTTTTGTCAGTGCTTTAGTTCAGGATGGGCAATAAATTATTT
4801 CTAAAGGAGGTCTAAAAGTGGAAAGAATGGTTTGATTTTATAAAATGAGTTGCTAGTTCATTACAGCTTTTTACTTTTGT
4881 ACATATTTTGCAAAACATTTGCCTCTTGCTATTAATATTTGCTTTGTAAAAATTACTGACATTTAATAAACATTTGTAAA
4961 CAATTCAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ggucuuCCUC--GUGAAUCCCGUCa 5'
                ||||  ::|| ||||||| 
Target 5' ttatttGGAGTTTGCTAAGGGCAGt 3'
1021 - 1045 159.00 -20.60
2
miRNA  3' gguCU-UCCUCGUGAAUCCCGUCa 5'
             || |||| :||  ||||::| 
Target 5' aatGATAGGA-TAC--AGGGTGGc 3'
3760 - 3780 123.00 -12.00
3
miRNA  3' ggucuuccucGUGAA-UCCCGUCa 5'
                    :|||| | ||||| 
Target 5' ttttacctctTACTTGAAGGCAGa 3'
4500 - 4523 121.00 -10.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-18a-3p :: GNA13    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ggtctTCCTCGTGAATCCCGTCa 5'
               | |||||:|  |||||| 
Target 5' -----AAGAGCATTATGGGCAGa 3'
1 - 18
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
339 hsa-miR-18a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000230 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 4 1
MIRT040745 ACSM2A acyl-CoA synthetase medium-chain family member 2A 1 1
MIRT040746 UBB ubiquitin B 1 1
MIRT040747 PRDX1 peroxiredoxin 1 1 1
MIRT040748 SRP9 signal recognition particle 9kDa 1 1
MIRT040749 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT040750 ANO3 anoctamin 3 1 1
MIRT040751 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT040752 CUL3 cullin 3 1 1
MIRT040753 VTI1A vesicle transport through interaction with t-SNAREs homolog 1A (yeast) 1 1
MIRT040754 ARF5 ADP-ribosylation factor 5 1 1
MIRT040755 RHEB Ras homolog enriched in brain 1 1
MIRT040756 RPAP1 RNA polymerase II associated protein 1 1 1
MIRT040757 SLC38A2 solute carrier family 38, member 2 1 1
MIRT040758 GINS1 GINS complex subunit 1 (Psf1 homolog) 1 1
MIRT040759 RPL26 ribosomal protein L26 1 1
MIRT040760 DAG1 dystroglycan 1 (dystrophin-associated glycoprotein 1) 1 1
MIRT040761 PSMB7 proteasome (prosome, macropain) subunit, beta type, 7 1 1
MIRT040762 PRCC papillary renal cell carcinoma (translocation-associated) 1 1
MIRT040763 USP3 ubiquitin specific peptidase 3 1 1
MIRT040764 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 1 1
MIRT040765 C6orf222 chromosome 6 open reading frame 222 1 1
MIRT040766 FAM3A family with sequence similarity 3, member A 1 1
MIRT040767 NOTCH4 notch 4 1 1
MIRT040768 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT040769 CD320 CD320 molecule 1 1
MIRT040770 BCL2L12 BCL2-like 12 (proline rich) 1 1
MIRT040771 DAB2IP DAB2 interacting protein 1 1
MIRT040772 P4HB prolyl 4-hydroxylase, beta polypeptide 1 1
MIRT040773 DPF1 D4, zinc and double PHD fingers family 1 1 1
MIRT040774 MED13L mediator complex subunit 13-like 1 1
MIRT040775 RPL31 ribosomal protein L31 1 1
MIRT040776 PCDHGC5 protocadherin gamma subfamily C, 5 1 1
MIRT040777 VMA21 VMA21 vacuolar H+-ATPase homolog (S. cerevisiae) 1 1
MIRT040778 COL27A1 collagen, type XXVII, alpha 1 1 1
MIRT040779 RPS12 ribosomal protein S12 1 1
MIRT040780 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT040781 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT040782 FAM105A family with sequence similarity 105, member A 1 1
MIRT040783 ATP6V1E1 ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 1 1
MIRT040784 RPL28 ribosomal protein L28 1 1
MIRT040785 RRS1 RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) 1 1
MIRT040786 CYB561 cytochrome b-561 1 1
MIRT040787 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT040788 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT040789 NIN ninein (GSK3B interacting protein) 1 1
MIRT040790 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT040791 SEMA4G sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G 1 1
MIRT040792 SULT1A3 sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 1 1
MIRT040793 TTPAL tocopherol (alpha) transfer protein-like 1 1
MIRT040794 GREB1L growth regulation by estrogen in breast cancer-like 1 1
MIRT040795 RNF170 ring finger protein 170 1 1
MIRT040796 SET SET nuclear oncogene 1 1
MIRT040797 SPECC1L sperm antigen with calponin homology and coiled-coil domains 1-like 1 1
MIRT040798 CANT1 calcium activated nucleotidase 1 1 1
MIRT040799 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT040800 PRRC2A proline-rich coiled-coil 2A 1 1
MIRT040801 NUP98 nucleoporin 98kDa 1 1
MIRT040802 FADS2 fatty acid desaturase 2 1 1
MIRT040803 PIK3R3 phosphoinositide-3-kinase, regulatory subunit 3 (gamma) 1 1
MIRT040804 TRAPPC10 trafficking protein particle complex 10 1 1
MIRT040805 ARHGEF7 Rho guanine nucleotide exchange factor (GEF) 7 1 1
MIRT040806 PDPR pyruvate dehydrogenase phosphatase regulatory subunit 1 1
MIRT040807 TUBB tubulin, beta class I 1 1
MIRT040808 ATP2C1 ATPase, Ca++ transporting, type 2C, member 1 1 1
MIRT040809 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 1
MIRT040810 NUP210 nucleoporin 210kDa 1 1
MIRT040811 TMEM109 transmembrane protein 109 1 1
MIRT040812 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT040813 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT040814 ADAD2 adenosine deaminase domain containing 2 1 1
MIRT040815 SHQ1 SHQ1 homolog (S. cerevisiae) 1 1
MIRT040816 EDARADD EDAR-associated death domain 1 1
MIRT040817 COG4 component of oligomeric golgi complex 4 1 1
MIRT040818 CACNA2D3 calcium channel, voltage-dependent, alpha 2/delta subunit 3 1 1
MIRT040819 SETD1A SET domain containing 1A 1 1
MIRT040820 ZW10 ZW10, kinetochore associated, homolog (Drosophila) 1 1
MIRT040821 TAPBP TAP binding protein (tapasin) 1 1
MIRT040822 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT040823 PDE4A phosphodiesterase 4A, cAMP-specific 1 1
MIRT040824 ST7L suppression of tumorigenicity 7 like 1 1
MIRT040825 SNX17 sorting nexin 17 1 1
MIRT040826 IP6K2 inositol hexakisphosphate kinase 2 1 1
MIRT040827 FOXK2 forkhead box K2 1 1
MIRT040828 CACHD1 cache domain containing 1 1 1
MIRT040829 KHDRBS1 KH domain containing, RNA binding, signal transduction associated 1 1 1
MIRT040830 MRPL24 mitochondrial ribosomal protein L24 1 1
MIRT040831 BRD1 bromodomain containing 1 1 1
MIRT040832 GNAS GNAS complex locus 1 1
MIRT040833 CELF1 CUGBP, Elav-like family member 1 1 1
MIRT040834 CIZ1 CDKN1A interacting zinc finger protein 1 1 1
MIRT040835 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT040836 RAB13 RAB13, member RAS oncogene family 1 1
MIRT040837 LNPEP leucyl/cystinyl aminopeptidase 1 1
MIRT040838 ZNF488 zinc finger protein 488 1 1
MIRT040839 RPS2 ribosomal protein S2 1 1
MIRT040840 NOL6 nucleolar protein family 6 (RNA-associated) 1 1
MIRT040841 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT040842 KBTBD4 kelch repeat and BTB (POZ) domain containing 4 1 1
MIRT040843 AP3D1 adaptor-related protein complex 3, delta 1 subunit 1 1
MIRT040844 GPR55 G protein-coupled receptor 55 1 1
MIRT040845 TMEM203 transmembrane protein 203 1 1
MIRT040846 FGF11 fibroblast growth factor 11 1 1
MIRT040847 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT040848 STRN4 striatin, calmodulin binding protein 4 1 1
MIRT040849 ITM2C integral membrane protein 2C 1 1
MIRT040850 NEURL4 neuralized homolog 4 (Drosophila) 1 1
MIRT040851 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT040852 PHLDB1 pleckstrin homology-like domain, family B, member 1 1 1
MIRT040853 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT040854 RBBP4 retinoblastoma binding protein 4 1 1
MIRT040855 IER2 immediate early response 2 1 1
MIRT040856 TRIP12 thyroid hormone receptor interactor 12 1 1
MIRT040857 CDCA2 cell division cycle associated 2 1 1
MIRT040858 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT040859 DDX17 DEAD (Asp-Glu-Ala-Asp) box helicase 17 1 1
MIRT040860 POLE3 polymerase (DNA directed), epsilon 3, accessory subunit 1 1
MIRT040861 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT040862 HIST1H1C histone cluster 1, H1c 1 1
MIRT040863 BSN bassoon (presynaptic cytomatrix protein) 1 1
MIRT040864 HMGB1 high mobility group box 1 1 2
MIRT040865 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT040866 ACLY ATP citrate lyase 1 1
MIRT040867 EXOC7 exocyst complex component 7 1 1
MIRT040868 BCS1L BC1 (ubiquinol-cytochrome c reductase) synthesis-like 1 1
MIRT040869 KIAA0100 KIAA0100 1 1
MIRT040870 RPS15 ribosomal protein S15 1 1
MIRT040871 DBN1 drebrin 1 1 1
MIRT040872 ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 1 1
MIRT040873 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT040874 DIS3L DIS3 mitotic control homolog (S. cerevisiae)-like 1 1
MIRT040875 PTGS1 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) 1 2
MIRT040876 IRS4 insulin receptor substrate 4 1 1
MIRT040877 COL4A1 collagen, type IV, alpha 1 1 1
MIRT040878 H2AFV H2A histone family, member V 1 1
MIRT040879 OTUD4 OTU domain containing 4 1 1
MIRT040880 RNF187 ring finger protein 187 1 1
MIRT040881 CIC capicua homolog (Drosophila) 1 1
MIRT040882 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT040883 USP32 ubiquitin specific peptidase 32 1 1
MIRT040884 SENP3 SUMO1/sentrin/SMT3 specific peptidase 3 1 1
MIRT040885 RCC1 regulator of chromosome condensation 1 1 1
MIRT040886 GNA13 guanine nucleotide binding protein (G protein), alpha 13 1 1
MIRT040887 ZNF777 zinc finger protein 777 1 1
MIRT040888 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT040889 LMAN1 lectin, mannose-binding, 1 1 1
MIRT040890 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) 1 1
MIRT040891 NDUFB3 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa 1 1
MIRT040892 ENO1 enolase 1, (alpha) 1 1
MIRT040893 SF3B2 splicing factor 3b, subunit 2, 145kDa 1 1
MIRT040894 CCDC51 coiled-coil domain containing 51 1 1
MIRT040895 CDK2AP1 cyclin-dependent kinase 2 associated protein 1 1 1
MIRT040896 DALRD3 DALR anticodon binding domain containing 3 1 1
MIRT040897 GIPC1 GIPC PDZ domain containing family, member 1 1 1
MIRT040898 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 1 1
MIRT040899 ACOT7 acyl-CoA thioesterase 7 1 1
MIRT040900 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT040901 KLHDC10 kelch domain containing 10 1 1
MIRT040902 MAP7D1 MAP7 domain containing 1 1 1
MIRT040903 FAM120A family with sequence similarity 120A 1 1
MIRT040904 TACC3 transforming, acidic coiled-coil containing protein 3 1 1
MIRT040905 GMPS guanine monphosphate synthetase 1 1
MIRT040906 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT040907 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT040908 ZC3H3 zinc finger CCCH-type containing 3 1 1
MIRT040909 PLSCR1 phospholipid scramblase 1 1 1
MIRT040910 PPTC7 PTC7 protein phosphatase homolog (S. cerevisiae) 1 1
MIRT040911 TUBGCP3 tubulin, gamma complex associated protein 3 1 1
MIRT040912 MDC1 mediator of DNA-damage checkpoint 1 1 1
MIRT040913 ZNF428 zinc finger protein 428 1 1
MIRT040914 UBXN7 UBX domain protein 7 1 1
MIRT040915 WDR7 WD repeat domain 7 1 1
MIRT040916 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT040917 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT040918 SRF serum response factor (c-fos serum response element-binding transcription factor) 1 1
MIRT040919 NCDN neurochondrin 1 1
MIRT040920 AGFG1 ArfGAP with FG repeats 1 1 1
MIRT040921 AP1B1 adaptor-related protein complex 1, beta 1 subunit 1 1
MIRT040922 SETX senataxin 1 1
MIRT040923 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT040924 FBXO31 F-box protein 31 1 1
MIRT040925 IGHMBP2 immunoglobulin mu binding protein 2 1 1
MIRT040926 METTL17 methyltransferase like 17 1 1
MIRT040927 HIPK2 homeodomain interacting protein kinase 2 1 1
MIRT040928 NBR1 neighbor of BRCA1 gene 1 1 1
MIRT040929 EIF3I eukaryotic translation initiation factor 3, subunit I 1 1
MIRT040930 HMGA1 high mobility group AT-hook 1 1 1
MIRT040931 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 2
MIRT040932 NFIC nuclear factor I/C (CCAAT-binding transcription factor) 1 1
MIRT040933 LPHN2 latrophilin 2 1 1
MIRT040934 ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 1 1
MIRT040935 XPO4 exportin 4 1 1
MIRT040936 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 1 1
MIRT040937 GFER growth factor, augmenter of liver regeneration 1 1
MIRT040938 NIPBL Nipped-B homolog (Drosophila) 1 1
MIRT040939 FNIP1 folliculin interacting protein 1 1 1
MIRT040940 MEN1 multiple endocrine neoplasia I 1 1
MIRT040941 RHPN1 rhophilin, Rho GTPase binding protein 1 1 1
MIRT040942 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT040943 PTPRN protein tyrosine phosphatase, receptor type, N 1 1
MIRT040944 PPFIA1 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 1 1
MIRT040945 PDCD6 programmed cell death 6 1 1
MIRT040946 CEP152 centrosomal protein 152kDa 1 1
MIRT040947 ST6GAL1 ST6 beta-galactosamide alpha-2,6-sialyltranferase 1 1 1
MIRT040948 NDOR1 NADPH dependent diflavin oxidoreductase 1 1 1
MIRT040949 PPIAL4G peptidylprolyl isomerase A (cyclophilin A)-like 4G 1 1
MIRT040950 GART phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase 1 1
MIRT040951 SRL sarcalumenin 1 1
MIRT040952 ATXN2L ataxin 2-like 1 1
MIRT040953 EDF1 endothelial differentiation-related factor 1 1 1
MIRT040954 MYO1C myosin IC 1 1
MIRT040955 RPL24 ribosomal protein L24 1 1
MIRT040956 CES2 carboxylesterase 2 1 1
MIRT040957 LMNB2 lamin B2 1 1
MIRT040958 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT040959 AP3S1 adaptor-related protein complex 3, sigma 1 subunit 1 1
MIRT040960 GDF11 growth differentiation factor 11 1 1
MIRT040961 PKM pyruvate kinase, muscle 1 1
MIRT040962 MTRF1 mitochondrial translational release factor 1 1 1
MIRT040963 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT040964 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT040965 KDM6B lysine (K)-specific demethylase 6B 1 1
MIRT040966 TNKS1BP1 tankyrase 1 binding protein 1, 182kDa 1 1
MIRT040967 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT040968 TYMS thymidylate synthetase 1 1
MIRT040969 UBXN6 UBX domain protein 6 1 1
MIRT040970 PGK1 phosphoglycerate kinase 1 1 2
MIRT040971 CLU clusterin 1 1
MIRT040972 NAA16 N(alpha)-acetyltransferase 16, NatA auxiliary subunit 1 1
MIRT040973 MINK1 misshapen-like kinase 1 1 1
MIRT040974 EIF3A eukaryotic translation initiation factor 3, subunit A 1 1
MIRT040975 SLC46A1 solute carrier family 46 (folate transporter), member 1 1 1
MIRT040976 MED24 mediator complex subunit 24 1 1
MIRT040977 MAST2 microtubule associated serine/threonine kinase 2 1 1
MIRT040978 UBN1 ubinuclein 1 1 1
MIRT040979 ATP8B2 ATPase, aminophospholipid transporter, class I, type 8B, member 2 1 1
MIRT040980 SVIL supervillin 1 1
MIRT200691 NUP62 nucleoporin 62kDa 1 2
MIRT311181 ANKRD33B ankyrin repeat domain 33B 1 2
MIRT378518 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 2
MIRT462157 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT464908 TXNIP thioredoxin interacting protein 1 1
MIRT467476 SMYD1 SET and MYND domain containing 1 1 2
MIRT480652 BSCL2 Berardinelli-Seip congenital lipodystrophy 2 (seipin) 1 1
MIRT485444 KCTD15 potassium channel tetramerisation domain containing 15 1 2
MIRT487222 HIC1 hypermethylated in cancer 1 1 1
MIRT488383 VAV3 vav 3 guanine nucleotide exchange factor 1 3
MIRT495031 FAM179A family with sequence similarity 179, member A 1 2
MIRT496365 STK40 serine/threonine kinase 40 1 1
MIRT497692 SMAD3 SMAD family member 3 1 1
MIRT502992 CCDC71L coiled-coil domain containing 71-like 1 4
MIRT504263 C1orf147 chromosome 1 open reading frame 147 1 2
MIRT512457 POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD) 1 1
MIRT515910 MFAP2 microfibrillar-associated protein 2 1 2
MIRT526291 KY kyphoscoliosis peptidase 1 1
MIRT526923 IRGQ immunity-related GTPase family, Q 1 3
MIRT530776 GPD1 glycerol-3-phosphate dehydrogenase 1 (soluble) 1 1
MIRT535080 POU2F1 POU class 2 homeobox 1 1 1
MIRT552722 YTHDC1 YTH domain containing 1 1 1
MIRT572308 LSM4 LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT574758 GHITM growth hormone inducible transmembrane protein 1 1
MIRT612592 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT614015 PIGM phosphatidylinositol glycan anchor biosynthesis, class M 1 1
MIRT614239 WDR53 WD repeat domain 53 1 2
MIRT616141 HS3ST1 heparan sulfate (glucosamine) 3-O-sulfotransferase 1 1 1
MIRT623226 MON1B MON1 homolog B (yeast) 1 1
MIRT623284 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 1 2
MIRT627102 PDRG1 p53 and DNA-damage regulated 1 1 1
MIRT629338 MLXIPL MLX interacting protein-like 1 1
MIRT629655 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT631855 PIGG phosphatidylinositol glycan anchor biosynthesis, class G 1 1
MIRT633182 AAK1 AP2 associated kinase 1 1 1
MIRT634288 SUGT1 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) 1 1
MIRT634403 PLEKHA6 pleckstrin homology domain containing, family A member 6 1 1
MIRT634933 GTF2H2C general transcription factor IIH, polypeptide 2C 1 2
MIRT637361 SPN sialophorin 1 1
MIRT638250 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 1 1
MIRT638737 FAXC failed axon connections homolog (Drosophila) 1 1
MIRT639768 GPR45 G protein-coupled receptor 45 1 1
MIRT645792 PLCE1 phospholipase C, epsilon 1 1 1
MIRT645877 ZNF275 zinc finger protein 275 1 1
MIRT649208 KIAA1715 KIAA1715 1 1
MIRT657265 HSPA4L heat shock 70kDa protein 4-like 1 1
MIRT657389 HM13 histocompatibility (minor) 13 1 1
MIRT658323 FAM83F family with sequence similarity 83, member F 1 1
MIRT659279 CTIF CBP80/20-dependent translation initiation factor 1 1
MIRT661057 RPL18A ribosomal protein L18a 1 1
MIRT663609 SEC23B Sec23 homolog B (S. cerevisiae) 1 1
MIRT664522 PRX periaxin 1 1
MIRT665114 DNASE2 deoxyribonuclease II, lysosomal 1 1
MIRT668039 GTPBP10 GTP-binding protein 10 (putative) 1 1
MIRT671808 WISP3 WNT1 inducible signaling pathway protein 3 1 1
MIRT673109 MFSD2A major facilitator superfamily domain containing 2A 1 1
MIRT674851 GINM1 glycoprotein integral membrane 1 1 1
MIRT676814 AGMAT agmatine ureohydrolase (agmatinase) 1 1
MIRT677647 HAUS2 HAUS augmin-like complex, subunit 2 1 1
MIRT678721 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT679258 LRRD1 leucine-rich repeats and death domain containing 1 1 1
MIRT679334 ISG20L2 interferon stimulated exonuclease gene 20kDa-like 2 1 1
MIRT684775 MYO1F myosin IF 1 1
MIRT685510 MSH3 mutS homolog 3 (E. coli) 1 1
MIRT685539 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 1
MIRT686275 WWC1 WW and C2 domain containing 1 1 1
MIRT688387 ENAH enabled homolog (Drosophila) 1 1
MIRT688702 CPS1 carbamoyl-phosphate synthase 1, mitochondrial 1 1
MIRT690066 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT691320 KIAA1841 KIAA1841 1 1
MIRT691416 DNA2 DNA replication helicase 2 homolog (yeast) 1 1
MIRT693600 SLC39A1 solute carrier family 39 (zinc transporter), member 1 1 1
MIRT693760 ZNF383 zinc finger protein 383 1 1
MIRT694088 KIAA0930 KIAA0930 1 1
MIRT695020 MRPS21 mitochondrial ribosomal protein S21 1 1
MIRT695969 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT698894 SPTBN2 spectrin, beta, non-erythrocytic 2 1 1
MIRT698920 SPEM1 spermatid maturation 1 1 1
MIRT700503 PTPN4 protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 1 1
MIRT701820 MRPL37 mitochondrial ribosomal protein L37 1 1
MIRT706342 STAC2 SH3 and cysteine rich domain 2 1 1
MIRT708323 NT5C 5', 3'-nucleotidase, cytosolic 1 1
MIRT708935 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT708995 CABP4 calcium binding protein 4 1 1
MIRT709746 UBD ubiquitin D 1 1
MIRT710270 FAM107A family with sequence similarity 107, member A 1 1
MIRT711961 CYP27B1 cytochrome P450, family 27, subfamily B, polypeptide 1 1 1
MIRT712577 ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 1 1
MIRT712646 TXNL4A thioredoxin-like 4A 1 1
MIRT712898 TGFA transforming growth factor, alpha 1 1
MIRT714836 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT715508 MAPKBP1 mitogen-activated protein kinase binding protein 1 1 1
MIRT716736 APOL6 apolipoprotein L, 6 1 1
MIRT717992 C9orf171 chromosome 9 open reading frame 171 1 1
MIRT719498 SEC24B SEC24 family, member B (S. cerevisiae) 1 1
MIRT720677 SLC39A13 solute carrier family 39 (zinc transporter), member 13 1 1
MIRT722441 ZBTB7B zinc finger and BTB domain containing 7B 1 1
MIRT723561 KLHL11 kelch-like 11 (Drosophila) 1 1
MIRT723674 CTC1 CTS telomere maintenance complex component 1 1 1
MIRT723773 ROBO4 roundabout, axon guidance receptor, homolog 4 (Drosophila) 1 1
MIRT723813 OR1L8 olfactory receptor, family 1, subfamily L, member 8 1 1
MIRT725620 CAMKV CaM kinase-like vesicle-associated 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*