Accession ID: MIRT041135 [miRNA, hsa-miR-503-5p :: CTSA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-503LinkOut: [miRBase ]
Synonyms MIRN503, hsa-mir-503, MIR503
Description Homo sapiens miR-503 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-503-5p
Mature Sequence 6| UAGCAGCGGGAACAGUUCUGCAG |28
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-503-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CTSA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GLB2, GSL, NGBE, PPCA, PPGB
Description cathepsin A
Transcript NM_0011675    LinkOut: [ RefSeq ]
Other Transcripts NM_0011276 , NM_0003   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTSA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTSA
(miRNA target sites are highlighted)
>CTSA|NM_0011675|3'UTR
   1 CAGCCATACTGATGACCACAGCAACCAGCTCCACGGCCTGATGCAGCCCCTCCCAGCCTCTCCCGCTAGGAGAGTCCTCT
  81 TCTAAGCAAAGTGCCCCTGCAGGCCGGGTTCTGCCGCCAGGACTGCCCCCTTCCCAGAGCCCTGTACATCCCAGACTGGG
 161 CCCAGGGTCTCCCATAGACAGCCTGGGGGCAAGTTAGCACTTTATTCCCGCAGCAGTTCCTGAATGGGGTGGCCTGGCCC
 241 CTTCTCTGCTTAAAGAATGCCCTTTATGATGCACTGATTCCATCCCAGGAACCCAACAGAGCTCAGGACAGCCCACAGGG
 321 AGGTGGTGGACGGACTGTAATTGATAGATTGATTATGGAATTAAATTGGGTACAGCTTCAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-503-5p :: CTSA    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
58 hsa-miR-503-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000642 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 2 1
MIRT000643 CCNF cyclin F 2 1
MIRT000644 WEE1 WEE1 homolog (S. pombe) 2 1
MIRT000645 CCNE2 cyclin E2 2 1
MIRT000646 CCNE1 cyclin E1 2 1
MIRT000647 CHEK1 CHK1 checkpoint homolog (S. pombe) 2 1
MIRT000648 CDC25A cell division cycle 25 homolog A (S. pombe) 2 1
MIRT000649 EIF2C1 eukaryotic translation initiation factor 2C, 1 2 1
MIRT000650 ATF6 activating transcription factor 6 2 1
MIRT000651 ANLN anillin, actin binding protein 2 1
MIRT000652 CDC14A CDC14 cell division cycle 14 homolog A (S. cerevisiae) 2 1
MIRT001105 CCND1 cyclin D1 4 2
MIRT006789 CD40 CD40 molecule, TNF receptor superfamily member 5 1 1
MIRT007223 FGF2 fibroblast growth factor 2 (basic) 1 1
MIRT007224 VEGFA vascular endothelial growth factor A 1 1
MIRT041094 KIAA1671 KIAA1671 1 1
MIRT041095 RPL23 ribosomal protein L23 1 1
MIRT041096 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT041097 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 1
MIRT041098 CLTC clathrin, heavy chain (Hc) 1 1
MIRT041099 MRPS23 mitochondrial ribosomal protein S23 1 1
MIRT041100 CUZD1 CUB and zona pellucida-like domains 1 1 1
MIRT041101 AHSA1 AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) 1 1
MIRT041102 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT041103 RPS5 ribosomal protein S5 1 1
MIRT041104 CCNG2 cyclin G2 1 1
MIRT041105 MCM7 minichromosome maintenance complex component 7 1 1
MIRT041106 FARSA phenylalanyl-tRNA synthetase, alpha subunit 1 1
MIRT041107 RPL15 ribosomal protein L15 1 1
MIRT041108 CDK12 cyclin-dependent kinase 12 1 1
MIRT041109 MTPN myotrophin 1 1
MIRT041110 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT041111 DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) 1 1
MIRT041112 WBSCR16 Williams-Beuren syndrome chromosome region 16 1 1
MIRT041113 UHMK1 U2AF homology motif (UHM) kinase 1 1 1
MIRT041114 CTSD cathepsin D 1 1
MIRT041115 SIAH2 seven in absentia homolog 2 (Drosophila) 1 1
MIRT041116 LIX1L Lix1 homolog (mouse)-like 1 1
MIRT041117 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT041118 KIAA0895L KIAA0895-like 1 1
MIRT041119 MRGBP chromosome 20 open reading frame 20 1 1
MIRT041120 SPNS1 spinster homolog 1 (Drosophila) 1 1
MIRT041121 UBFD1 ubiquitin family domain containing 1 1 1
MIRT041122 HEXIM1 hexamethylene bis-acetamide inducible 1 1 1
MIRT041123 RPL18A ribosomal protein L18a 1 1
MIRT041124 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT041125 MRPL10 mitochondrial ribosomal protein L10 1 1
MIRT041126 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT041127 SBF1 SET binding factor 1 1 1
MIRT041128 PIK3R4 phosphoinositide-3-kinase, regulatory subunit 4 1 1
MIRT041129 DCLRE1A DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae) 1 1
MIRT041130 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 1
MIRT041131 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 1
MIRT041132 DHFR dihydrofolate reductase 1 1
MIRT041133 HDGF hepatoma-derived growth factor 1 1
MIRT041134 MT1E metallothionein 1E 1 1
MIRT041135 CTSA cathepsin A 1 1
MIRT041136 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1