Accession ID: MIRT041135 [miRNA, hsa-miR-503-5p :: CTSA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-503LinkOut: [miRBase ]
Synonyms MIRN503, hsa-mir-503, MIR503
Description Homo sapiens miR-503 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-503-5p
Mature Sequence 6| UAGCAGCGGGAACAGUUCUGCAG |28
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-503-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CTSA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GLB2, GSL, NGBE, PPCA, PPGB
Description cathepsin A
Transcript NM_000308    LinkOut: [ RefSeq ]
Other Transcripts NM_001127695 , NM_001167594   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTSA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTSA
(miRNA target sites are highlighted)
>CTSA|NM_000308|3'UTR
   1 CAGCCATACTGATGACCACAGCAACCAGCTCCACGGCCTGATGCAGCCCCTCCCAGCCTCTCCCGCTAGGAGAGTCCTCT
  81 TCTAAGCAAAGTGCCCCTGCAGGCCGGGTTCTGCCGCCAGGACTGCCCCCTTCCCAGAGCCCTGTACATCCCAGACTGGG
 161 CCCAGGGTCTCCCATAGACAGCCTGGGGGCAAGTTAGCACTTTATTCCCGCAGCAGTTCCTGAATGGGGTGGCCTGGCCC
 241 CTTCTCTGCTTAAAGAATGCCCTTTATGATGCACTGATTCCATCCCAGGAACCCAACAGAGCTCAGGACAGCCCACAGGG
 321 AGGTGGTGGACGGACTGTAATTGATAGATTGATTATGGAATTAAATTGGGTACAGCTTCAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gacGUCUUG--ACAAGGGCGACGau 5'
             :|| ||  | ||||||| ||  
Target 5' agtTAGCACTTTATTCCCGCAGCag 3'
192 - 216 118.00 -14.50
2
miRNA  3' gacguCUUGACAAGG---GCGACGAu 5'
               |: |||  ||   | ||||| 
Target 5' ggggtGGCCTGGCCCCTTCTCTGCTt 3'
226 - 251 118.00 -14.70
3
miRNA  3' gaCGUCUUGACAAGGGCGACGau 5'
            ||| || ||   || ||||  
Target 5' aaGCA-AAGTG---CCCCTGCag 3'
84 - 102 105.00 -11.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-503-5p :: CTSA    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gacgtctTGACAAGGGCGACGAt 5'
                 :|||||||:|||||| 
Target 5' ------cGCTGTTCCTGCTGCTg 3'
1 - 17
2
miRNA  3' gaCGTC-TTGACAAGGGCGACGAT----- 5'
            || |  :||| | |:|||||||     
Target 5' ctGCTGCTGCTGCTGCTGCTGCTAGTGTC 3'
12 - 40
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
240 hsa-miR-503-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000642 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 2 1
MIRT000643 CCNF cyclin F 2 1
MIRT000644 WEE1 WEE1 homolog (S. pombe) 3 3
MIRT000645 CCNE2 cyclin E2 3 4
MIRT000646 CCNE1 cyclin E1 3 3
MIRT000647 CHEK1 checkpoint kinase 1 3 2
MIRT000648 CDC25A cell division cycle 25 homolog A (S. pombe) 3 2
MIRT000649 EIF2C1 eukaryotic translation initiation factor 2C, 1 2 1
MIRT000650 ATF6 activating transcription factor 6 2 1
MIRT000651 ANLN anillin, actin binding protein 2 1
MIRT000652 CDC14A CDC14 cell division cycle 14 homolog A (S. cerevisiae) 2 1
MIRT001105 CCND1 cyclin D1 5 7
MIRT006789 CD40 CD40 molecule, TNF receptor superfamily member 5 1 1
MIRT007223 FGF2 fibroblast growth factor 2 (basic) 4 4
MIRT007224 VEGFA vascular endothelial growth factor A 2 7
MIRT041094 KIAA1671 KIAA1671 1 1
MIRT041095 RPL23 ribosomal protein L23 1 1
MIRT041096 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT041097 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 1
MIRT041098 CLTC clathrin, heavy chain (Hc) 1 1
MIRT041099 MRPS23 mitochondrial ribosomal protein S23 1 1
MIRT041100 CUZD1 CUB and zona pellucida-like domains 1 1 1
MIRT041101 AHSA1 AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) 1 1
MIRT041102 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT041103 RPS5 ribosomal protein S5 1 1
MIRT041104 CCNG2 cyclin G2 1 1
MIRT041105 MCM7 minichromosome maintenance complex component 7 1 1
MIRT041106 FARSA phenylalanyl-tRNA synthetase, alpha subunit 1 1
MIRT041107 RPL15 ribosomal protein L15 1 1
MIRT041108 CDK12 cyclin-dependent kinase 12 1 1
MIRT041109 MTPN myotrophin 1 1
MIRT041110 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT041111 DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) 1 1
MIRT041112 WBSCR16 Williams-Beuren syndrome chromosome region 16 1 1
MIRT041113 UHMK1 U2AF homology motif (UHM) kinase 1 1 1
MIRT041114 CTSD cathepsin D 1 1
MIRT041115 SIAH2 siah E3 ubiquitin protein ligase 2 1 1
MIRT041116 LIX1L Lix1 homolog (mouse)-like 1 1
MIRT041117 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT041118 KIAA0895L KIAA0895-like 1 1
MIRT041119 MRGBP MRG/MORF4L binding protein 1 1
MIRT041120 SPNS1 spinster homolog 1 (Drosophila) 1 1
MIRT041121 UBFD1 ubiquitin family domain containing 1 1 1
MIRT041122 HEXIM1 hexamethylene bis-acetamide inducible 1 1 1
MIRT041123 RPL18A ribosomal protein L18a 1 1
MIRT041124 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT041125 MRPL10 mitochondrial ribosomal protein L10 1 1
MIRT041126 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT041127 SBF1 SET binding factor 1 1 1
MIRT041128 PIK3R4 phosphoinositide-3-kinase, regulatory subunit 4 1 1
MIRT041129 DCLRE1A DNA cross-link repair 1A 1 1
MIRT041130 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 1
MIRT041131 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 2
MIRT041132 DHFR dihydrofolate reductase 1 1
MIRT041133 HDGF hepatoma-derived growth factor 1 1
MIRT041134 MT1E metallothionein 1E 1 1
MIRT041135 CTSA cathepsin A 1 1
MIRT041136 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT053075 CCND3 cyclin D3 2 1
MIRT054231 TNFRSF11A tumor necrosis factor receptor superfamily, member 11a, NFKB activator 2 1
MIRT054427 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 4 5
MIRT054428 IKBKB inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta 3 1
MIRT054780 TNFRSF11A tumor necrosis factor receptor superfamily, member 11a, NFKB activator 4 1
MIRT054861 FGF8 fibroblast growth factor 8 (androgen-induced) 3 1
MIRT064691 CCND2 cyclin D2 1 2
MIRT073642 IGF1R insulin-like growth factor 1 receptor 3 1
MIRT083460 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 2
MIRT093690 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096241 CANX calnexin 1 1
MIRT105844 DDHD2 DDHD domain containing 2 1 1
MIRT107784 DCAF10 DDB1 and CUL4 associated factor 10 1 2
MIRT133780 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT142251 DCTN5 dynactin 5 (p25) 1 4
MIRT156473 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT170931 FOXK1 forkhead box K1 1 1
MIRT186377 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT196459 TAOK1 TAO kinase 1 1 1
MIRT206833 PAPOLG poly(A) polymerase gamma 1 2
MIRT215381 CREBRF CREB3 regulatory factor 1 1
MIRT249859 CHAC1 ChaC, cation transport regulator homolog 1 (E. coli) 1 1
MIRT319923 ZNF282 zinc finger protein 282 1 1
MIRT320612 ZNRF2 zinc and ring finger 2 1 1
MIRT321164 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT324278 LURAP1L leucine rich adaptor protein 1-like 1 1
MIRT326310 OCRL oculocerebrorenal syndrome of Lowe 1 1
MIRT437350 FANCA Fanconi anemia, complementation group A 2 1
MIRT437379 FGFR1 fibroblast growth factor receptor 1 3 1
MIRT437907 FBXW7 F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase 2 1
MIRT437989 ARHGEF19 Rho guanine nucleotide exchange factor (GEF) 19 3 1
MIRT438662 BCL2 B-cell CLL/lymphoma 2 3 1
MIRT444126 ZNRF3 zinc and ring finger 3 1 1
MIRT446501 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT448439 TLL1 tolloid-like 1 1 1
MIRT450334 LRWD1 leucine-rich repeats and WD repeat domain containing 1 1 1
MIRT451851 TXNDC5 thioredoxin domain containing 5 (endoplasmic reticulum) 1 1
MIRT461557 ACTR3B ARP3 actin-related protein 3 homolog B (yeast) 1 1
MIRT463169 ZNF367 zinc finger protein 367 1 5
MIRT463597 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT465166 TSC22D2 TSC22 domain family, member 2 1 1
MIRT466431 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 4
MIRT467397 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT468674 SEC24A SEC24 family, member A (S. cerevisiae) 1 2
MIRT469408 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 3
MIRT470751 PNPLA6 patatin-like phospholipase domain containing 6 1 1
MIRT471949 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT472469 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 1 6
MIRT479337 CERK ceramide kinase 1 1
MIRT480542 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT482113 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 2
MIRT485207 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 4
MIRT494112 DNAH17 dynein, axonemal, heavy chain 17 1 1
MIRT498977 ORC4 origin recognition complex, subunit 4 1 4
MIRT499113 SNRPB2 small nuclear ribonucleoprotein polypeptide B 1 4
MIRT499449 ODF2L outer dense fiber of sperm tails 2-like 1 4
MIRT500090 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500320 ZNF622 zinc finger protein 622 1 4
MIRT500418 ZMAT3 zinc finger, matrin-type 3 1 4
MIRT500574 USP53 ubiquitin specific peptidase 53 1 1
MIRT500599 UBN2 ubinuclein 2 1 5
MIRT500800 TLK1 tousled-like kinase 1 1 3
MIRT500933 SRPR signal recognition particle receptor (docking protein) 1 3
MIRT500948 SREK1 splicing regulatory glutamine/lysine-rich protein 1 1 4
MIRT501084 SMAD7 SMAD family member 7 1 4
MIRT501821 NDUFA4P1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa, pseudogene 1 1 3
MIRT501880 MOB4 MOB family member 4, phocein 1 4
MIRT502196 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT502642 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 4
MIRT502916 CDCA4 cell division cycle associated 4 1 4
MIRT502945 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 4
MIRT504533 ZNF620 zinc finger protein 620 1 3
MIRT505074 ZFHX4 zinc finger homeobox 4 1 3
MIRT505111 YTHDC1 YTH domain containing 1 1 3
MIRT505343 TMEM245 transmembrane protein 245 1 3
MIRT505390 TMEM100 transmembrane protein 100 1 1
MIRT505683 SESTD1 SEC14 and spectrin domains 1 1 3
MIRT506163 PLAG1 pleiomorphic adenoma gene 1 1 4
MIRT506187 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 3
MIRT506355 NUP50 nucleoporin 50kDa 1 3
MIRT506483 MYO5A myosin VA (heavy chain 12, myoxin) 1 3
MIRT506853 KIF23 kinesin family member 23 1 3
MIRT507513 DYNLL2 dynein, light chain, LC8-type 2 1 2
MIRT509138 ZNF691 zinc finger protein 691 1 2
MIRT509687 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT512207 C1orf21 chromosome 1 open reading frame 21 1 3
MIRT518088 TRIM35 tripartite motif containing 35 1 1
MIRT518991 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT520965 SPRED1 sprouty-related, EVH1 domain containing 1 1 1
MIRT521050 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 2
MIRT521193 SBNO1 strawberry notch homolog 1 (Drosophila) 1 3
MIRT521620 PSAT1 phosphoserine aminotransferase 1 1 3
MIRT522095 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 2
MIRT534133 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 2
MIRT537819 EFNB2 ephrin-B2 1 2
MIRT540840 GNAT1 guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1 1 2
MIRT541022 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 1
MIRT541147 PISD phosphatidylserine decarboxylase 1 1
MIRT541388 CDC42SE2 CDC42 small effector 2 1 1
MIRT541427 CBX4 chromobox homolog 4 1 1
MIRT543522 PRSS21 protease, serine, 21 (testisin) 1 1
MIRT543833 GSG1 germ cell associated 1 1 1
MIRT544962 UGT2B4 UDP glucuronosyltransferase 2 family, polypeptide B4 1 1
MIRT545183 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545344 CCDC83 coiled-coil domain containing 83 1 1
MIRT545679 DECR1 2,4-dienoyl CoA reductase 1, mitochondrial 1 1
MIRT545939 ZBTB44 zinc finger and BTB domain containing 44 1 2
MIRT546111 USP48 ubiquitin specific peptidase 48 1 2
MIRT546605 SALL1 sal-like 1 (Drosophila) 1 2
MIRT546641 RTN4 reticulon 4 1 1
MIRT547667 KPNA3 karyopherin alpha 3 (importin alpha 4) 1 1
MIRT547806 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT547995 HCFC2 host cell factor C2 1 2
MIRT548725 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT548943 CDK17 cyclin-dependent kinase 17 1 1
MIRT549073 CACUL1 CDK2-associated, cullin domain 1 1 1
MIRT549274 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT549439 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 1
MIRT550464 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550820 FAM229B chromosome 6 open reading frame 225 1 1
MIRT552032 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT552341 ZNF704 zinc finger protein 704 1 1
MIRT552446 ZNF449 zinc finger protein 449 1 1
MIRT552741 YRDC yrdC domain containing (E. coli) 1 1
MIRT553118 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT553807 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554686 RNF41 ring finger protein 41 1 1
MIRT554697 RNF149 ring finger protein 149 1 1
MIRT554845 RECK reversion-inducing-cysteine-rich protein with kazal motifs 1 1
MIRT555141 PTPRD protein tyrosine phosphatase, receptor type, D 1 1
MIRT555273 PRDM4 PR domain containing 4 1 1
MIRT555313 PPP2R5C protein phosphatase 2, regulatory subunit B', gamma 1 2
MIRT555559 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT556860 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557477 GPR27 G protein-coupled receptor 27 1 2
MIRT558034 EXT1 exostosin 1 1 1
MIRT558362 DMTF1 cyclin D binding myb-like transcription factor 1 1 1
MIRT558506 CYP26B1 cytochrome P450, family 26, subfamily B, polypeptide 1 1 2
MIRT558516 CTDSPL CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like 1 2
MIRT558584 CREBL2 cAMP responsive element binding protein-like 2 1 2
MIRT558642 CNNM2 cyclin M2 1 1
MIRT558654 CNKSR3 CNKSR family member 3 1 1
MIRT558866 CD2AP CD2-associated protein 1 1
MIRT559003 CA8 carbonic anhydrase VIII 1 1
MIRT559162 BTN3A3 butyrophilin, subfamily 3, member A3 1 1
MIRT560000 RAB3IP RAB3A interacting protein (rabin3) 1 1
MIRT562024 LANCL1 LanC lantibiotic synthetase component C-like 1 (bacterial) 1 1
MIRT562589 CBX2 chromobox homolog 2 1 1
MIRT562596 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT562874 KIAA1456 KIAA1456 1 1
MIRT563083 SLC25A12 solute carrier family 25 (aspartate/glutamate carrier), member 12 1 1
MIRT563500 DLGAP3 discs, large (Drosophila) homolog-associated protein 3 1 1
MIRT563893 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564329 CCNT1 cyclin T1 1 1
MIRT564947 XKR7 XK, Kell blood group complex subunit-related family, member 7 1 1
MIRT564982 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565677 SETD1B SET domain containing 1B 1 1
MIRT566303 PPM1A protein phosphatase, Mg2+/Mn2+ dependent, 1A 1 1
MIRT566715 MTMR3 myotubularin related protein 3 1 1
MIRT566828 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT571237 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT571425 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT571952 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT571963 KIF5B kinesin family member 5B 1 1
MIRT573040 GREM2 gremlin 2 1 1
MIRT574592 N4BP1 NEDD4 binding protein 1 1 1
MIRT575879 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT576364 Pxdn peroxidasin homolog (Drosophila) 1 1
MIRT614695 TRAK1 trafficking protein, kinesin binding 1 1 1
MIRT616984 EPOR erythropoietin receptor 1 1
MIRT628988 SMAD2 SMAD family member 2 1 1
MIRT629131 ANK3 ankyrin 3, node of Ranvier (ankyrin G) 1 1
MIRT632406 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 1
MIRT659254 CUL3 cullin 3 1 1
MIRT680979 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682273 RS1 retinoschisin 1 1 1
MIRT682511 GLP2R glucagon-like peptide 2 receptor 1 1
MIRT687382 NT5DC3 5'-nucleotidase domain containing 3 1 1
MIRT693927 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT700661 PPP1R11 protein phosphatase 1, regulatory (inhibitor) subunit 11 1 1
MIRT702878 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT706165 CASK calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*