Accession ID: MIRT041140 [miRNA, hsa-miR-501-5p :: HSP90AA1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-501LinkOut: [miRBase ]
Synonyms MIRN501, hsa-mir-501, MIR501
Description Homo sapiens miR-501 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-501-5p
Mature Sequence 14| AAUCCUUUGUCCCUGGGUGAGA |35
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-501-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol HSP90AA1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms HSP86, HSP89A, HSP90A, HSP90N, HSPC1, HSPCA, HSPCAL1, HSPCAL4, HSPN, Hsp89, Hsp90, LAP2
Description heat shock protein 90kDa alpha (cytosolic), class A member 1
Transcript NM_001017963    LinkOut: [ RefSeq ]
Other Transcripts NM_005348   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on HSP90AA1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of HSP90AA1
(miRNA target sites are highlighted)
>HSP90AA1|NM_001017963|3'UTR
   1 TCTCTGGCTGAGGGATGACTTACCTGTTCAGTACTCTACAATTCCTCTGATAATATATTTTCAAGGATGTTTTTCTTTAT
  81 TTTTGTTAATATTAAAAAGTCTGTATGGCATGACAACTACTTTAAGGGGAAGATAAGATTTCTGTCTACTAAGTGATGCT
 161 GTGATACCTTAGGCACTAAAGCAGAGCTAGTAATGCTTTTTGAGTTTCATGTTGGTTTATTTTCACAGATTGGGGTAACG
 241 TGCACTGTAAGACGTATGTAACATGATGTTAACTTTGTGGTCTAAAGTGTTTAGCTGTCAAGCCGGATGCCTAAGTAGAC
 321 CAAATCTTGTTATTGAAGTGTTCTGAGCTGTATCTTGATGTTTAGAAAAGTATTCGTTACATCTTGTAGGATCTACTTTT
 401 TGAACTTTTCATTCCCTGTAGTTGACAATTCTGCATGTACTAGTCCTCTAGAAATAGGTTAAACTGAAGCAACTTGATGG
 481 AAGGATCTCTCCACAGGGCTTGTTTTCCAAAGAAAAGTATTGTTTGGAGGAGCAAAGTTAAAAGCCTACCTAAGCATATC
 561 GTAAAGCTGTTCAAAAATAACTCAGACCCAGTCTTGTGGATGGAAATGTAGTGCTCGAGTCACATTCTGCTTAAAGTTGT
 641 AACAAATACAGATGAGTTAAAAGATATTGTGTGACAGTGTCTTATTTAGGGGGAAAGGGGAGTATCTGGATGACAGTTAG
 721 TGCCAAAATGTAAAACATGAGGCGCTAGCAGGAGATGGTTAAACACTAGCTGCTCCAAGGGTTGACATGGTCTTCCCAGC
 801 ATGTACTCAGCAGGTGTGGGGTGGAGCACACGTAGGCACAGAAAACAGGAATGCAGACAACATGCATCCCCTGCGTCCAT
 881 GAGTTACATGTGTTCTCTTAGTGTCCACGTTGTTTTGATGTTATTCATGGAATACCTTCTGTGTTAAATACAGTCACTTA
 961 ATTCCTTGGCCTTA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agAGUGGGUCCCUGUUUCCUaa 5'
            |:|:::||||: |||||:  
Target 5' tcTTATTTAGGGGGAAAGGGga 3'
680 - 701 136.00 -24.50
2
miRNA  3' agaguggguccCUG-UUUCCUAa 5'
                     ||: :|||||| 
Target 5' tgaagcaacttGATGGAAGGATc 3'
465 - 487 127.00 -7.70
3
miRNA  3' agaguGGGUCCCUGUUUCCUAa 5'
               :|:  || ::|:|||| 
Target 5' -----TCTCTGGCTGAGGGATg 3'
1 - 17 117.00 -13.29
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-501-5p :: HSP90AA1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' agagtgggtccctGTTTCCtaa 5'
                       || |||   
Target 5' --------ctctcCACAGGgct 3'
1 - 14
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
146 hsa-miR-501-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT007340 LAMTOR5 late endosomal/lysosomal adaptor, MAPK and MTOR activator 5 3 1
MIRT041137 HDGF hepatoma-derived growth factor 1 1
MIRT041138 HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 1 1
MIRT041139 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT041140 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT041141 CDC6 cell division cycle 6 homolog (S. cerevisiae) 1 1
MIRT041142 SFXN1 sideroflexin 1 1 1
MIRT041143 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT041144 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT041145 RPS19 ribosomal protein S19 1 1
MIRT118236 CSRP2BP CSRP2 binding protein 1 1
MIRT257291 FOXC1 forkhead box C1 1 1
MIRT353988 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 2
MIRT371490 SREK1IP1 SREK1-interacting protein 1 1 1
MIRT445196 FAXC failed axon connections homolog (Drosophila) 1 1
MIRT447663 SLC7A6OS solute carrier family 7, member 6 opposite strand 1 1
MIRT468252 SFXN4 sideroflexin 4 1 1
MIRT469440 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT469848 PXK PX domain containing serine/threonine kinase 1 4
MIRT485455 IVNS1ABP influenza virus NS1A binding protein 1 1
MIRT506044 PRDX3 peroxiredoxin 3 1 3
MIRT517345 DCAF4L1 DDB1 and CUL4 associated factor 4-like 1 1 2
MIRT518989 NNT nicotinamide nucleotide transhydrogenase 1 3
MIRT528207 NELFE RD RNA binding protein 1 1
MIRT528605 ZNF326 zinc finger protein 326 1 1
MIRT529519 ICMT isoprenylcysteine carboxyl methyltransferase 1 1
MIRT534042 STK4 serine/threonine kinase 4 1 1
MIRT534067 SRSF10 serine/arginine-rich splicing factor 10 1 1
MIRT538179 DCDC2 doublecortin domain containing 2 1 1
MIRT543830 GSG1 germ cell associated 1 1 1
MIRT550816 FAM229B chromosome 6 open reading frame 225 1 1
MIRT559728 ADIPOR2 adiponectin receptor 2 1 1
MIRT609590 GPM6B glycoprotein M6B 1 1
MIRT610896 HINFP histone H4 transcription factor 1 1
MIRT611550 GGT6 gamma-glutamyltransferase 6 1 1
MIRT612952 GNAQ guanine nucleotide binding protein (G protein), q polypeptide 1 1
MIRT615514 PRRC2A proline-rich coiled-coil 2A 1 1
MIRT617311 FAM9C family with sequence similarity 9, member C 1 1
MIRT617499 H2AFX H2A histone family, member X 1 1
MIRT617537 LYRM7 LYR motif containing 7 1 2
MIRT618230 PGBD4 piggyBac transposable element derived 4 1 1
MIRT619088 OMA1 OMA1 zinc metallopeptidase homolog (S. cerevisiae) 1 1
MIRT619335 SCYL3 SCY1-like 3 (S. cerevisiae) 1 1
MIRT620033 ST6GALNAC3 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 1 1
MIRT621205 GALNT8 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8) 1 1
MIRT621354 GUCA1B guanylate cyclase activator 1B (retina) 1 1
MIRT621669 UBE4B ubiquitination factor E4B 1 1
MIRT622245 SLC25A20 solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 1 1
MIRT622597 PRRC2B proline-rich coiled-coil 2B 1 1
MIRT622748 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase, type II, alpha 1 1
MIRT623618 INTU inturned planar cell polarity effector homolog (Drosophila) 1 1
MIRT624084 DR1 down-regulator of transcription 1, TBP-binding (negative cofactor 2) 1 1
MIRT624361 CHD1 chromodomain helicase DNA binding protein 1 1 1
MIRT624384 CD84 CD84 molecule 1 1
MIRT624661 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 1
MIRT625438 RMDN1 family with sequence similarity 82, member B 1 1
MIRT626729 TRIM65 tripartite motif containing 65 1 1
MIRT627695 RNF165 ring finger protein 165 1 1
MIRT627830 PPIC peptidylprolyl isomerase C (cyclophilin C) 1 1
MIRT627867 PARVB parvin, beta 1 1
MIRT628173 HAS2 hyaluronan synthase 2 1 1
MIRT637090 KLRD1 killer cell lectin-like receptor subfamily D, member 1 1 1
MIRT639217 PPIL2 peptidylprolyl isomerase (cyclophilin)-like 2 1 1
MIRT639340 SIK3 SIK family kinase 3 1 1
MIRT639362 INIP INTS3 and NABP interacting protein 1 1
MIRT639384 FFAR4 omega-3 fatty acid receptor 1 1 1
MIRT639720 NPRL3 nitrogen permease regulator-like 3 (S. cerevisiae) 1 1
MIRT640321 STAT1 signal transducer and activator of transcription 1, 91kDa 1 1
MIRT641071 HHIPL1 HHIP-like 1 1 1
MIRT641103 C16orf72 chromosome 16 open reading frame 72 1 1
MIRT641684 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT641915 SLC8A1 solute carrier family 8 (sodium/calcium exchanger), member 1 1 1
MIRT642050 KCNN3 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 1 1
MIRT642673 RGS6 regulator of G-protein signaling 6 1 1
MIRT643147 COMMD2 COMM domain containing 2 1 1
MIRT643775 FSHB follicle stimulating hormone, beta polypeptide 1 1
MIRT643787 DCLK3 doublecortin-like kinase 3 1 1
MIRT643825 SP140L SP140 nuclear body protein-like 1 1
MIRT644627 SRSF2 serine/arginine-rich splicing factor 2 1 1
MIRT645474 NTM neurotrimin 1 1
MIRT646067 VANGL2 vang-like 2 (van gogh, Drosophila) 1 1
MIRT646105 GORAB golgin, RAB6-interacting 1 1
MIRT646293 ZNF277 zinc finger protein 277 1 1
MIRT646910 TMEM248 transmembrane protein 248 1 1
MIRT646984 SCARB1 scavenger receptor class B, member 1 1 1
MIRT647134 OR9Q1 olfactory receptor, family 9, subfamily Q, member 1 1 1
MIRT647216 CYP2U1 cytochrome P450, family 2, subfamily U, polypeptide 1 1 1
MIRT648180 TBCA tubulin folding cofactor A 1 1
MIRT648327 PLIN1 perilipin 1 1 1
MIRT648349 PPP1R16B protein phosphatase 1, regulatory subunit 16B 1 1
MIRT649029 SLC1A2 solute carrier family 1 (glial high affinity glutamate transporter), member 2 1 1
MIRT649565 POLD3 polymerase (DNA-directed), delta 3, accessory subunit 1 1
MIRT649872 SLFN12L schlafen family member 12-like 1 1
MIRT650103 POLR1A polymerase (RNA) I polypeptide A, 194kDa 1 1
MIRT650391 C1D C1D nuclear receptor corepressor 1 1
MIRT650605 HSD3B1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 1 1
MIRT651252 ZMAT4 zinc finger, matrin-type 4 1 1
MIRT652001 UBA6 ubiquitin-like modifier activating enzyme 6 1 1
MIRT652420 TMEM242 transmembrane protein 242 1 1
MIRT652574 TLR6 toll-like receptor 6 1 1
MIRT652823 TAOK1 TAO kinase 1 1 1
MIRT652855 TACC1 transforming, acidic coiled-coil containing protein 1 1 1
MIRT652966 SVEP1 sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1 1 1
MIRT653101 SRSF7 serine/arginine-rich splicing factor 7 1 1
MIRT653174 SPPL3 signal peptide peptidase like 3 1 1
MIRT653537 SLC38A9 solute carrier family 38, member 9 1 1
MIRT653571 SLC35B3 solute carrier family 35, member B3 1 1
MIRT653729 SLC25A32 solute carrier family 25 (mitochondrial folate carrier) , member 32 1 1
MIRT654375 RBM23 RNA binding motif protein 23 1 1
MIRT654808 PPT1 palmitoyl-protein thioesterase 1 1 1
MIRT655750 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 1
MIRT656694 LONRF2 LON peptidase N-terminal domain and ring finger 2 1 1
MIRT656935 KIAA1456 KIAA1456 1 1
MIRT657128 ITPRIPL1 inositol 1,4,5-trisphosphate receptor interacting protein-like 1 1 1
MIRT657155 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 1
MIRT657186 IKZF5 IKAROS family zinc finger 5 (Pegasus) 1 1
MIRT657582 GRIN2B glutamate receptor, ionotropic, N-methyl D-aspartate 2B 1 1
MIRT657898 GDF7 growth differentiation factor 7 1 1
MIRT658056 FSD1L fibronectin type III and SPRY domain containing 1-like 1 1
MIRT658066 FRRS1L ferric-chelate reductase 1-like 1 1
MIRT658529 ERP44 endoplasmic reticulum protein 44 1 1
MIRT658715 ELOVL4 ELOVL fatty acid elongase 4 1 1
MIRT658808 EFNA5 ephrin-A5 1 1
MIRT659273 CTNNBIP1 catenin, beta interacting protein 1 1 1
MIRT659996 C2CD2L C2CD2-like 1 1
MIRT660064 C11orf87 chromosome 11 open reading frame 87 1 1
MIRT660138 BRPF3 bromodomain and PHD finger containing, 3 1 1
MIRT660420 ATXN1L ataxin 1-like 1 1
MIRT661515 C8orf82 chromosome 8 open reading frame 82 1 1
MIRT663683 CCDC18 coiled-coil domain containing 18 1 1
MIRT664815 NOX5 NADPH oxidase, EF-hand calcium binding domain 5 1 1
MIRT666303 SLC25A25 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 1 1
MIRT666352 SIX1 SIX homeobox 1 1 1
MIRT667084 OTOG otogelin 1 1
MIRT667528 LRP2BP LRP2 binding protein 1 2
MIRT667705 KIF26B kinesin family member 26B 1 1
MIRT668422 FAM217B family with sequence similarity 217, member B 1 1
MIRT697549 ZBTB44 zinc finger and BTB domain containing 44 1 1
MIRT712014 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT713093 QSER1 glutamine and serine rich 1 1 1
MIRT717315 TRAF3IP1 TNF receptor-associated factor 3 interacting protein 1 1 1
MIRT720629 ZNF585B zinc finger protein 585B 1 1
MIRT721408 MYT1L myelin transcription factor 1-like 1 1
MIRT722242 RBM41 RNA binding motif protein 41 1 1
MIRT724371 ASGR1 asialoglycoprotein receptor 1 1 1
MIRT725415 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*