Accession ID: MIRT041140 [miRNA, hsa-miR-501-5p :: HSP90AA1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-501LinkOut: [miRBase ]
Synonyms MIRN501, hsa-mir-501, MIR501
Description Homo sapiens miR-501 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-501-5p
Mature Sequence 14| AAUCCUUUGUCCCUGGGUGAGA |35
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-501-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol HSP90AA1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ31884, HSP86, HSP89A, HSP90A, HSP90N, HSPC1, HSPCA, HSPCAL1, HSPCAL4, HSPN, Hsp89, Hsp90, LAP2
Description heat shock protein 90kDa alpha (cytosolic), class A member 1
Transcript NM_0010179    LinkOut: [ RefSeq ]
Other Transcripts NM_0053   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on HSP90AA1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of HSP90AA1
(miRNA target sites are highlighted)
>HSP90AA1|NM_0010179|3'UTR
   1 TAATCTCTGGCTGAGGGATGACTTACCTGTTCAGTACTCTACAATTCCTCTGATAATATATTTTCAAGGATGTTTTTCTT
  81 TATTTTTGTTAATATTAAAAAGTCTGTATGGCATGACAACTACTTTAAGGGGAAGATAAGATTTCTGTCTACTAAGTGAT
 161 GCTGTGATACCTTAGGCACTAAAGCAGAGCTAGTAATGCTTTTTGAGTTTCATGTTGGTTTATTTTCACAGATTGGGGTA
 241 ACGTGCACTGTAAGACGTATGTAACATGATGTTAACTTTGTGGTCTAAAGTGTTTAGCTGTCAAGCCGGATGCCTAAGTA
 321 GACCAAATCTTGTTATTGAAGTGTTCTGAGCTGTATCTTGATGTTTAGAAAAGTATTCGTTACATCTTGTAGGATCTACT
 401 TTTTGAACTTTTCATTCCCTGTAGTTGACAATTCTGCATGTACTAGTCCTCTAGAAATAGGTTAAACTGAAGCAACTTGA
 481 TGGAAGGATCTCTCCACAGGGCTTGTTTTCCAAAGAAAAGTATTGTTTGGAGGAGCAAAGTTAAAAGCCTACCTAAGCAT
 561 ATCGTAAAGCTGTTCAAAAATAACTCAGACCCAGTCTTGTGGATGGAAATGTAGTGCTCGAGTCACATTCTGCTTAAAGT
 641 TGTAACAAATACAGATGAGTTAAAAGATATTGTGTGACAGTGTCTTATTTAGGGGGAAAGGGGAGTATCTGGATGACAGT
 721 TAGTGCCAAAATGTAAAACATGAGGCGCTAGCAGGAGATGGTTAAACACTAGCTGCTCCAAGGGTTGACATGGTCTTCCC
 801 AGCATGTACTCAGCAGGTGTGGGGTGGAGCACACGTAGGCACAGAAAACAGGAATGCAGACAACATGCATCCCCTGCGTC
 881 CATGAGTTACATGTGTTCTCTTAGTGTCCACGTTGTTTTGATGTTATTCATGGAATACCTTCTGTGTTAAATACAGTCAC
 961 TTAATTCCTTGGCCTTAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agAGUGGGUCCCUGUUUCCUaa 5'
            |:|:::||||: |||||:  
Target 5' tcTTATTTAGGGGGAAAGGGga 3'
683 - 704 136.00 -24.50
2
miRNA  3' agaguggguccCUG-UUUCCUAa 5'
                     ||: :|||||| 
Target 5' tgaagcaacttGATGGAAGGATc 3'
468 - 490 127.00 -7.70
3
miRNA  3' agAGUGGGUCCCUGUUUCCUAa 5'
            | |:|:  || ::|:|||| 
Target 5' --TAATCTCTGGCTGAGGGATg 3'
1 - 20 124.00 -13.29
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-501-5p :: HSP90AA1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' agagtgggtccctGTTTCCtaa 5'
                       || |||   
Target 5' --------ctctcCACAGGgct 3'
1 - 14
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
10 hsa-miR-501-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT007340 LAMTOR5 hepatitis B virus x interacting protein 3 1
MIRT041137 HDGF hepatoma-derived growth factor 1 1
MIRT041138 HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 1 1
MIRT041139 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT041140 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT041141 CDC6 cell division cycle 6 homolog (S. cerevisiae) 1 1
MIRT041142 SFXN1 sideroflexin 1 1 1
MIRT041143 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT041144 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT041145 RPS19 ribosomal protein S19 1 1