Accession ID: MIRT041744 [miRNA, hsa-miR-484 :: MSH6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-484LinkOut: [miRBase ]
Synonyms MIRN484, hsa-mir-484, MIR484
Description Homo sapiens miR-484 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-484
Mature Sequence 8| UCAGGCUCAGUCCCCUCCCGAU |29
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-484 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MSH6 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GTBP, HNPCC5, HSAP
Description mutS homolog 6 (E. coli)
Transcript NM_0001    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MSH6 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MSH6
(miRNA target sites are highlighted)
>MSH6|NM_0001|3'UTR
   1 TAGACTGACTACATTGGAAGCTTTGAGTTGACTTCTGACAAAGGTGGTAAATTCAGACAACATTATGATCTAATAAACTT
  81 TATTTTTTAAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
 161 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uagcccuccccugacUCGGACu 5'
                         || ||| 
Target 5' --------------tAGACTGa 3'
1 - 8 88.00 -6.72
2
miRNA  3' uagcCCUCCCCUGACUCGGACu 5'
              |||  |  :|||| :|| 
Target 5' cattGGA-AGCTTTGAG-TTGa 3'
12 - 31 81.00 -12.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-484 :: MSH6    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' taGCCCTCCCCTGACTCGGAct 5'
            || |:||| : ||: |||  
Target 5' gtCGAGGGGGTGATGGTCCTat 3'
2 - 23
2
miRNA  3' tagccctcccctgacTCGGACT- 5'
                         | :|||  
Target 5' atgtgtcgcccagtaATTCTGTT 3'
22 - 44
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
780 hsa-miR-484 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006714 FIS1 fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) 3 1
MIRT016617 RPS29 ribosomal protein S29 1 1
MIRT016618 EDA2R ectodysplasin A2 receptor 1 1
MIRT016619 ZBED4 zinc finger, BED-type containing 4 1 1
MIRT016620 NHSL1 NHS-like 1 1 1
MIRT016621 UBR5 ubiquitin protein ligase E3 component n-recognin 5 1 1
MIRT016622 YRDC yrdC domain containing (E. coli) 1 1
MIRT016623 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 2
MIRT016624 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 1 1
MIRT016625 NUP54 nucleoporin 54kDa 1 1
MIRT016626 KCNJ14 potassium inwardly-rectifying channel, subfamily J, member 14 1 1
MIRT016627 HOXA5 homeobox A5 1 1
MIRT041624 BAG5 BCL2-associated athanogene 5 1 1
MIRT041625 ANAPC7 anaphase promoting complex subunit 7 1 1
MIRT041626 TUBB2A tubulin, beta 2A 1 1
MIRT041627 IL2 interleukin 2 1 1
MIRT041628 URGCP upregulator of cell proliferation 1 1
MIRT041629 PCNT pericentrin 1 1
MIRT041630 NME8 thioredoxin domain containing 3 (spermatozoa) 1 1
MIRT041631 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT041632 C1orf21 chromosome 1 open reading frame 21 1 1
MIRT041633 ZNF354A zinc finger protein 354A 1 1
MIRT041634 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT041635 AEBP2 AE binding protein 2 1 1
MIRT041636 PKD1 polycystic kidney disease 1 (autosomal dominant) 1 1
MIRT041637 C14orf166 chromosome 14 open reading frame 166 1 1
MIRT041638 H2AFY H2A histone family, member Y 1 1
MIRT041639 TMF1 TATA element modulatory factor 1 1 1
MIRT041640 FAU Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed 1 1
MIRT041641 PTRH2 peptidyl-tRNA hydrolase 2 1 1
MIRT041642 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT041643 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT041644 DDX6 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 1 1
MIRT041645 HIST2H4B histone cluster 2, H4b 1 1
MIRT041646 SYNE2 spectrin repeat containing, nuclear envelope 2 1 1
MIRT041647 MDH2 malate dehydrogenase 2, NAD (mitochondrial) 1 1
MIRT041648 SLC6A8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 1 1
MIRT041649 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT041650 GOT2 glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) 1 1
MIRT041651 UQCRQ ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa 1 1
MIRT041652 RAB40C RAB40C, member RAS oncogene family 1 1
MIRT041653 RPS15 ribosomal protein S15 1 1
MIRT041654 METTL2A methyltransferase like 2A 1 1
MIRT041655 BAG6 HLA-B associated transcript 3 1 1
MIRT041656 CASC3 cancer susceptibility candidate 3 1 1
MIRT041657 AGO4 eukaryotic translation initiation factor 2C, 4 1 1
MIRT041658 RPS10 ribosomal protein S10 1 1
MIRT041659 METTL10 methyltransferase like 10 1 1
MIRT041660 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT041661 KIAA0895 KIAA0895 1 1
MIRT041662 ZNF362 zinc finger protein 362 1 1
MIRT041663 RPS24 ribosomal protein S24 1 1
MIRT041664 SRSF9 splicing factor, arginine/serine-rich 9 1 1
MIRT041665 PKM pyruvate kinase, muscle 1 1
MIRT041666 EXOC5 exocyst complex component 5 1 1
MIRT041667 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT041668 FAM46A family with sequence similarity 46, member A 1 1
MIRT041669 ACTB actin, beta 1 1
MIRT041670 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT041671 ATXN7L3 ataxin 7-like 3 1 1
MIRT041672 RPS18 ribosomal protein S18 1 1
MIRT041673 TMEM9B TMEM9 domain family, member B 1 1
MIRT041674 TBX1 T-box 1 1 1
MIRT041675 CDC34 cell division cycle 34 homolog (S. cerevisiae) 1 1
MIRT041676 CDS2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 1 1
MIRT041677 TMEM184B transmembrane protein 184B 1 1
MIRT041678 PHB prohibitin 1 1
MIRT041679 STIP1 stress-induced-phosphoprotein 1 1 1
MIRT041680 DVL2 dishevelled, dsh homolog 2 (Drosophila) 1 1
MIRT041681 AMMECR1L AMME chromosomal region gene 1-like 1 1
MIRT041682 CAPZB capping protein (actin filament) muscle Z-line, beta 1 1
MIRT041683 PI4KA phosphatidylinositol 4-kinase, catalytic, alpha 1 1
MIRT041684 C5orf51 chromosome 5 open reading frame 51 1 1
MIRT041685 CUTA cutA divalent cation tolerance homolog (E. coli) 1 1
MIRT041686 TXLNA taxilin alpha 1 1
MIRT041687 FAM188B family with sequence similarity 188, member B 1 1
MIRT041688 FBXW2 F-box and WD repeat domain containing 2 1 1
MIRT041689 MFSD12 chromosome 19 open reading frame 28 1 1
MIRT041690 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like 1 1
MIRT041691 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT041692 RUNX2 runt-related transcription factor 2 1 1
MIRT041693 RAB36 RAB36, member RAS oncogene family 1 1
MIRT041694 MRPL3 mitochondrial ribosomal protein L3 1 1
MIRT041695 CLTC clathrin, heavy chain (Hc) 1 1
MIRT041696 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT041697 ACADS acyl-CoA dehydrogenase, C-2 to C-3 short chain 1 1
MIRT041698 RPLP2 ribosomal protein, large, P2 1 1
MIRT041699 TMOD2 tropomodulin 2 (neuronal) 1 1
MIRT041700 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT041701 PLOD1 procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1 1 1
MIRT041702 HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 1 1
MIRT041703 TFAM transcription factor A, mitochondrial 1 1
MIRT041704 ND6 NADH dehydrogenase, subunit 6 (complex I) 1 1
MIRT041705 BTG1 B-cell translocation gene 1, anti-proliferative 1 1
MIRT041706 LUC7L3 LUC7-like 3 (S. cerevisiae) 1 1
MIRT041707 SAV1 salvador homolog 1 (Drosophila) 1 1
MIRT041708 SCAP SREBF chaperone 1 1
MIRT041709 CBX6 chromobox homolog 6 1 1
MIRT041710 AGL amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase 1 1
MIRT041711 TRIM28 tripartite motif-containing 28 1 1
MIRT041712 DCTN3 dynactin 3 (p22) 1 1
MIRT041713 CLN8 ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation) 1 1
MIRT041714 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT041715 METTL2B methyltransferase like 2B 1 1
MIRT041716 EXOSC10 exosome component 10 1 1
MIRT041717 FBRS fibrosin 1 1
MIRT041718 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT041719 GNB2 guanine nucleotide binding protein (G protein), beta polypeptide 2 1 1
MIRT041720 HLA-C major histocompatibility complex, class I, C 1 1
MIRT041721 SLC43A1 solute carrier family 43, member 1 1 1
MIRT041722 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT041723 RTN3 reticulon 3 1 1
MIRT041724 CAMLG calcium modulating ligand 1 1
MIRT041725 NRIP2 nuclear receptor interacting protein 2 1 1
MIRT041726 HMGXB3 HMG box domain containing 3 1 1
MIRT041727 LAMP1 lysosomal-associated membrane protein 1 1 1
MIRT041728 BIRC5 baculoviral IAP repeat-containing 5 1 1
MIRT041729 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 1
MIRT041730 CD2AP CD2-associated protein 1 1
MIRT041731 MBOAT7 membrane bound O-acyltransferase domain containing 7 1 1
MIRT041732 EXOSC2 exosome component 2 1 1
MIRT041733 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT041734 TBC1D22A TBC1 domain family, member 22A 1 1
MIRT041735 FAM160B2 family with sequence similarity 160, member B2 1 1
MIRT041736 AXIN1 axin 1 1 1
MIRT041737 TSPAN3 tetraspanin 3 1 1
MIRT041738 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 1 1
MIRT041739 SEPHS2 selenophosphate synthetase 2 1 1
MIRT041740 PSMC5 proteasome (prosome, macropain) 26S subunit, ATPase, 5 1 1
MIRT041741 TMEM170B transmembrane protein 170B 1 1
MIRT041742 CNIH4 cornichon homolog 4 (Drosophila) 1 1
MIRT041743 FLII flightless I homolog (Drosophila) 1 1
MIRT041744 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT041745 DSTN destrin (actin depolymerizing factor) 1 1
MIRT041746 MRPL46 mitochondrial ribosomal protein L46 1 1
MIRT041747 NADK2 chromosome 5 open reading frame 33 1 1
MIRT041748 UBAC2 UBA domain containing 2 1 1
MIRT041749 GOLGA3 golgin A3 1 1
MIRT041750 POLG polymerase (DNA directed), gamma 1 1
MIRT041751 NCAPH non-SMC condensin I complex, subunit H 1 1
MIRT041752 H1F0 H1 histone family, member 0 1 1
MIRT041753 KANSL3 KIAA1310 1 1
MIRT041754 FAF1 Fas (TNFRSF6) associated factor 1 1 1
MIRT041755 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 1
MIRT041756 RPLP0 ribosomal protein, large, P0 1 1
MIRT041757 TARS2 threonyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT041758 DCLRE1B DNA cross-link repair 1B (PSO2 homolog, S. cerevisiae) 1 1
MIRT041759 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT041760 ENO1 enolase 1, (alpha) 1 1
MIRT041761 LETM1 leucine zipper-EF-hand containing transmembrane protein 1 1 1
MIRT041762 HECTD3 HECT domain containing 3 1 1
MIRT041763 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT041764 SNRPD2 small nuclear ribonucleoprotein D2 polypeptide 16.5kDa 1 1
MIRT041765 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT041766 FARSA phenylalanyl-tRNA synthetase, alpha subunit 1 1
MIRT041767 TCEB2 transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) 1 1
MIRT041768 FAM129B family with sequence similarity 129, member B 1 1
MIRT041769 CPSF7 cleavage and polyadenylation specific factor 7, 59kDa 1 1
MIRT041770 UBQLN2 ubiquilin 2 1 1
MIRT041771 GTF2B general transcription factor IIB 1 1
MIRT041772 NONO non-POU domain containing, octamer-binding 1 1
MIRT041773 AUNIP chromosome 1 open reading frame 135 1 1
MIRT041774 ANKRD54 ankyrin repeat domain 54 1 1
MIRT041775 ZNF121 zinc finger protein 121 1 1
MIRT041776 CCNK cyclin K 1 1
MIRT041777 UBL7 ubiquitin-like 7 (bone marrow stromal cell-derived) 1 1
MIRT041778 TMEM50A transmembrane protein 50A 1 1
MIRT041779 AHDC1 AT hook, DNA binding motif, containing 1 1 1
MIRT041780 RAD51B RAD51-like 1 (S. cerevisiae) 1 1
MIRT041781 DHX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 1 1
MIRT041782 PTBP3 ROD1 regulator of differentiation 1 (S. pombe) 1 1
MIRT041783 CLEC16A C-type lectin domain family 16, member A 1 1
MIRT041784 EIF4B eukaryotic translation initiation factor 4B 1 1
MIRT041785 TKT transketolase 1 1
MIRT041786 IPO5 importin 5 1 1
MIRT041787 MRPS18B mitochondrial ribosomal protein S18B 1 1
MIRT041788 UBQLN4 ubiquilin 4 1 1
MIRT041789 RNF10 ring finger protein 10 1 1
MIRT041790 EMD emerin 1 1
MIRT041791 CCDC47 coiled-coil domain containing 47 1 1
MIRT041792 KDM5C lysine (K)-specific demethylase 5C 1 1
MIRT041793 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT041794 JMJD6 jumonji domain containing 6 1 1
MIRT041795 HCLS1 hematopoietic cell-specific Lyn substrate 1 1 1
MIRT041796 SEC11A SEC11 homolog A (S. cerevisiae) 1 1
MIRT041797 MLH3 mutL homolog 3 (E. coli) 1 1
MIRT041798 CWC22 CWC22 spliceosome-associated protein homolog (S. cerevisiae) 1 1
MIRT041799 HIST1H4D histone cluster 1, H4d 1 1
MIRT041800 SLC38A1 solute carrier family 38, member 1 1 1
MIRT041801 RNF115 ring finger protein 115 1 1
MIRT041802 TCF19 transcription factor 19 1 1
MIRT041803 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT041804 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 1
MIRT041805 PSMD8 proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 1 1
MIRT041806 HIVEP2 human immunodeficiency virus type I enhancer binding protein 2 1 1
MIRT041807 PHF16 PHD finger protein 16 1 1
MIRT041808 SLC2A1 solute carrier family 2 (facilitated glucose transporter), member 1 1 1
MIRT041809 PSMG1 proteasome (prosome, macropain) assembly chaperone 1 1 1
MIRT041810 ECHDC2 enoyl CoA hydratase domain containing 2 1 1
MIRT041811 NHLRC2 NHL repeat containing 2 1 1
MIRT041812 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT041813 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 1 1
MIRT041814 PRKCD protein kinase C, delta 1 1
MIRT041815 PDLIM2 PDZ and LIM domain 2 (mystique) 1 1
MIRT041816 PDXK pyridoxal (pyridoxine, vitamin B6) kinase 1 1
MIRT041817 GOLM1 golgi membrane protein 1 1 1
MIRT041818 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT041819 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT041820 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT041821 YY1 YY1 transcription factor 1 1
MIRT041822 TMEM131 transmembrane protein 131 1 1
MIRT041823 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT041824 GANAB glucosidase, alpha; neutral AB 1 1
MIRT041825 UTP14C UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) 1 1
MIRT041826 THOP1 thimet oligopeptidase 1 1 1
MIRT041827 KPNB1 karyopherin (importin) beta 1 1 1
MIRT041828 FIZ1 FLT3-interacting zinc finger 1 1 1
MIRT041829 NOL7 nucleolar protein 7, 27kDa 1 1
MIRT041830 NCOA4 nuclear receptor coactivator 4 1 1
MIRT041831 PRPF31 PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae) 1 1
MIRT041832 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT041833 EMC8 COX4 neighbor 1 1
MIRT041834 RBM39 RNA binding motif protein 39 1 1
MIRT041835 KNTC1 kinetochore associated 1 1 1
MIRT041836 LBR lamin B receptor 1 1
MIRT041837 PRRC2A HLA-B associated transcript 2 1 1
MIRT041838 TIMELESS timeless homolog (Drosophila) 1 1
MIRT041839 RNF14 ring finger protein 14 1 1
MIRT041840 RRS1 RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) 1 1
MIRT041841 RER1 RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) 1 1
MIRT041842 CFL1 cofilin 1 (non-muscle) 1 1
MIRT041843 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT041844 FASN fatty acid synthase 1 1
MIRT041845 MEIS1 Meis homeobox 1 1 1
MIRT041846 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 1 1
MIRT041847 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 1 1
MIRT041848 H2AFV H2A histone family, member V 1 1
MIRT041849 TRIM44 tripartite motif-containing 44 1 1
MIRT041850 FLOT1 flotillin 1 1 1
MIRT041851 CCDC136 coiled-coil domain containing 136 1 1
MIRT041852 GNL2 guanine nucleotide binding protein-like 2 (nucleolar) 1 1
MIRT041853 SET SET nuclear oncogene 1 1
MIRT041854 ZNF202 zinc finger protein 202 1 1
MIRT041855 ENKD1 chromosome 16 open reading frame 48 1 1
MIRT041856 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT041857 BRAT1 chromosome 7 open reading frame 27 1 1
MIRT041858 SAP18 Sin3A-associated protein, 18kDa 1 1
MIRT041859 MDN1 MDN1, midasin homolog (yeast) 1 1
MIRT041860 YBX1 Y box binding protein 1 1 1
MIRT041861 DCBLD1 discoidin, CUB and LCCL domain containing 1 1 1
MIRT041862 AARS2 alanyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT041863 MLLT1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 1 1
MIRT041864 PRDX1 peroxiredoxin 1 1 1
MIRT041865 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT041866 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT041867 ATP5J ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 1 1
MIRT041868 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT041869 REXO1 REX1, RNA exonuclease 1 homolog (S. cerevisiae) 1 1
MIRT041870 ACTA2 actin, alpha 2, smooth muscle, aorta 1 1
MIRT041871 HMGN1 high-mobility group nucleosome binding domain 1 1 1
MIRT041872 PRDX4 peroxiredoxin 4 1 1
MIRT041873 NOMO3 NODAL modulator 3 1 1
MIRT041874 ITGA9 integrin, alpha 9 1 1
MIRT041875 DDX41 DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 1 1
MIRT041876 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT041877 PEG10 paternally expressed 10 1 1
MIRT041878 DGCR6L DiGeorge syndrome critical region gene 6-like 1 1
MIRT041879 ORC6 origin recognition complex, subunit 6 like (yeast) 1 1
MIRT041880 TEX261 testis expressed 261 1 1
MIRT041881 AKAP7 A kinase (PRKA) anchor protein 7 1 1
MIRT041882 PDE12 phosphodiesterase 12 1 1
MIRT041883 HCFC1 host cell factor C1 (VP16-accessory protein) 1 1
MIRT041884 GPBP1 GC-rich promoter binding protein 1 1 1
MIRT041885 HK2 hexokinase 2 1 1
MIRT041886 GNL1 guanine nucleotide binding protein-like 1 1 1
MIRT041887 SH2B1 SH2B adaptor protein 1 1 1
MIRT041888 ADAM10 ADAM metallopeptidase domain 10 1 1
MIRT041889 WDR26 WD repeat domain 26 1 1
MIRT041890 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT041891 ADA adenosine deaminase 1 1
MIRT041892 DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 1 1
MIRT041893 GREB1L growth regulation by estrogen in breast cancer-like 1 1
MIRT041894 NASP nuclear autoantigenic sperm protein (histone-binding) 1 1
MIRT041895 MYO10 myosin X 1 1
MIRT041896 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT041897 NDST1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 1 1
MIRT041898 AP1B1 adaptor-related protein complex 1, beta 1 subunit 1 1
MIRT041899 PPM1A protein phosphatase, Mg2+/Mn2+ dependent, 1A 1 1
MIRT041900 KIAA1109 KIAA1109 1 1
MIRT041901 TMEM243 chromosome 7 open reading frame 23 1 1
MIRT041902 RPL27A ribosomal protein L27a 1 1
MIRT041903 MRPS24 mitochondrial ribosomal protein S24 1 1
MIRT041904 MCUR1 coiled-coil domain containing 90A 1 1
MIRT041905 TIPIN TIMELESS interacting protein 1 1
MIRT041906 GTPBP1 GTP binding protein 1 1 1
MIRT041907 KIF1C kinesin family member 1C 1 1
MIRT041908 MTIF2 mitochondrial translational initiation factor 2 1 1
MIRT041909 ABHD2 abhydrolase domain containing 2 1 1
MIRT041910 M6PR mannose-6-phosphate receptor (cation dependent) 1 1
MIRT041911 SPAG9 sperm associated antigen 9 1 1
MIRT041912 POLR3K polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa 1 1
MIRT041913 EXOC6B exocyst complex component 6B 1 1
MIRT041914 MLX MAX-like protein X 1 1
MIRT041915 HNRNPH2 protein-coding 1 1
MIRT041916 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 1
MIRT041917 BCAT2 branched chain amino-acid transaminase 2, mitochondrial 1 1
MIRT041918 CAP1 CAP, adenylate cyclase-associated protein 1 (yeast) 1 1
MIRT041919 AKT1S1 AKT1 substrate 1 (proline-rich) 1 1
MIRT041920 PARP1 poly (ADP-ribose) polymerase 1 1 1
MIRT041921 COPS3 COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) 1 1
MIRT041922 ZFR zinc finger RNA binding protein 1 1
MIRT041923 RPS14 ribosomal protein S14 1 1
MIRT041924 ZBTB45 zinc finger and BTB domain containing 45 1 1
MIRT041925 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT041926 REXO4 REX4, RNA exonuclease 4 homolog (S. cerevisiae) 1 1
MIRT041927 EZH2 enhancer of zeste homolog 2 (Drosophila) 1 1
MIRT041928 SF3B2 splicing factor 3b, subunit 2, 145kDa 1 1
MIRT041929 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT041930 RFTN1 raftlin, lipid raft linker 1 1 1
MIRT041931 TNK2 tyrosine kinase, non-receptor, 2 1 1
MIRT041932 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT041933 CDCA7L cell division cycle associated 7-like 1 1
MIRT041934 PLXNA1 plexin A1 1 1
MIRT041935 RPS27L ribosomal protein S27-like 1 1
MIRT041936 ADAR adenosine deaminase, RNA-specific 1 1
MIRT041937 HOXA11 homeobox A11 1 1
MIRT041938 RPL5 ribosomal protein L5 1 1
MIRT041939 STRN striatin, calmodulin binding protein 1 1
MIRT041940 MAF1 MAF1 homolog (S. cerevisiae) 1 1
MIRT041941 UBA52 ubiquitin A-52 residue ribosomal protein fusion product 1 1 1
MIRT041942 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT041943 SRF serum response factor (c-fos serum response element-binding transcription factor) 1 1
MIRT041944 RFWD3 ring finger and WD repeat domain 3 1 1
MIRT041945 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT041946 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT041947 PHKB phosphorylase kinase, beta 1 1
MIRT041948 GRIPAP1 GRIP1 associated protein 1 1 1
MIRT041949 CHCHD2 coiled-coil-helix-coiled-coil-helix domain containing 2 1 1
MIRT041950 MYSM1 Myb-like, SWIRM and MPN domains 1 1 1
MIRT041951 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT041952 AARS alanyl-tRNA synthetase 1 1
MIRT041953 NDUFV1 NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa 1 1
MIRT041954 CYSTM1 chromosome 5 open reading frame 32 1 1
MIRT041955 HYOU1 hypoxia up-regulated 1 1 1
MIRT041956 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 1
MIRT041957 GLUL glutamate-ammonia ligase 1 1
MIRT041958 PSMC2 proteasome (prosome, macropain) 26S subunit, ATPase, 2 1 1
MIRT041959 C1QBP complement component 1, q subcomponent binding protein 1 1
MIRT041960 WDR4 WD repeat domain 4 1 1
MIRT041961 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT041962 TUBB tubulin, beta 1 1
MIRT041963 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT041964 TCEB3 transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A) 1 1
MIRT041965 AP2M1 adaptor-related protein complex 2, mu 1 subunit 1 1
MIRT041966 GEMIN4 gem (nuclear organelle) associated protein 4 1 1
MIRT041967 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT041968 USP40 ubiquitin specific peptidase 40 1 1
MIRT041969 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT041970 DHX38 DEAH (Asp-Glu-Ala-His) box polypeptide 38 1 1
MIRT041971 NEO1 neogenin homolog 1 (chicken) 1 1
MIRT041972 MFN2 mitofusin 2 1 1
MIRT041973 NCOR1 nuclear receptor corepressor 1 1 1
MIRT041974 TBC1D15 TBC1 domain family, member 15 1 1
MIRT041975 SCYL1 SCY1-like 1 (S. cerevisiae) 1 1
MIRT041976 MTG1 mitochondrial GTPase 1 homolog (S. cerevisiae) 1 1
MIRT041977 MCM5 minichromosome maintenance complex component 5 1 1
MIRT041978 TULP4 tubby like protein 4 1 1
MIRT041979 TIMM50 translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) 1 1
MIRT041980 RRM2 ribonucleotide reductase M2 1 1
MIRT041981 SURF2 surfeit 2 1 1
MIRT041982 RNF167 ring finger protein 167 1 1
MIRT041983 ADRA1A adrenergic, alpha-1A-, receptor 1 1
MIRT041984 PPM1G protein phosphatase, Mg2+/Mn2+ dependent, 1G 1 1
MIRT041985 SPHK1 sphingosine kinase 1 1 1
MIRT041986 APLP1 amyloid beta (A4) precursor-like protein 1 1 1
MIRT041987 CCNT2 cyclin T2 1 1
MIRT041988 SEPHS1 selenophosphate synthetase 1 1 1
MIRT041989 SESN2 sestrin 2 1 1
MIRT041990 IRS2 insulin receptor substrate 2 1 1
MIRT041991 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 1 1
MIRT041992 MDM2 Mdm2 p53 binding protein homolog (mouse) 1 1
MIRT041993 CBX5 chromobox homolog 5 (HP1 alpha homolog, Drosophila) 1 1
MIRT041994 CRTAP cartilage associated protein 1 1
MIRT041995 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 1 1
MIRT041996 GPATCH4 G patch domain containing 4 1 1
MIRT041997 CECR2 cat eye syndrome chromosome region, candidate 2 1 1
MIRT041998 CAMK2D calcium/calmodulin-dependent protein kinase II delta 1 1
MIRT041999 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT042000 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 1 1
MIRT042001 AGK acylglycerol kinase 1 1
MIRT042002 MCM7 minichromosome maintenance complex component 7 1 1
MIRT042003 BRI3 brain protein I3 1 1
MIRT042004 PRR14L chromosome 22 open reading frame 30 1 1
MIRT042005 CBR1 carbonyl reductase 1 1 1
MIRT042006 NDUFA13 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 1 1
MIRT042007 CLUH KIAA0664 1 1
MIRT042008 WDR5 WD repeat domain 5 1 1
MIRT042009 ALKBH5 alkB, alkylation repair homolog 5 (E. coli) 1 1
MIRT042010 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT042011 FLNB filamin B, beta 1 1
MIRT042012 PRADC1 chromosome 2 open reading frame 7 1 1
MIRT042013 CHTF18 CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae) 1 1
MIRT042014 FUZ fuzzy homolog (Drosophila) 1 1
MIRT042015 NMD3 NMD3 homolog (S. cerevisiae) 1 1
MIRT042016 PURA purine-rich element binding protein A 1 1
MIRT042017 SKAP2 src kinase associated phosphoprotein 2 1 1
MIRT042018 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT042019 MYO9B myosin IXB 1 1
MIRT042020 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT042021 RGP1 RGP1 retrograde golgi transport homolog (S. cerevisiae) 1 1
MIRT042022 DST dystonin 1 1
MIRT042023 ZFX zinc finger protein, X-linked 1 1
MIRT042024 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT042025 FBXL18 F-box and leucine-rich repeat protein 18 1 1
MIRT042026 SLK STE20-like kinase (yeast) 1 1
MIRT042027 RCC2 regulator of chromosome condensation 2 1 1
MIRT042028 SQSTM1 sequestosome 1 1 1
MIRT042029 TIMM23 translocase of inner mitochondrial membrane 23 homolog (yeast) 1 1
MIRT042030 ZZEF1 zinc finger, ZZ-type with EF-hand domain 1 1 1
MIRT042031 XRCC5 X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining) 1 1
MIRT042032 DIMT1 DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) 1 1
MIRT042033 GTF2I general transcription factor IIi 1 1
MIRT042034 AMOTL1 angiomotin like 1 1 1
MIRT042035 TAOK2 TAO kinase 2 1 1
MIRT042036 ASXL1 additional sex combs like 1 (Drosophila) 1 1
MIRT042037 ARMC6 armadillo repeat containing 6 1 1
MIRT042038 WBSCR22 Williams Beuren syndrome chromosome region 22 1 1
MIRT042039 DNAJA3 DnaJ (Hsp40) homolog, subfamily A, member 3 1 1
MIRT042040 DZANK1 chromosome 20 open reading frame 12 1 1
MIRT042041 PRMT7 protein arginine methyltransferase 7 1 1
MIRT042042 TUBA1B tubulin, alpha 1b 1 1
MIRT042043 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT042044 ATN1 atrophin 1 1 1
MIRT042045 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT042046 NUDC nuclear distribution gene C homolog (A. nidulans) 1 1
MIRT042047 CCDC97 coiled-coil domain containing 97 1 1
MIRT042048 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 1
MIRT042049 EIF5B eukaryotic translation initiation factor 5B 1 1
MIRT042050 DDX28 DEAD (Asp-Glu-Ala-Asp) box polypeptide 28 1 1
MIRT042051 ADCK2 aarF domain containing kinase 2 1 1
MIRT042052 RING1 ring finger protein 1 1 1
MIRT042053 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT042054 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT042055 C12orf10 chromosome 12 open reading frame 10 1 1
MIRT042056 GHITM growth hormone inducible transmembrane protein 1 1
MIRT042057 ZNF664 zinc finger protein 664 1 1
MIRT042058 ZNF226 zinc finger protein 226 1 1
MIRT042059 FLNA filamin A, alpha 1 1
MIRT042060 AUP1 ancient ubiquitous protein 1 1 1
MIRT042061 VPRBP Vpr (HIV-1) binding protein 1 1
MIRT042062 RRAGD Ras-related GTP binding D 1 1
MIRT042063 HDLBP high density lipoprotein binding protein 1 1
MIRT042064 ANXA11 annexin A11 1 1
MIRT042065 KARS lysyl-tRNA synthetase 1 1
MIRT042066 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT042067 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT042068 CTPS1 CTP synthase 1 1
MIRT042069 ACLY ATP citrate lyase 1 1
MIRT042070 BCL2L1 BCL2-like 1 1 1
MIRT042071 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT042072 SETD6 SET domain containing 6 1 1
MIRT042073 PMM2 phosphomannomutase 2 1 1
MIRT042074 GNS glucosamine (N-acetyl)-6-sulfatase 1 1
MIRT042075 DHX40 DEAH (Asp-Glu-Ala-His) box polypeptide 40 1 1
MIRT042076 DCTN4 dynactin 4 (p62) 1 1
MIRT042077 TMED9 transmembrane emp24 protein transport domain containing 9 1 1
MIRT042078 RIOK2 RIO kinase 2 (yeast) 1 1
MIRT042079 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT042080 RNASEH1 ribonuclease H1 1 1
MIRT042081 MYO5A myosin VA (heavy chain 12, myoxin) 1 1
MIRT042082 ECE1 endothelin converting enzyme 1 1 1
MIRT042083 SLC4A2 solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1) 1 1
MIRT042084 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT042085 CLDN7 claudin 7 1 1
MIRT042086 SPIRE1 spire homolog 1 (Drosophila) 1 1
MIRT042087 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 1
MIRT042088 SDF4 stromal cell derived factor 4 1 1
MIRT042089 NUCB1 nucleobindin 1 1 1
MIRT042090 COX3 cytochrome c oxidase III 1 1
MIRT042091 DNAJB2 DnaJ (Hsp40) homolog, subfamily B, member 2 1 1
MIRT042092 STT3A STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) 1 1
MIRT042093 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT042094 SETD1B SET domain containing 1B 1 1
MIRT042095 RPS23 ribosomal protein S23 1 1
MIRT042096 PLD6 phospholipase D family, member 6 1 1
MIRT042097 UTRN utrophin 1 1
MIRT042098 ABCD4 ATP-binding cassette, sub-family D (ALD), member 4 1 1
MIRT042099 RC3H2 ring finger and CCCH-type zinc finger domains 2 1 1
MIRT042100 BLOC1S6 pallidin homolog (mouse) 1 1
MIRT042101 CASP7 caspase 7, apoptosis-related cysteine peptidase 1 1
MIRT042102 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT042103 DIP2A DIP2 disco-interacting protein 2 homolog A (Drosophila) 1 1
MIRT042104 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT042105 GRIA4 glutamate receptor, ionotrophic, AMPA 4 1 1
MIRT042106 RAB3IP RAB3A interacting protein (rabin3) 1 1
MIRT042107 GTF3C3 general transcription factor IIIC, polypeptide 3, 102kDa 1 1
MIRT042108 NCS1 neuronal calcium sensor 1 1 1
MIRT042109 LRRC20 leucine rich repeat containing 20 1 1
MIRT042110 RCE1 RCE1 homolog, prenyl protein peptidase (S. cerevisiae) 1 1
MIRT042111 GTF2H4 general transcription factor IIH, polypeptide 4, 52kDa 1 1
MIRT042112 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT042113 RBM42 RNA binding motif protein 42 1 1
MIRT042114 MAN2A2 mannosidase, alpha, class 2A, member 2 1 1
MIRT042115 PHF23 PHD finger protein 23 1 1
MIRT042116 ZC3H7B zinc finger CCCH-type containing 7B 1 1
MIRT042117 HIST1H3H histone cluster 1, H3h 1 1
MIRT042118 BRCA1 breast cancer 1, early onset 1 1
MIRT042119 CERS5 LAG1 homolog, ceramide synthase 5 1 1
MIRT042120 H2AFX H2A histone family, member X 1 1
MIRT042121 EHMT1 euchromatic histone-lysine N-methyltransferase 1 1 1
MIRT042122 ANAPC1 anaphase promoting complex subunit 1 1 1
MIRT042123 FGFBP3 fibroblast growth factor binding protein 3 1 1
MIRT042124 POM121 POM121 membrane glycoprotein (rat) 1 1
MIRT042125 TPST2 tyrosylprotein sulfotransferase 2 1 1
MIRT042126 UBE2S ubiquitin-conjugating enzyme E2S 1 1
MIRT042127 RAB11FIP3 RAB11 family interacting protein 3 (class II) 1 1
MIRT042128 TTYH3 tweety homolog 3 (Drosophila) 1 1
MIRT042129 ATXN7L3B ataxin 7-like 3B 1 1
MIRT042130 FAM117A family with sequence similarity 117, member A 1 1
MIRT042131 CKAP5 cytoskeleton associated protein 5 1 1
MIRT042132 MED15 mediator complex subunit 15 1 1
MIRT042133 CDX2 caudal type homeobox 2 1 1
MIRT042134 BMS1 BMS1 homolog, ribosome assembly protein (yeast) 1 1
MIRT042135 ZNF792 zinc finger protein 792 1 1
MIRT042136 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 1 1
MIRT042137 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 1
MIRT042138 GART phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase 1 1
MIRT042139 CNFN cornifelin 1 1
MIRT042140 SP3 Sp3 transcription factor 1 1
MIRT042141 SMAD2 SMAD family member 2 1 1
MIRT042142 BACE2 beta-site APP-cleaving enzyme 2 1 1
MIRT042143 IRS4 insulin receptor substrate 4 1 1
MIRT042144 ZMAT5 zinc finger, matrin type 5 1 1
MIRT042145 RBMS2 RNA binding motif, single stranded interacting protein 2 1 1
MIRT042146 MGAT4B mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B 1 1
MIRT042147 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT042148 RNF111 ring finger protein 111 1 1
MIRT042149 AP3D1 adaptor-related protein complex 3, delta 1 subunit 1 1
MIRT042150 AKAP13 A kinase (PRKA) anchor protein 13 1 1
MIRT042151 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 1 1
MIRT042152 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT042153 ENOPH1 enolase-phosphatase 1 1 1
MIRT042154 UBAP2L ubiquitin associated protein 2-like 1 1
MIRT042155 DGKA diacylglycerol kinase, alpha 80kDa 1 1
MIRT042156 WAC WW domain containing adaptor with coiled-coil 1 1
MIRT042157 ZNF322 zinc finger protein 322A 1 1
MIRT042158 TSPAN6 tetraspanin 6 1 1
MIRT042159 N4BP2L2 NEDD4 binding protein 2-like 2 1 1
MIRT042160 P4HB prolyl 4-hydroxylase, beta polypeptide 1 1
MIRT042161 JAG2 jagged 2 1 1
MIRT042162 BRD2 bromodomain containing 2 1 1
MIRT042163 PPP1R26 KIAA0649 1 1
MIRT042164 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT042165 ELOVL1 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 1 1
MIRT042166 MARS methionyl-tRNA synthetase 1 1
MIRT042167 CAPRIN1 cell cycle associated protein 1 1 1
MIRT042168 NSFL1C NSFL1 (p97) cofactor (p47) 1 1
MIRT042169 CEP250 centrosomal protein 250kDa 1 1
MIRT042170 VAPB VAMP (vesicle-associated membrane protein)-associated protein B and C 1 1
MIRT042171 PYGB phosphorylase, glycogen; brain 1 1
MIRT042172 CD2BP2 CD2 (cytoplasmic tail) binding protein 2 1 1
MIRT042173 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT042174 ITGA5 integrin, alpha 5 (fibronectin receptor, alpha polypeptide) 1 1
MIRT042175 KLC2 kinesin light chain 2 1 1
MIRT042176 TUBGCP4 tubulin, gamma complex associated protein 4 1 1
MIRT042177 STMN1 stathmin 1 1 1
MIRT042178 DLG5 discs, large homolog 5 (Drosophila) 1 1
MIRT042179 IMPA2 inositol(myo)-1(or 4)-monophosphatase 2 1 1
MIRT042180 RPL21 ribosomal protein L21 1 1
MIRT042181 TEP1 telomerase-associated protein 1 1 1
MIRT042182 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT042183 TMEM98 transmembrane protein 98 1 1
MIRT042184 SRPR signal recognition particle receptor (docking protein) 1 1
MIRT042185 TET2 tet oncogene family member 2 1 1
MIRT042186 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT042187 HIC2 hypermethylated in cancer 2 1 1
MIRT042188 GLTP glycolipid transfer protein 1 1
MIRT042189 ASCC2 activating signal cointegrator 1 complex subunit 2 1 1
MIRT042190 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT042191 UBQLN1 ubiquilin 1 1 1
MIRT042192 NOC2L nucleolar complex associated 2 homolog (S. cerevisiae) 1 1
MIRT042193 STK10 serine/threonine kinase 10 1 1
MIRT042194 NOTCH3 Notch homolog 3 (Drosophila) 1 1
MIRT042195 PGD phosphogluconate dehydrogenase 1 1
MIRT042196 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT042197 UCP2 uncoupling protein 2 (mitochondrial, proton carrier) 1 1
MIRT042198 ALAS1 aminolevulinate, delta-, synthase 1 1 1
MIRT042199 PPP2R5A protein phosphatase 2, regulatory subunit B', alpha 1 1
MIRT042200 GIT1 G protein-coupled receptor kinase interacting ArfGAP 1 1 1
MIRT042201 DGAT1 diacylglycerol O-acyltransferase homolog 1 (mouse) 1 1
MIRT042202 MAP4 microtubule-associated protein 4 1 1
MIRT042203 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT042204 TOMM40 translocase of outer mitochondrial membrane 40 homolog (yeast) 1 1
MIRT042205 RNMTL1 RNA methyltransferase like 1 1 1
MIRT042206 RPL28 ribosomal protein L28 1 1
MIRT042207 ZSCAN25 zinc finger protein 498 1 1
MIRT042208 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT042209 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1
MIRT042210 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT042211 SMC4 structural maintenance of chromosomes 4 1 1
MIRT042212 CCDC94 coiled-coil domain containing 94 1 1
MIRT042213 RXRB retinoid X receptor, beta 1 1
MIRT042214 PRRC2B HLA-B associated transcript 2-like 1 1 1
MIRT042215 USP30 ubiquitin specific peptidase 30 1 1
MIRT042216 CUL5 cullin 5 1 1
MIRT042217 BEND3 BEN domain containing 3 1 1
MIRT042218 ASNA1 arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) 1 1
MIRT042219 BRD4 bromodomain containing 4 1 1
MIRT042220 NME4 non-metastatic cells 4, protein expressed in 1 1
MIRT042221 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT042222 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 1
MIRT042223 CHAF1B chromatin assembly factor 1, subunit B (p60) 1 1
MIRT042224 ADCK3 chaperone, ABC1 activity of bc1 complex homolog (S. pombe) 1 1
MIRT042225 ATP11A ATPase, class VI, type 11A 1 1
MIRT042226 TROAP trophinin associated protein (tastin) 1 1
MIRT042227 INTS5 integrator complex subunit 5 1 1
MIRT042228 MCM3AP minichromosome maintenance complex component 3 associated protein 1 1
MIRT042229 BLMH bleomycin hydrolase 1 1
MIRT042230 TOP1 topoisomerase (DNA) I 1 1
MIRT042231 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT042232 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT042233 PRPS1 phosphoribosyl pyrophosphate synthetase 1 1 1
MIRT042234 FAM129A family with sequence similarity 129, member A 1 1
MIRT042235 TNKS1BP1 tankyrase 1 binding protein 1, 182kDa 1 1
MIRT042236 GFOD1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT042237 TRAF7 TNF receptor-associated factor 7 1 1
MIRT042238 CHSY3 chondroitin sulfate synthase 3 1 1
MIRT042239 PSMC3IP PSMC3 interacting protein 1 1
MIRT042240 FURIN furin (paired basic amino acid cleaving enzyme) 1 1
MIRT042241 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 1
MIRT042242 COG1 component of oligomeric golgi complex 1 1 1
MIRT042243 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT042244 COX5A cytochrome c oxidase subunit Va 1 1
MIRT042245 UBA2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT042246 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 1 1
MIRT042247 EFNB3 ephrin-B3 1 1
MIRT042248 MPP2 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) 1 1
MIRT042249 ST3GAL2 ST3 beta-galactoside alpha-2,3-sialyltransferase 2 1 1
MIRT042250 ABL1 c-abl oncogene 1, receptor tyrosine kinase 1 1
MIRT042251 HARS2 histidyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT042252 TMBIM6 transmembrane BAX inhibitor motif containing 6 1 1
MIRT042253 INO80B INO80 complex subunit B 1 1
MIRT042254 MSI2 musashi homolog 2 (Drosophila) 1 1
MIRT042255 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT042256 ZNF264 zinc finger protein 264 1 1
MIRT042257 SLC19A1 solute carrier family 19 (folate transporter), member 1 1 1
MIRT042258 LSM12 LSM12 homolog (S. cerevisiae) 1 1
MIRT042259 PUF60 poly-U binding splicing factor 60KDa 1 1
MIRT042260 APP amyloid beta (A4) precursor protein 1 1
MIRT042261 FEM1A fem-1 homolog a (C. elegans) 1 1
MIRT042262 SYNGR2 synaptogyrin 2 1 1
MIRT042263 CCS copper chaperone for superoxide dismutase 1 1
MIRT042264 COX8A cytochrome c oxidase subunit VIIIA (ubiquitous) 1 1
MIRT042265 TSPAN33 tetraspanin 33 1 1
MIRT042266 AIFM1 apoptosis-inducing factor, mitochondrion-associated, 1 1 1
MIRT042267 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT042268 LRCH4 leucine-rich repeats and calponin homology (CH) domain containing 4 1 1
MIRT042269 HADHA hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit 1 1
MIRT042270 LMNB1 lamin B1 1 1
MIRT042271 NPAS2 neuronal PAS domain protein 2 1 1
MIRT042272 CYFIP1 cytoplasmic FMR1 interacting protein 1 1 1
MIRT042273 CD97 CD97 molecule 1 1
MIRT042274 RPN2 ribophorin II 1 1
MIRT042275 DDX54 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 1 1
MIRT042276 HOMER1 homer homolog 1 (Drosophila) 1 1
MIRT042277 ABHD12 abhydrolase domain containing 12 1 1
MIRT042278 TSEN54 tRNA splicing endonuclease 54 homolog (S. cerevisiae) 1 1
MIRT042279 TLN1 talin 1 1 1
MIRT042280 ACPT acid phosphatase, testicular 1 1
MIRT042281 RABL6 chromosome 9 open reading frame 86 1 1
MIRT042282 ELMSAN1 chromosome 14 open reading frame 43 1 1
MIRT042283 C19orf12 chromosome 19 open reading frame 12 1 1
MIRT042284 NEK1 NIMA (never in mitosis gene a)-related kinase 1 1 1
MIRT042285 TRIP6 thyroid hormone receptor interactor 6 1 1
MIRT042286 APRT adenine phosphoribosyltransferase 1 1
MIRT042287 RPS9 ribosomal protein S9 1 1
MIRT042288 RNF5 ring finger protein 5 1 1
MIRT042289 TYMS thymidylate synthetase 1 1
MIRT042290 GTSE1 G-2 and S-phase expressed 1 1 1
MIRT042291 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT042292 NYNRIN NYN domain and retroviral integrase containing 1 1
MIRT042293 TSC22D3 TSC22 domain family, member 3 1 1
MIRT042294 DNASE1L1 deoxyribonuclease I-like 1 1 1
MIRT042295 SUGP2 splicing factor, arginine/serine-rich 14 1 1
MIRT042296 MEGF8 multiple EGF-like-domains 8 1 1
MIRT042297 TWF2 twinfilin, actin-binding protein, homolog 2 (Drosophila) 1 1
MIRT042298 XPO7 exportin 7 1 1
MIRT042299 ELAC2 elaC homolog 2 (E. coli) 1 1
MIRT042300 MAP7D1 MAP7 domain containing 1 1 1
MIRT042301 ZNF383 zinc finger protein 383 1 1
MIRT042302 EIF6 eukaryotic translation initiation factor 6 1 1
MIRT042303 PLD3 phospholipase D family, member 3 1 1
MIRT042304 SLC39A13 solute carrier family 39 (zinc transporter), member 13 1 1
MIRT042305 MKRN2 makorin ring finger protein 2 1 1
MIRT042306 TNFRSF12A tumor necrosis factor receptor superfamily, member 12A 1 1
MIRT042307 RPL36 ribosomal protein L36 1 1
MIRT042308 SALL2 sal-like 2 (Drosophila) 1 1
MIRT042309 TMEM161A transmembrane protein 161A 1 1
MIRT042310 AMER1 family with sequence similarity 123B 1 1
MIRT042311 PER1 period homolog 1 (Drosophila) 1 1
MIRT042312 MINOS1 chromosome 1 open reading frame 151 1 1
MIRT042313 PITHD1 chromosome 1 open reading frame 128 1 1
MIRT042314 PIN1 peptidylprolyl cis/trans isomerase, NIMA-interacting 1 1 1
MIRT042315 GTF2H3 general transcription factor IIH, polypeptide 3, 34kDa 1 1
MIRT042316 NABP2 oligonucleotide/oligosaccharide-binding fold containing 2B 1 1
MIRT042317 GLCE glucuronic acid epimerase 1 1
MIRT042318 MZT2B family with sequence similarity 128, member B 1 1
MIRT042319 SPECC1L cytospin A 1 1
MIRT042320 SEMA4D sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D 1 1
MIRT042321 ATL2 atlastin GTPase 2 1 1
MIRT042322 UPF3A UPF3 regulator of nonsense transcripts homolog A (yeast) 1 1
MIRT042323 ARL6IP4 ADP-ribosylation-like factor 6 interacting protein 4 1 1
MIRT042324 EIF3A eukaryotic translation initiation factor 3, subunit A 1 1
MIRT042325 TNFAIP1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 1 1
MIRT042326 DGCR2 DiGeorge syndrome critical region gene 2 1 1
MIRT042327 MAP3K10 mitogen-activated protein kinase kinase kinase 10 1 1
MIRT042328 UBE2Z ubiquitin-conjugating enzyme E2Z 1 1
MIRT042329 MED12L mediator complex subunit 12-like 1 1
MIRT042330 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT042331 POLR3H polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) 1 1
MIRT042332 SUCO chromosome 1 open reading frame 9 1 1
MIRT042333 L3MBTL2 l(3)mbt-like 2 (Drosophila) 1 1
MIRT042334 SIPA1L2 signal-induced proliferation-associated 1 like 2 1 1
MIRT042335 TNFAIP8L1 tumor necrosis factor, alpha-induced protein 8-like 1 1 1
MIRT042336 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT042337 EMC6 transmembrane protein 93 1 1
MIRT042338 DCTN5 dynactin 5 (p25) 1 1
MIRT042339 SOLH small optic lobes homolog (Drosophila) 1 1
MIRT042340 HOXC11 homeobox C11 1 1
MIRT042341 VARS valyl-tRNA synthetase 1 1
MIRT042342 LONRF2 LON peptidase N-terminal domain and ring finger 2 1 1
MIRT042343 SORD sorbitol dehydrogenase 1 1
MIRT042344 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT042345 EXOG endo/exonuclease (5'-3'), endonuclease G-like 1 1
MIRT042346 ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 1 1
MIRT042347 MSTO1 misato homolog 1 (Drosophila) 1 1
MIRT042348 ARFGEF2 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) 1 1
MIRT042349 OCRL oculocerebrorenal syndrome of Lowe 1 1
MIRT042350 CREBRF chromosome 5 open reading frame 41 1 1
MIRT042351 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT042352 USP5 ubiquitin specific peptidase 5 (isopeptidase T) 1 1
MIRT042353 ZFYVE21 zinc finger, FYVE domain containing 21 1 1
MIRT042354 CYB5R3 cytochrome b5 reductase 3 1 1
MIRT042355 ZNF48 zinc finger protein 48 1 1
MIRT042356 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT042357 PTGR2 prostaglandin reductase 2 1 1
MIRT042358 TBC1D2B TBC1 domain family, member 2B 1 1
MIRT042359 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT042360 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT042361 MTCH2 mitochondrial carrier homolog 2 (C. elegans) 1 1
MIRT042362 CTSD cathepsin D 1 1
MIRT042363 ADRM1 adhesion regulating molecule 1 1 1
MIRT042364 BBX bobby sox homolog (Drosophila) 1 1
MIRT042365 SNX11 sorting nexin 11 1 1
MIRT042366 RFX5 regulatory factor X, 5 (influences HLA class II expression) 1 1
MIRT042367 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT042368 GRPEL1 GrpE-like 1, mitochondrial (E. coli) 1 1
MIRT042369 MB21D2 chromosome 3 open reading frame 59 1 1
MIRT042370 ISM2 isthmin 2 homolog (zebrafish) 1 1
MIRT042371 TCHP trichoplein, keratin filament binding 1 1
MIRT042372 HSD17B4 hydroxysteroid (17-beta) dehydrogenase 4 1 1
MIRT042373 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT042374 SLC1A4 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 1 1
MIRT042375 DMTN erythrocyte membrane protein band 4.9 (dematin) 1 1
MIRT042376 FAR1 fatty acyl CoA reductase 1 1 1
MIRT042377 PHTF1 putative homeodomain transcription factor 1 1 1
MIRT042378 TRIM65 tripartite motif-containing 65 1 1
MIRT042379 CADM1 cell adhesion molecule 1 1 1
MIRT042380 CECR5 cat eye syndrome chromosome region, candidate 5 1 1
MIRT042381 POLDIP3 polymerase (DNA-directed), delta interacting protein 3 1 1
MIRT042382 NLE1 notchless homolog 1 (Drosophila) 1 1
MIRT042383 PFKL phosphofructokinase, liver 1 1
MIRT042384 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT042385 MAST3 microtubule associated serine/threonine kinase 3 1 1
MIRT042386 ZSWIM8 KIAA0913 1 1
MIRT042387 RNF11 ring finger protein 11 1 1
MIRT042388 LAMB2 laminin, beta 2 (laminin S) 1 1
MIRT042389 TTC36 tetratricopeptide repeat domain 36 1 1
MIRT042390 HSPBP1 HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 1 1
MIRT042391 CHMP7 CHMP family, member 7 1 1