Accession ID: MIRT042692 [miRNA, hsa-miR-196b-5p :: MSH6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-196bLinkOut: [miRBase ]
Synonyms MIRN196B, miR-196b, miRNA196B, MIR196B
Description Homo sapiens miR-196b stem-loop
Comment miR-196b is predicted based on sequence homology to miR-196a .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-196b-5p
Mature Sequence 15| UAGGUAGUUUCCUGUUGUUGGG |36
Evidence Experimental
Experiments Cloned
Putative hsa-miR-196b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MSH6 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GTBP, HNPCC5, HSAP
Description mutS homolog 6 (E. coli)
Transcript NM_000179    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MSH6 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MSH6
(miRNA target sites are highlighted)
>MSH6|NM_000179|3'UTR
   1 ACTGACTACATTGGAAGCTTTGAGTTGACTTCTGACAAAGGTGGTAAATTCAGACAACATTATGATCTAATAAACTTTAT
  81 TTTTTAAAAATGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ggguuguuguccuUUGAUGGAu 5'
                       :||||| | 
Target 5' ----------actGACTACATt 3'
1 - 12 109.00 -5.02
2
miRNA  3' ggGU-UGUUGUCCUUUGAUGGAu 5'
            || ||||||    |: |:|| 
Target 5' ttCAGACAACA--TTATGATCTa 3'
49 - 69 92.00 -8.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-196b-5p :: MSH6    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ggGTTGTTGTCCTTTGATGGat 5'
            ||:|  |||||:||||::  
Target 5' ccCAGC--CAGGAGACTATTac 3'
13 - 32
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
140 hsa-miR-196b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001042 HOXB8 homeobox B8 3 3
MIRT004638 HOXC8 homeobox C8 4 6
MIRT007146 BCL2 B-cell CLL/lymphoma 2 0 1
MIRT007284 CD8A CD8a molecule 1 1
MIRT042654 HSD17B10 hydroxysteroid (17-beta) dehydrogenase 10 1 1
MIRT042655 ATF4 activating transcription factor 4 (tax-responsive enhancer element B67) 1 1
MIRT042656 MAPRE1 microtubule-associated protein, RP/EB family, member 1 1 1
MIRT042657 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT042658 MEPCE methylphosphate capping enzyme 1 1
MIRT042659 COX3 cytochrome c oxidase III 1 1
MIRT042660 PRKACA protein kinase, cAMP-dependent, catalytic, alpha 1 1
MIRT042661 PAXBP1 GC-rich sequence DNA-binding factor 1 1 1
MIRT042662 PALD1 phosphatase domain containing, paladin 1 1 1
MIRT042663 GPS1 G protein pathway suppressor 1 1 1
MIRT042664 CHD2 chromodomain helicase DNA binding protein 2 1 1
MIRT042665 SLC6A15 solute carrier family 6 (neutral amino acid transporter), member 15 1 1
MIRT042666 PDE12 phosphodiesterase 12 1 1
MIRT042667 SLC23A2 solute carrier family 23 (nucleobase transporters), member 2 1 1
MIRT042668 TXNDC5 thioredoxin domain containing 5 (endoplasmic reticulum) 1 1
MIRT042669 BEST3 bestrophin 3 1 1
MIRT042670 ATP6 ATP synthase F0 subunit 6 1 1
MIRT042671 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT042672 HTR1D 5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled 1 1
MIRT042673 RTF1 Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT042674 CKB creatine kinase, brain 1 1
MIRT042675 MAT2A methionine adenosyltransferase II, alpha 1 1
MIRT042676 TRA2A transformer 2 alpha homolog (Drosophila) 1 1
MIRT042677 WHSC1L1 Wolf-Hirschhorn syndrome candidate 1-like 1 1 1
MIRT042678 CDK5R1 cyclin-dependent kinase 5, regulatory subunit 1 (p35) 1 1
MIRT042679 MRPS26 mitochondrial ribosomal protein S26 1 1
MIRT042680 AJUBA ajuba LIM protein 1 1
MIRT042681 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT042682 REEP5 receptor accessory protein 5 1 1
MIRT042683 LAMB2 laminin, beta 2 (laminin S) 1 1
MIRT042684 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT042685 TXLNA taxilin alpha 1 1
MIRT042686 TUBB tubulin, beta class I 1 1
MIRT042687 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT042688 MFHAS1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT042689 LHX2 LIM homeobox 2 1 1
MIRT042690 BCAR3 breast cancer anti-estrogen resistance 3 1 1
MIRT042691 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) 1 1
MIRT042692 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT042693 HERC2 HECT and RLD domain containing E3 ubiquitin protein ligase 2 1 1
MIRT042694 IARS isoleucyl-tRNA synthetase 1 1
MIRT042695 CACNB3 calcium channel, voltage-dependent, beta 3 subunit 1 1
MIRT042696 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT042697 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 1 1
MIRT042698 SNX9 sorting nexin 9 1 1
MIRT053330 HOXA9 homeobox A9 5 5
MIRT053331 MEIS1 Meis homeobox 1 4 1
MIRT053338 FAS Fas (TNF receptor superfamily, member 6) 4 1
MIRT053485 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 4 1
MIRT053586 HOXA10 homeobox A10 2 1
MIRT054026 RDX radixin 4 3
MIRT056751 ARID5B AT rich interactive domain 5B (MRF1-like) 1 1
MIRT057646 LCOR ligand dependent nuclear receptor corepressor 1 2
MIRT063826 SRP9 signal recognition particle 9kDa 1 2
MIRT066479 HMGA2 high mobility group AT-hook 2 1 3
MIRT076232 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 3
MIRT083306 ZCCHC3 zinc finger, CCHC domain containing 3 1 1
MIRT084982 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT095772 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 5
MIRT102166 SRRT serrate RNA effector molecule homolog (Arabidopsis) 1 4
MIRT168592 HMGA1 high mobility group AT-hook 1 1 2
MIRT187723 SUOX sulfite oxidase 1 1
MIRT191924 CALM1 calmodulin 1 (phosphorylase kinase, delta) 1 1
MIRT205505 SP100 SP100 nuclear antigen 1 1
MIRT206422 SLC30A6 solute carrier family 30 (zinc transporter), member 6 1 1
MIRT209859 ACVR2B activin A receptor, type IIB 1 1
MIRT229843 YIPF6 Yip1 domain family, member 6 1 1
MIRT230834 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT235379 CALM3 calmodulin 3 (phosphorylase kinase, delta) 1 1
MIRT251628 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 1 1
MIRT252336 SALL3 sal-like 3 (Drosophila) 1 1
MIRT255320 CDV3 CDV3 homolog (mouse) 1 1
MIRT264697 C11ORF57 chromosome 11 open reading frame 57 1 2
MIRT267834 PBX1 pre-B-cell leukemia homeobox 1 1 1
MIRT324737 ACER2 alkaline ceramidase 2 1 1
MIRT366071 FAM127A family with sequence similarity 127, member A 1 2
MIRT386076 ZNF609 zinc finger protein 609 1 1
MIRT402063 ATP6V1F ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F 1 2
MIRT438111 HOXB7 homeobox B7 1 1
MIRT438210 GFI1 growth factor independent 1 transcription repressor 1 1
MIRT439103 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 0 1
MIRT447142 KIF27 kinesin family member 27 1 1
MIRT447557 C14orf37 chromosome 14 open reading frame 37 1 1
MIRT449960 FMNL3 formin-like 3 1 1
MIRT465086 TSPAN3 tetraspanin 3 1 1
MIRT470427 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT470686 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 2
MIRT472725 MTUS1 microtubule associated tumor suppressor 1 1 3
MIRT473243 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 4
MIRT473800 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT474506 KLHDC8B kelch domain containing 8B 1 1
MIRT474916 KCTD21 potassium channel tetramerisation domain containing 21 1 1
MIRT479418 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 2
MIRT486548 DCTN4 dynactin 4 (p62) 1 1
MIRT492429 RGL2 ral guanine nucleotide dissociation stimulator-like 2 1 1
MIRT493924 FAM127B family with sequence similarity 127, member B 1 2
MIRT499502 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT500971 SPTSSA serine palmitoyltransferase, small subunit A 1 1
MIRT501430 RAB11FIP4 RAB11 family interacting protein 4 (class II) 1 1
MIRT502411 GATA6 GATA binding protein 6 1 4
MIRT506369 NUP155 nucleoporin 155kDa 1 3
MIRT506944 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 3
MIRT507498 E2F7 E2F transcription factor 7 1 3
MIRT513875 HOXA5 homeobox A5 1 1
MIRT520042 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 3
MIRT522365 NAP1L1 nucleosome assembly protein 1-like 1 1 2
MIRT543673 FAM135A family with sequence similarity 135, member A 1 1
MIRT545198 HIST1H2BD histone cluster 1, H2bd 1 1
MIRT546337 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT546451 SLC9A7 solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7 1 1
MIRT546786 RCC2 regulator of chromosome condensation 2 1 2
MIRT547252 NXPE3 neurexophilin and PC-esterase domain family, member 3 1 1
MIRT547452 MBD4 methyl-CpG binding domain protein 4 1 1
MIRT547580 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 2
MIRT547839 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 2
MIRT549502 ABHD2 abhydrolase domain containing 2 1 1
MIRT549582 ZNF850 zinc finger protein 850 1 1
MIRT551887 MMS22L MMS22-like, DNA repair protein 1 1
MIRT552124 MED10 mediator complex subunit 10 1 1
MIRT553344 TRPC3 transient receptor potential cation channel, subfamily C, member 3 1 2
MIRT554187 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT555194 PRUNE2 prune homolog 2 (Drosophila) 1 1
MIRT555553 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT556284 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT556979 HSPA4L heat shock 70kDa protein 4-like 1 1
MIRT559182 BRAP BRCA1 associated protein 1 1
MIRT560300 DFFA DNA fragmentation factor, 45kDa, alpha polypeptide 1 1
MIRT561214 ZSWIM1 zinc finger, SWIM-type containing 1 1 1
MIRT562353 EXOC8 exocyst complex component 8 1 1
MIRT565602 SLC35G1 solute carrier family 35, member G1 1 1
MIRT574793 FAM104A family with sequence similarity 104, member A 1 1
MIRT575598 Gnl1 guanine nucleotide binding protein-like 1 1 1
MIRT610362 GNL1 guanine nucleotide binding protein-like 1 1 1
MIRT617859 FMO4 flavin containing monooxygenase 4 1 1
MIRT698192 TMEM66 transmembrane protein 66 1 1
MIRT704410 CTPS1 CTP synthase 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*