Accession ID: MIRT042692 [miRNA, hsa-miR-196b-5p :: MSH6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-196bLinkOut: [miRBase ]
Synonyms MIRN196B, miR-196b, miRNA196B, MIR196B
Description Homo sapiens miR-196b stem-loop
Comment miR-196b is predicted based on sequence homology to miR-196a .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-196b-5p
Mature Sequence 15| UAGGUAGUUUCCUGUUGUUGGG |36
Evidence Experimental
Experiments Cloned
Putative hsa-miR-196b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MSH6 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GTBP, HNPCC5, HSAP
Description mutS homolog 6 (E. coli)
Transcript NM_0001    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MSH6 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MSH6
(miRNA target sites are highlighted)
>MSH6|NM_0001|3'UTR
   1 TAGACTGACTACATTGGAAGCTTTGAGTTGACTTCTGACAAAGGTGGTAAATTCAGACAACATTATGATCTAATAAACTT
  81 TATTTTTTAAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
 161 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ggguuguuguccuUUGAUGGAu 5'
                       :||||| | 
Target 5' -------tagactGACTACATt 3'
1 - 15 109.00 -5.12
2
miRNA  3' ggGU-UGUUGUCCUUUGAUGGAu 5'
            || ||||||    |: |:|| 
Target 5' ttCAGACAACA--TTATGATCTa 3'
52 - 72 92.00 -8.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-196b-5p :: MSH6    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ggGTTGTTGTCCTTTGATGGat 5'
            ||:|  |||||:||||::  
Target 5' ccCAGC--CAGGAGACTATTac 3'
13 - 32
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
49 hsa-miR-196b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001042 HOXB8 homeobox B8 3 3
MIRT004638 HOXC8 homeobox C8 4 3
MIRT007146 BCL2 B-cell CLL/lymphoma 2 0 1
MIRT007284 CD8A CD8a molecule 1 1
MIRT042654 HSD17B10 hydroxysteroid (17-beta) dehydrogenase 10 1 1
MIRT042655 ATF4 activating transcription factor 4 (tax-responsive enhancer element B67) 1 1
MIRT042656 MAPRE1 microtubule-associated protein, RP/EB family, member 1 1 1
MIRT042657 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT042658 MEPCE methylphosphate capping enzyme 1 1
MIRT042659 COX3 cytochrome c oxidase III 1 1
MIRT042660 PRKACA protein kinase, cAMP-dependent, catalytic, alpha 1 1
MIRT042661 PAXBP1 GC-rich sequence DNA-binding factor 1 1 1
MIRT042662 PALD1 KIAA1274 1 1
MIRT042663 GPS1 G protein pathway suppressor 1 1 1
MIRT042664 CHD2 chromodomain helicase DNA binding protein 2 1 1
MIRT042665 SLC6A15 solute carrier family 6 (neutral amino acid transporter), member 15 1 1
MIRT042666 PDE12 phosphodiesterase 12 1 1
MIRT042667 SLC23A2 solute carrier family 23 (nucleobase transporters), member 2 1 1
MIRT042668 TXNDC5 thioredoxin domain containing 5 (endoplasmic reticulum) 1 1
MIRT042669 BEST3 bestrophin 3 1 1
MIRT042670 ATP6 ATP synthase F0 subunit 6 1 1
MIRT042671 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT042672 HTR1D 5-hydroxytryptamine (serotonin) receptor 1D 1 1
MIRT042673 RTF1 Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT042674 CKB creatine kinase, brain 1 1
MIRT042675 MAT2A methionine adenosyltransferase II, alpha 1 1
MIRT042676 TRA2A transformer 2 alpha homolog (Drosophila) 1 1
MIRT042677 WHSC1L1 Wolf-Hirschhorn syndrome candidate 1-like 1 1 1
MIRT042678 CDK5R1 cyclin-dependent kinase 5, regulatory subunit 1 (p35) 1 1
MIRT042679 MRPS26 mitochondrial ribosomal protein S26 1 1
MIRT042680 AJUBA jub, ajuba homolog (Xenopus laevis) 1 1
MIRT042681 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT042682 REEP5 receptor accessory protein 5 1 1
MIRT042683 LAMB2 laminin, beta 2 (laminin S) 1 1
MIRT042684 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT042685 TXLNA taxilin alpha 1 1
MIRT042686 TUBB tubulin, beta 1 1
MIRT042687 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT042688 MFHAS1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT042689 LHX2 LIM homeobox 2 1 1
MIRT042690 BCAR3 breast cancer anti-estrogen resistance 3 1 1
MIRT042691 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) 1 1
MIRT042692 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT042693 HERC2 hect domain and RLD 2 1 1
MIRT042694 IARS isoleucyl-tRNA synthetase 1 1
MIRT042695 CACNB3 calcium channel, voltage-dependent, beta 3 subunit 1 1
MIRT042696 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT042697 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 1 1
MIRT042698 SNX9 sorting nexin 9 1 1