Accession ID: MIRT042718 [miRNA, hsa-miR-346 :: CKB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-346LinkOut: [miRBase ]
Synonyms MIRN346, hsa-mir-346, miR-346, miRNA346, MIR346
Description Homo sapiens miR-346 stem-loop
Comment This sequence is the predicted human homologue . The mature miRNA differs from the rat sequence at two positions, and its expression has not been verified in human.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-346
Mature Sequence 20| UGUCUGCCCGCAUGCCUGCCUCU |42
Evidence Not_experimental
Experiments
Expression Profile
Putative hsa-miR-346 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CKB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms B-CK, CKBB
Description creatine kinase, brain
Transcript NM_0018    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CKB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CKB
(miRNA target sites are highlighted)
>CKB|NM_0018|3'UTR
   1 TGAAGCCCGGCCCACACCCGACACCAGCCCTGCTGCTTCCTAACTTATTGCCTGGGCAGTGCCCACCATGCACCCCTGAT
  81 GTTCGCCGTCTGGCGAGCCCTTAGCCTTGCTGTAGAGACTTCCGTCACCCTTGGTAGAGTTTATTTTTTTGATGGCTAAG
 161 ATACTGCTGATGCTGAAATAAACTAGGGTTTTGGCCTGCCTGCGTCTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucuccguccguACG--CCCGUCugu 5'
                     |||  ||||||   
Target 5' tcctaacttatTGCCTGGGCAGtgc 3'
38 - 62 110.00 -12.30
2
miRNA  3' ucuccGUCCGUACG-CCCGUCUgu 5'
               | | ||  |  ||:|||  
Target 5' gacttCCGTCACCCTTGGTAGAgt 3'
117 - 140 106.00 -5.60
3
miRNA  3' ucuccguccguACGCCCG--UCUGu 5'
                     ||  |||  |||: 
Target 5' gtttattttttTGATGGCTAAGATa 3'
139 - 163 88.00 -6.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-346 :: CKB    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
57 hsa-miR-346 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000075 NRIP1 nuclear receptor interacting protein 1 1 1
MIRT000076 EFEMP2 EGF-containing fibulin-like extracellular matrix protein 2 4 2
MIRT001040 LIF leukemia inhibitory factor (cholinergic differentiation factor) 2 2
MIRT001128 BTK Bruton agammaglobulinemia tyrosine kinase 4 2
MIRT004219 BDH2 3-hydroxybutyrate dehydrogenase, type 2 2 1
MIRT004220 GALT galactose-1-phosphate uridylyltransferase 2 1
MIRT004221 SERHL serine hydrolase-like 2 1
MIRT004222 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT004223 FNTB farnesyltransferase, CAAX box, beta 2 2
MIRT004224 GGT5 gamma-glutamyltransferase 5 2 1
MIRT004225 GJC2 gap junction protein, gamma 2, 47kDa 2 2
MIRT004226 SETD4 SET domain containing 4 2 1
MIRT004227 TSTA3 tissue specific transplantation antigen P35B 2 1
MIRT004228 CFLAR CASP8 and FADD-like apoptosis regulator 2 1
MIRT004229 SSH3 slingshot homolog 3 (Drosophila) 2 2
MIRT004230 CRELD1 cysteine-rich with EGF-like domains 1 2 1
MIRT004231 CNPY3 canopy 3 homolog (zebrafish) 2 1
MIRT004232 NR2F6 nuclear receptor subfamily 2, group F, member 6 2 1
MIRT004233 CD247 CD247 molecule 2 1
MIRT004234 TERF1 telomeric repeat binding factor (NIMA-interacting) 1 2 2
MIRT004235 RXRB retinoid X receptor, beta 2 1
MIRT004236 DGCR2 DiGeorge syndrome critical region gene 2 2 1
MIRT004237 IL11RA interleukin 11 receptor, alpha 2 1
MIRT004238 INPP5J inositol polyphosphate-5-phosphatase J 2 1
MIRT004239 MAPK8IP1 mitogen-activated protein kinase 8 interacting protein 1 2 1
MIRT004240 MED16 mediator complex subunit 16 2 1
MIRT004241 RFX1 regulatory factor X, 1 (influences HLA class II expression) 2 1
MIRT004304 IL18 interleukin 18 (interferon-gamma-inducing factor) 4 2
MIRT006669 TAP1 transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) 2 1
MIRT016689 ZFP36 zinc finger protein 36, C3H type, homolog (mouse) 3 1
MIRT042699 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 1 1
MIRT042700 DCAF11 DDB1 and CUL4 associated factor 11 1 1
MIRT042701 RAD54B RAD54 homolog B (S. cerevisiae) 1 1
MIRT042702 PSMD1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 1 1
MIRT042703 EZH1 enhancer of zeste homolog 1 (Drosophila) 1 1
MIRT042704 PRDM16 PR domain containing 16 1 1
MIRT042705 GPI glucose-6-phosphate isomerase 1 1
MIRT042706 BCAP31 B-cell receptor-associated protein 31 1 1
MIRT042707 HDHD1 haloacid dehalogenase-like hydrolase domain containing 1A 1 1
MIRT042708 RAD51AP1 RAD51 associated protein 1 1 1
MIRT042709 ZCCHC24 zinc finger, CCHC domain containing 24 1 1
MIRT042710 SBF1 SET binding factor 1 1 1
MIRT042711 DGCR14 DiGeorge syndrome critical region gene 14 1 1
MIRT042712 PIK3R3 phosphoinositide-3-kinase, regulatory subunit 3 (gamma) 1 1
MIRT042713 APLP2 amyloid beta (A4) precursor-like protein 2 1 1
MIRT042714 MLLT4 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 1 1
MIRT042715 TEAD2 TEA domain family member 2 1 1
MIRT042716 RPL30 ribosomal protein L30 1 1
MIRT042717 FAM46A family with sequence similarity 46, member A 1 1
MIRT042718 CKB creatine kinase, brain 1 1
MIRT042719 CCHCR1 coiled-coil alpha-helical rod protein 1 1 1
MIRT042720 PRMT5 protein arginine methyltransferase 5 1 1
MIRT042721 BCOR BCL6 corepressor 1 1
MIRT042722 LIMK1 LIM domain kinase 1 1 1
MIRT042723 PSMA3 proteasome (prosome, macropain) subunit, alpha type, 3 1 1
MIRT042724 USP22 ubiquitin specific peptidase 22 1 1
MIRT042725 CNN2 calponin 2 1 1