Accession ID: MIRT042998 [miRNA, hsa-miR-324-3p :: RAB7A, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-324LinkOut: [miRBase ]
Synonyms MIRN324, hsa-mir-324, MIR324
Description Homo sapiens miR-324 stem-loop
Comment This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-324-3p
Mature Sequence 53| ACUGCCCCAGGUGCUGCUGG |72
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-324-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol RAB7A LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ20819, PRO2706, RAB7
Description RAB7A, member RAS oncogene family
Transcript NM_0046    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on RAB7A LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of RAB7A
(miRNA target sites are highlighted)
>RAB7A|NM_0046|3'UTR
   1 TGAGGGGGCAGTGAGAGTTGAGCACAGAGTCCTTCACAAACCAAGAACACACGTAGGCCTTCAACACAATTCCCCTCTCC
  81 TCTTCCAAACAAAACATACATTGATCTCTCACATCCAGCTGCCAAAAGAAAACCCCATCAAACACAGTTACACCCCACAT
 161 ATCTCTCACACACACACACACACGCACACACACACACACAGATCTGACGTAATCAAACTCCAGCCCTTGCCCGTGATGGC
 241 TCCTTGGGGTCTGCCTGCCCACCCACATGAGCCCGCGAGTATGGCAGCAGGACAAGCCAGCGGTGGAAGTCATTCTGATA
 321 TGGAGTTGGCATTGGAAGCTTATTCTTTTTGTTCACTGGAGAGAGAGAGAACTGTTTACAGTTAATCTGTGTCTAATTAT
 401 CTGATTTTTTTTATTGGTCTTGTGGTCTTTTTACCCCCCCTTTCCCCTCCCTCCTTGAAGGCTACCCCTTGGGAAGGCTG
 481 GTGCCCCATGCCCCATTACAGGCTCACACCCAGTCTGATCAGGCTGAGTTTTGTATGTATCTATCTGTTAATGCTTGTTA
 561 CTTTTAACTAATCAGATCTTTTTACAGTATCCATTTATTATGTAATGCTTCTTAGAAAAGAATCTTATAGTACATGTTAA
 641 TATATGCAACCAATTAAAATGTATAAATTAGTGTAAGAAATTCTTGGATTATGTGTTTAAGTCCTGTAATGCAGGCCTGT
 721 AAGGTGGAGGGTTGAACCCTGTTTGGATTGCAGAGTGTTACTCAGAATTGGGAAATCCAGCTAGCGGCAGTATTCTGTAC
 801 AGTAGACACAAGAATTATGTACGCCTTTTATCAAAGACTTAAGAGCCAAAAAGCTTTTCATCTCTCCAGGGGGAAAACTG
 881 TCTAGTTCCCTTCTGTGTCTAAATTTTCCAAAACGTTGATTTGCATAATACAGTGGTATGTGCAATGGATAAATTGCCGT
 961 TATTTCAAAAATTAAAATTCTCATTTTCTTTCTTTTTTTTCCCCCCTGCTCCACACTTCAAAACTCCCGTTAGATCAGCA
1041 TTCTACTACAAGAGTGAAAGGAAAACCCTAACAGATCTGTCCTAGTGATTTTACCTTTGTTCTAGAAGGCGCTCCTTTCA
1121 GGGTTGTGGTATTCTTAGGTTAGCGGAGCTTTTTCCTCTTTTCCCCACCCATCTCCCCAATATTGCCCATTATTAATTAA
1201 CCTCTTTCTTTGGTTGGAACCCTGGCAGTTCTGCTCCCTTCCTAGGATCTGCCCCTGCATTGTAGCTTGCTTAACGGAGC
1281 ACTTCTCCTTTTTCCAAAGGTCTACATTCTAGGGTGTGGGCTGAGTTCTTCTGTAAAGAGATGAACGCAATGCCAATAAA
1361 ATTGAACAAGAACAATGATAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ggucgucguggaCCCCGUCa 5'
                      ||||||| 
Target 5' --------tgagGGGGCAGt 3'
1 - 12 140.00 -15.10
2
miRNA  3' ggucgucGUGGA-CCCCGUCa 5'
                 || || | ||||| 
Target 5' ggaaatcCAGCTAGCGGCAGt 3'
771 - 791 117.00 -17.00
3
miRNA  3' ggucGUCGUGG-ACCCCGuca 5'
              ::|| || |||||:   
Target 5' gtgaTGGCTCCTTGGGGTctg 3'
233 - 253 100.00 -13.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-324-3p :: RAB7A    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
207 hsa-miR-324-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004682 WNT9B wingless-type MMTV integration site family, member 9B 2 1
MIRT004683 CREBBP CREB binding protein 2 1
MIRT004684 DVL2 dishevelled, dsh homolog 2 (Drosophila) 2 1
MIRT042812 PIKFYVE phosphoinositide kinase, FYVE finger containing 1 1
MIRT042813 RPL10A ribosomal protein L10a 1 1
MIRT042814 ACOT7 acyl-CoA thioesterase 7 1 1
MIRT042815 ACACA acetyl-CoA carboxylase alpha 1 1
MIRT042816 TOMM40 translocase of outer mitochondrial membrane 40 homolog (yeast) 1 1
MIRT042817 RPS3 ribosomal protein S3 1 1
MIRT042818 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT042819 ANKRD27 ankyrin repeat domain 27 (VPS9 domain) 1 1
MIRT042820 DLX2 distal-less homeobox 2 1 1
MIRT042821 PNMA2 paraneoplastic antigen MA2 1 1
MIRT042822 VOPP1 vesicular, overexpressed in cancer, prosurvival protein 1 1 1
MIRT042823 CTNND1 catenin (cadherin-associated protein), delta 1 1 1
MIRT042824 BAHD1 bromo adjacent homology domain containing 1 1 1
MIRT042825 TUBB tubulin, beta 1 1
MIRT042826 CDIP1 chromosome 16 open reading frame 5 1 1
MIRT042827 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT042828 HERC1 hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 1 1
MIRT042829 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT042830 IAH1 isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae) 1 1
MIRT042831 MAGI1 membrane associated guanylate kinase, WW and PDZ domain containing 1 1 1
MIRT042832 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT042833 CAPZB capping protein (actin filament) muscle Z-line, beta 1 1
MIRT042834 RFC1 replication factor C (activator 1) 1, 145kDa 1 1
MIRT042835 COX7A2L cytochrome c oxidase subunit VIIa polypeptide 2 like 1 1
MIRT042836 HSPA8 heat shock 70kDa protein 8 1 1
MIRT042837 NUDCD3 NudC domain containing 3 1 1
MIRT042838 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT042839 TUBG1 tubulin, gamma 1 1 1
MIRT042840 STK16 serine/threonine kinase 16 1 1
MIRT042841 ZSWIM6 zinc finger, SWIM-type containing 6 1 1
MIRT042842 ITCH itchy E3 ubiquitin protein ligase homolog (mouse) 1 1
MIRT042843 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT042844 CACNA1I calcium channel, voltage-dependent, T type, alpha 1I subunit 1 1
MIRT042845 ARHGAP26 Rho GTPase activating protein 26 1 1
MIRT042846 DCLRE1C DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) 1 1
MIRT042847 MAT2A methionine adenosyltransferase II, alpha 1 1
MIRT042848 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 1 1
MIRT042849 STAT5B signal transducer and activator of transcription 5B 1 1
MIRT042850 IQGAP1 IQ motif containing GTPase activating protein 1 1 1
MIRT042851 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) 1 1
MIRT042852 NOL12 nucleolar protein 12 1 1
MIRT042853 HMGA1 high mobility group AT-hook 1 1 1
MIRT042854 ZNF23 zinc finger protein 23 (KOX 16) 1 1
MIRT042855 SLC25A1 solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 1 1
MIRT042856 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT042857 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT042858 RAB18 RAB18, member RAS oncogene family 1 1
MIRT042859 PSAP prosaposin 1 1
MIRT042860 DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) 1 1
MIRT042861 CCND2 cyclin D2 1 1
MIRT042862 UNC45B unc-45 homolog B (C. elegans) 1 1
MIRT042863 PHF17 PHD finger protein 17 1 1
MIRT042864 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT042865 MED24 mediator complex subunit 24 1 1
MIRT042866 SLC2A1 solute carrier family 2 (facilitated glucose transporter), member 1 1 1
MIRT042867 DDOST dolichyl-diphosphooligosaccharide--protein glycosyltransferase 1 1
MIRT042868 FKBP9 FK506 binding protein 9, 63 kDa 1 1
MIRT042869 EBI3 Epstein-Barr virus induced 3 1 1
MIRT042870 MPRIP myosin phosphatase Rho interacting protein 1 1
MIRT042871 FADS2 fatty acid desaturase 2 1 1
MIRT042872 SLC25A39 solute carrier family 25, member 39 1 1
MIRT042873 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT042874 CCT6A chaperonin containing TCP1, subunit 6A (zeta 1) 1 1
MIRT042875 ARRDC4 arrestin domain containing 4 1 1
MIRT042876 PKM pyruvate kinase, muscle 1 1
MIRT042877 RUVBL2 RuvB-like 2 (E. coli) 1 1
MIRT042878 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT042879 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT042880 TRAK1 trafficking protein, kinesin binding 1 1 1
MIRT042881 PPFIA1 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 1 1
MIRT042882 STX16 syntaxin 16 1 1
MIRT042883 ARHGAP17 Rho GTPase activating protein 17 1 1
MIRT042884 GTF2H2 general transcription factor IIH, polypeptide 2, 44kDa 1 1
MIRT042885 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT042886 SYNJ2 synaptojanin 2 1 1
MIRT042887 EIF3B eukaryotic translation initiation factor 3, subunit B 1 1
MIRT042888 SMS spermine synthase 1 1
MIRT042889 SACM1L SAC1 suppressor of actin mutations 1-like (yeast) 1 1
MIRT042890 FASN fatty acid synthase 1 1
MIRT042891 RPLP0 ribosomal protein, large, P0 1 1
MIRT042892 EBP emopamil binding protein (sterol isomerase) 1 1
MIRT042893 FXR2 fragile X mental retardation, autosomal homolog 2 1 1
MIRT042894 RPLP1 ribosomal protein, large, P1 1 1
MIRT042895 CCNF cyclin F 1 1
MIRT042896 CDK5RAP2 CDK5 regulatory subunit associated protein 2 1 1
MIRT042897 UBE3B ubiquitin protein ligase E3B 1 1
MIRT042898 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 1 1
MIRT042899 TNIP1 TNFAIP3 interacting protein 1 1 1
MIRT042900 CSNK1A1 casein kinase 1, alpha 1 1 1
MIRT042901 ANXA11 annexin A11 1 1
MIRT042902 KLHDC2 kelch domain containing 2 1 1
MIRT042903 CXXC1 CXXC finger 1 (PHD domain) 1 1
MIRT042904 RBM10 RNA binding motif protein 10 1 1
MIRT042905 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT042906 ZMIZ2 zinc finger, MIZ-type containing 2 1 1
MIRT042907 CLUAP1 clusterin associated protein 1 1 1
MIRT042908 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT042909 UBC ubiquitin C 1 1
MIRT042910 TACC3 transforming, acidic coiled-coil containing protein 3 1 1
MIRT042911 GNAS GNAS complex locus 1 1
MIRT042912 POGZ pogo transposable element with ZNF domain 1 1
MIRT042913 PRRC2B HLA-B associated transcript 2-like 1 1 1
MIRT042914 RPL4 ribosomal protein L4 1 1
MIRT042915 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 1 1
MIRT042916 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT042917 MCM4 minichromosome maintenance complex component 4 1 1
MIRT042918 ACLY ATP citrate lyase 1 1
MIRT042919 KDELR2 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 1 1
MIRT042920 NSRP1 coiled-coil domain containing 55 1 1
MIRT042921 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT042922 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT042923 CIZ1 CDKN1A interacting zinc finger protein 1 1 1
MIRT042924 FAXC chromosome 6 open reading frame 168 1 1
MIRT042925 TCTN1 tectonic family member 1 1 1
MIRT042926 SRF serum response factor (c-fos serum response element-binding transcription factor) 1 1
MIRT042927 PITPNM2 phosphatidylinositol transfer protein, membrane-associated 2 1 1
MIRT042928 HIST1H1C histone cluster 1, H1c 1 1
MIRT042929 VARS valyl-tRNA synthetase 1 1
MIRT042930 HIST1H2AJ histone cluster 1, H2aj 1 1
MIRT042931 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT042932 PTPN14 protein tyrosine phosphatase, non-receptor type 14 1 1
MIRT042933 DERL2 Der1-like domain family, member 2 1 1
MIRT042934 POLR2C polymerase (RNA) II (DNA directed) polypeptide C, 33kDa 1 1
MIRT042935 RPL31 ribosomal protein L31 1 1
MIRT042936 CD151 CD151 molecule (Raph blood group) 1 1
MIRT042937 FOXRED1 FAD-dependent oxidoreductase domain containing 1 1 1
MIRT042938 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT042939 CECR5 cat eye syndrome chromosome region, candidate 5 1 1
MIRT042940 SAE1 SUMO1 activating enzyme subunit 1 1 1
MIRT042941 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT042942 ODC1 ornithine decarboxylase 1 1 1
MIRT042943 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT042944 MAST4 microtubule associated serine/threonine kinase family member 4 1 1
MIRT042945 TMX4 thioredoxin-related transmembrane protein 4 1 1
MIRT042946 RBM26 RNA binding motif protein 26 1 1
MIRT042947 FUBP1 far upstream element (FUSE) binding protein 1 1 1
MIRT042948 TRIM65 tripartite motif-containing 65 1 1
MIRT042949 SIX1 SIX homeobox 1 1 1
MIRT042950 NEK9 NIMA (never in mitosis gene a)- related kinase 9 1 1
MIRT042951 HEXIM1 hexamethylene bis-acetamide inducible 1 1 1
MIRT042952 NHP2 NHP2 ribonucleoprotein homolog (yeast) 1 1
MIRT042953 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT042954 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT042955 RPL35A ribosomal protein L35a 1 1
MIRT042956 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT042957 HSPA9 heat shock 70kDa protein 9 (mortalin) 1 1
MIRT042958 PLEKHB2 pleckstrin homology domain containing, family B (evectins) member 2 1 1
MIRT042959 SPRY1 sprouty homolog 1, antagonist of FGF signaling (Drosophila) 1 1
MIRT042960 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT042961 MED15 mediator complex subunit 15 1 1
MIRT042962 DAZAP2 DAZ associated protein 2 1 1
MIRT042963 APRT adenine phosphoribosyltransferase 1 1
MIRT042964 DDX18 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 1 1
MIRT042965 RAD23A RAD23 homolog A (S. cerevisiae) 1 1
MIRT042966 PTBP3 ROD1 regulator of differentiation 1 (S. pombe) 1 1
MIRT042967 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT042968 PUM1 pumilio homolog 1 (Drosophila) 1 1
MIRT042969 TJP1 tight junction protein 1 (zona occludens 1) 1 1
MIRT042970 VPS4A vacuolar protein sorting 4 homolog A (S. cerevisiae) 1 1
MIRT042971 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT042972 PKN3 protein kinase N3 1 1
MIRT042973 KDM2B lysine (K)-specific demethylase 2B 1 1
MIRT042974 FEN1 flap structure-specific endonuclease 1 1 1
MIRT042975 PRRC2C HLA-B associated transcript 2-like 2 1 1
MIRT042976 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT042977 APOLD1 apolipoprotein L domain containing 1 1 1
MIRT042978 CCDC109B coiled-coil domain containing 109B 1 1
MIRT042979 NFATC3 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 1 1
MIRT042980 COX7C cytochrome c oxidase subunit VIIc 1 1
MIRT042981 RPL10 ribosomal protein L10 1 1
MIRT042982 TMED9 transmembrane emp24 protein transport domain containing 9 1 1
MIRT042983 ST3GAL2 ST3 beta-galactoside alpha-2,3-sialyltransferase 2 1 1
MIRT042984 DUS2L dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae) 1 1
MIRT042985 RPS8 ribosomal protein S8 1 1
MIRT042986 SBF1 SET binding factor 1 1 1
MIRT042987 AGFG2 ArfGAP with FG repeats 2 1 1
MIRT042988 ATXN2L ataxin 2-like 1 1
MIRT042989 KDM5C lysine (K)-specific demethylase 5C 1 1
MIRT042990 FBXL2 F-box and leucine-rich repeat protein 2 1 1
MIRT042991 VPS18 vacuolar protein sorting 18 homolog (S. cerevisiae) 1 1
MIRT042992 MYO6 myosin VI 1 1
MIRT042993 PLEKHG2 pleckstrin homology domain containing, family G (with RhoGef domain) member 2 1 1
MIRT042994 ATPIF1 ATPase inhibitory factor 1 1 1
MIRT042995 PPIE peptidylprolyl isomerase E (cyclophilin E) 1 1
MIRT042996 TAPBP TAP binding protein (tapasin) 1 1
MIRT042997 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT042998 RAB7A RAB7A, member RAS oncogene family 1 1
MIRT042999 PPP1R10 protein phosphatase 1, regulatory (inhibitor) subunit 10 1 1
MIRT043000 POU2F1 POU class 2 homeobox 1 1 1
MIRT043001 MCRS1 microspherule protein 1 1 1
MIRT043002 SAP18 Sin3A-associated protein, 18kDa 1 1
MIRT043003 ACTN4 actinin, alpha 4 1 1
MIRT043004 EIF3M eukaryotic translation initiation factor 3, subunit M 1 1
MIRT043005 UBE2Z ubiquitin-conjugating enzyme E2Z 1 1
MIRT043006 SCYL1 SCY1-like 1 (S. cerevisiae) 1 1
MIRT043007 WDR46 WD repeat domain 46 1 1
MIRT043008 SON SON DNA binding protein 1 1
MIRT043009 MED25 mediator complex subunit 25 1 1
MIRT043010 ZNF432 zinc finger protein 432 1 1
MIRT043011 SETDB1 SET domain, bifurcated 1 1 1
MIRT043012 TNKS tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 1 1
MIRT043013 CXXC5 CXXC finger 5 1 1
MIRT043014 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT043015 RPS5 ribosomal protein S5 1 1